Human Reproduction, Vol. 17, No. 6, 1578-1583,
June 2002
© 2002 European Society of Human Reproduction and Embryology
Increased (CTG/CAG)n lengths in myotonic dystrophy type 1 and MachadoJoseph disease genes in idiopathic azoospermia patients
1 Department of Life Sciences and 2 Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan, Republic of China
| Abstract |
|---|
|
|
|---|
BACKGROUND: An increase in CAG trinucleotide repeat length in the androgen receptor (AR) gene has been linked to idiopathic azoospermia. METHODS: In order to test whether other (CAG/CTG)n loci are also affected, the (CAG/CTG)n frequency distribution at myotonic dystrophy type 1 (DM1), MachadoJoseph disease (MJD), dentatorubral-pallidoluysian atrophy (DRPLA) and spinocerebellar ataxia type 8 (SCA8) loci, in addition to the AR gene, was investigated in 48 azoospermia patients and 47 controls. RESULTS: The median CAG repeat length in the AR gene was significantly longer in azoospermia patients than in controls (23 versus 21, P < 0.001). Significant differences were also noted in the upper tails of trinucleotide repeat length distributions at both DM1 and MJD loci between the two populations. At the DM1 locus, alleles of more than 18 repeats were observed only in azoospermia patients, and not in controls (P = 0.014). At the MJD locus, the frequency of normal alleles (ANs) with 29 or more CAG repeats was also much higher in azoospermia patients (29.2 versus 7.4%; P = 0.0001). However, the repeat length distribution at DRPLA and SCA8 loci did not differ in the two groups. CONCLUSIONS: These data indicated that, at least in a subset of azoospermia patients, there was an increase in the number of trinucleotide repeats in some disease loci. Thus, it is noteworthy to evaluate whether offspring of these azoospermia patients, if born by assisted reproductive technologies, have an increased risk of trinucleotide repeat diseases.
Key words: DM1/genetic instability/idiopathic azoospermia/MJD/trinucleotide repeats
| Introduction |
|---|
|
|
|---|
Azoospermia is a common form of male infertility for which the underlying cause is largely unknown. Recent studies have suggested that many of the so-called idiopathic azoospermia may have a genetic basis. For example, increased length of a polymorphic CAG repeat sequence in exon 1 of the androgen receptor (AR) gene was shown to be associated with idiopathic azoospermia (Dowsing et al., 1999
The CAG repeat in the AR gene encodes a polyglutamine tract in the transactivation domain of the protein. The length of this repeat has been shown to be inversely correlated to the transactivation activity of AR (Chamberlain et al., 1994
; Kazemi-Esfarjani et al., 1995
). It appeared that shorter CAG repeat length was associated with an increased risk of prostate cancer (Giovannucci et al., 1997
), as well as with the progression of breast cancer (Yu et al., 2000
). In addition to male infertility, longer CAG repeat length was also shown to be linked with endometrial carcinoma (Sasaki et al., 2000
), and might also increase the risk of BRCA1-associated breast cancer (Rebbeck et al., 1999
) and male breast cancer (Young et al., 2000
). Marked expansion of this CAG repeat (>40) in the AR gene is the genetic cause for spinal and bulbar muscular atrophy (SBMA, also known as Kennedy disease), with which androgen insensitivity and testicular atrophy are usually associated (Nagashima et al., 1988
; La Spada et al., 1991
).
Expansions of unstable trinucleotide repeats in a number of other gene loci also lead to many other non-reproductive hereditary disorders. Examples include CGG or CCG expansion in fragile X syndrome (FRAX), CTG expansion in myotonic dystrophy type 1 (DM1), CAG expansions in Huntington disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinocerebellar ataxias (SCAs, 1, 2, 6, 7) and MachadoJoseph disease (MJD). Although exactly how these repeat expansions cause disease is not clear, a hallmark of these diseases is `anticipation'; i.e. the severity is greater and/or the age of onset becomes earlier in successive generations within the family (Timchenko and Caskey, 1996
). The clinical severity of these diseases is positively correlated with the length of the expanded trinucleotide repeats. Since the repeat length increases as it is transmitted, it is thought that the molecular basis of anticipation is meiotic instability of the trinucleotide repeat. In addition to instability during gametogenesis, these trinucleotide repeats are also unstable in somatic cells, resulting in somatic heterogeneity (Timchenko and Caskey, 1996
).
Recent advances in assisted reproductive technology, such as ICSI, have made it possible to treat most forms of azoospermia. However, the safety of ICSI remains of great concern because the overall genetic constitutions of azoospermia patients are not clear. Based on the facts that CAG repeat length in the AR gene may be enhanced in idiopathic azoospermia patients (Dowsing et al., 1999
; Yoshida et al., 1999
; Mifsud et al., 2001
) and that testicular atrophy or reduced fertility is often associated with CTG repeat expansion in certain male DM1 patients (Harper, 1989
; Hortas et al., 2000
), it is important to know whether increases in trinucleotide repeat length might be found in other disease genes associated with expansion of trinucleotide repeats besides AR in idiopathic azoospermia patients.
DM1 is caused by a CTG expansion in the 3'-untranslated region of the DM1 protein kinase (DM1PK) gene. MJD is the most popular form among the CAG trinucleotide repeat diseases, whereas DRPLA is relatively rare. SCA8 is a newly defined disorder which contains CTG expansion in an untranslated region instead of CAG expansion found in the coding region of other SCAs (Koob et al., 1999
). In this study, the (CTG/CAG)n distribution at the AR, DM1, MJD, DRPLA and SCA8 loci was investigated and compared in 48 idiopathic azoospermia patients and 47 normal male individuals, in order to test whether azoospermia patients contain longer trinucleotide repeat lengths in these disease loci.
| Materials and methods |
|---|
|
|
|---|
Study groups
The 48 azoospermia patients were recruited from infertility clinics and were aged between 25 and 40 years. The patients were examined by either a urologist or a gynaecologist in the clinics, and were confirmed as having non-obstructive azoospermia. Patients who had varicocele and other obstructive syndromes of the seminal tract were excluded. The 47 controls were unrelated Taiwanese males who were of similar age to the patients, apparently healthy, and proven fertile. All subjects provided their informed consent before blood samples were collected. A cytogenetic examination was carried out on each subject to confirm that all had normal male karyotypes.
Determination of trinucleotide repeat lengths
Genomic DNA was extracted from the peripheral blood of each subject using a Puregene genomic DNA isolation kit (Gentra System, Minneapolis, MN, USA). The trinucleotide repeat length was determined by [35S]-dATP incorporated PCR followed by electrophoresis on denaturing polyacrylamide gel with 7 mol/l urea, as described previously (Hsiao et al., 1999
). When a single band was obtained for a particular locus, it was proved to be homozygous by PCR-based Southern blot analysis (Hsiao et al., 1999
). Some of the fragments were also sequenced to verify accuracy in the trinucleotide repeat number calculation. All PCR reactions were denatured for 5 min at 95°C, followed by 30 cycles of 1 min at 95°C, 1 min at annealing temperature, 1 min at 72°C, and completed by a final extension for 10 min at 72°C. The annealing temperatures were 55, 62, 61, 58 and 54°C for AR, DM1, MJD, DRPLA and SCA8 respectively. The reaction mixtures contained 10 ng genomic DNA, 400 µmol of dNTP, 0.5 µmol of each primer, 5 µCi of
-[35S]-dATP, 1X PCR buffer (J buffer for AR, I buffer for DM1, SCA8 and MJD, and K buffer for DRPLA) and 0.25 U of DNA polymerase, using the FailSafeTM PCR system (Epicentre, Madison, WI, USA). The primer sequences were as described (Fu et al., 1991
; Kawaguchi et al., 1994
; Koide et al., 1994
; Monckton et al., 1995
; Koob et al., 1999
): for AR, 5'ACCAGGTAGCCTGTGGGGCCTCTA CGATGGGC3'(sense) and 5'CCAGAGCGTGCGCGAAGTGATCCAGAACCCG3' (antisense); for DM1, 5'CAGTTCACAACCGCTCCGAG3' (sense) and 5'CTTCCCAGGCCTGCAGTTTGCCCATC3' (antisense); for MJD, 5'CCAGTGACTACTTTGATTCG3' (sense) and 5'ATCCATGTGCAAAGGCCAGCC3' (antisense); for DRPLA, 5'CACCAGTCTCAACACATCACCATC3' (sense) and 5'CCTCCAGTGGGTGGGGAAATGCTC3' (antisense); for SCA8, 5'TTTGAGAAAGGCTTGTGAGGACTGAGAATG3' (sense) and 5'GGTCCTTCATGTTAGAAAACCTGGCT3' (antisense).
Statistical analysis
The median, mean and standard error of the mean trinucleotide repeat length for each locus were calculated. Since the (CTG/CAG)n lengths did not follow the normal distribution, the difference between azoospermia and control groups was tested by the MannWhitney U-test, and the difference of the frequency of larger alleles in each locus between azoospermia and control groups was tested by
2 analysis. A P-value < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
The median AR CAG repeat length was significantly higher in azoospermia patients than in fertile controls (23 versus 21; P < 0.001) (Table I
|
|
|
To test whether other (CAG/CTG)n loci were affected in the genome of azoospermia patients, trinucleotide repeat numbers at four other disease loci, DM1, MJD, DRPLA and SCA8, were also determined in both patients and controls used in AR locus study. The mean, median and size range of trinucleotide repeat length at each locus in the two groups are listed in Table I
The distribution of MJD alleles in the control group was also bimodal, with the highest peak at 16 repeat and the second peak at 28 repeat (Figure 1C
). The distribution of MJD alleles in the azoospermia group was more diverse, with the second peak shifted to the right by two to three repeats (3031 repeats). Statistical analysis showed that there was a significant over-representation of normal alleles (ANs) with 29 or more repeats in azoospermia patients (P = 0.0001; Table II
).
Frequency distributions of trinucleotide repeat lengths in the DRPLA and the recently defined SCA8 loci are shown in Figure 1D and E
respectively. In the DRPLA locus, some (CAG)>20 alleles were observed that had not been reported previously in a normal Caucasian population; otherwise, the size ranges in the two groups were the same. In the SCA8 locus, the allele size ranged from 15 to 34 in control group, and from 18 to 39 in the azoospermia group (Table I
). Likewise, a previous report had shown that >99% of the ANs had 1637 repeats in this locus (Koob et al., 1999
). In contrast to the DM1 and MJD loci, there were no differences in either the medians of trinucleotide repeat lengths or the frequencies of high-range alleles (>20 repeats for DRPLA or >30 repeats for SCA8) between the azoospermia and control groups in both the DRPLA and SCA8 genes (Tables I and II![]()
).
Subsequently, the trinucleotide repeat lengths for all five loci in each of the azoospermia patients were carefully examined in order to investigate whether a person with large ANs at one of these loci was likely to have large ANs at other loci. The repeat numbers in all five genes for 13 patients having large ANs in the AR (>27), DM1 (>18) or MJD (>29) loci are listed in Table III
. Among these 13 patients, seven were found to have large ANs in the AR/DM1 (patient A21), AR/MJD (patients A41 and A25), or DM1/MJD (patients A32, A36, A38, A40) loci. For patient A41, large ANs were also present in the SCA8 locus. Patients A17 and A27 contained large ANs in DRPLA and SCA8 loci respectively, in addition to the MJD locus.
|
| Discussion |
|---|
|
|
|---|
Consistent with previous reports (Dowsing et al., 1999
Further analysis of the association of repeat lengths among different loci showed that most azoospermia patients with large ANs in the AR, DM1 or MJD loci also had large ANs at certain other loci (Table III
). This increase in repeat length was not universal, however, since a patient with large ANs in one locus did not necessarily contain large ANs in all other loci. These data do not argue for an underlying defect in a common mechanism maintaining genome integrity, such as DNA replication or mismatch repair, in azoospermia patients. However, the results of the present study suggested that the genetic defects in azoospermia patients might somehow contribute to the trinucleotide repeat instability at certain loci.
It has been shown that the prevalence of DM1 in a population is positively correlated with the number of alleles in the upper tail of the frequency distribution (Tishkoff et al., 1998
; Mor-Cohen et al., 1997a
,b
). Similarly, there is a close association between the prevalence of MJD and the frequency of large ANs in distinct ethnic populations (Takano et al., 1998
). An increasing amount of data has supported the hypothesis that the large ANs may further expand and thus contribute to generation of the trinucleotide repeat diseases. Therefore, an increased frequency of large ANs in the DM1 and MJD loci in the idiopathic azoospermia population may result in a greater predisposition towards DM1 and MJD. Since these trinucleotide repeat diseases are dominantly inherited, and many of them also show anticipation phenomena, it is very important to monitor the transmission of any large alleles to see whether they indeed continue to expand into disease alleles.
ICSI has become a powerful technology for men with various spermatogenic disorders to increase their prospects of parenthood. However, the genetic constitution of these infertile patientsand thus the safety of this technologyis of great concern. The present data indicated that, at least in a subset of the idiopathic azoospermia patients, the trinucleotide repeat length was increased in some disease loci. This implied that these idiopathic azoospermia patients might be carriers of larger trinucleotide repeat alleles, and that this may ultimately result in an increased prevalence of heritable diseases among their offspring. The application of ICSI in the treatment of azoospermia patients, therefore, should be undertaken only after thorough genetic evaluation and screening, as was suggested previously (Johnson, 1998
; Kim et al., 1998
).
In summary, the present results showed that the trinucleotide repeat lengths at the DM1, MJD and AR loci, but not at DRPLA or SCA8, were significantly larger in idiopathic azoospermia patients than in control subjects. Whether the pathological mechanism of idiopathic azoospermia is associated with the mechanism that contributes to trinucleotide repeat instability remains to be further elucidated.
| Acknowledgements |
|---|
|
|
|---|
The authors thank Dr Shan-Li Tseng for providing the azoospermia samples and Dr C.-C. Lin for reading the manuscript. This work was supported in part by grants from National Science Council, Taiwan (NSC89-2320-B-040-018 and NSC89-2320-B-040068) and from Chung-Shan Medical University (CSMC87-OM-B-001).
| Notes |
|---|
3 To whom correspondence should be addressed at: Department of Life Sciences, Chung Shan Medical University, No. 110, Sec. 1, Chien-Kuo North Road, Taichung, Taiwan 402, Republic of China. E-mail: kmh{at}csmu.edu.tw
| References |
|---|
|
|
|---|
Chamberlain, N.L., Driver, E.D. and Miesfeld, R.L. (1994) The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Res., 22, 31813186.
Dowsing, A.T., Yong, E.L., Clark, M., McLachlan, R.I., de Kretser, D.M. and Trounson, A.O. (1999) Linkage between male infertility and trinucleotide repeat expansion in the androgen-receptor gene. Lancet, 354, 640643.[Web of Science][Medline]
Fu, Y.H., Kuhl, D.P., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, S., Verkerk, A.J., Holden, J.J., Fenwick, R.G. Jr, Warren, S.T. et al. (1991) Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell, 67, 10471058.[Web of Science][Medline]
Giovannucci, E., Stampfer, M.J., Krithivas, K., Brown, M., Dahl, D., Brufsky, A., Talcott, J., Hennekens, C.H. and Kantoff, P.W. (1997) The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. Proc. Natl Acad. Sci. USA, 94, 33203323.
Harper, P.S. (1989) The myotonic disorders. In Emery, A.E.A. and Rimoin, D.L. (eds), Principles and Practice of Medical Genetics, 2nd edn. Churchill Livingstone, Edinburgh.
Hortas, M.L., Castilla, J.A., Gil, M.T., Molina, J., Garrido, M.L., Morell, M. and Redondo, M. (2000) Decreased sperm function of patients with myotonic muscular dystrophy. Hum. Reprod., 15, 445448.
Hsiao, K.M., Lin, H.M., Pan, H., Li, T.C., Chen, S.S., Jou, S.B., Chiu, Y.L., Wu, M.F., Lin, C.C. and Li, S.Y. (1999) Application of FTA sample collection and DNA purification system on the determination of CTG trinucleotide repeat size by PCR-based Southern blotting. J. Clin. Lab. Anal., 13, 188193.[Web of Science][Medline]
Jansen, G., Mahadevan, M., Amemiya, C., Wormskamp, N., Segers, B., Hendriks, W., O'Hoy, K., Baird, S., Sabourin, L., Lennon, G. et al. (1992) Characterization of the myotonic dystrophy region predicts multiple protein isoform-encoding mRNAs. Nature Genet., 1, 261266.[Web of Science][Medline]
Johnson, M.D. (1998) Genetic risks of intracytoplasmic sperm injection in the treatment of male infertility: recommendations for genetic counseling and screening. Fertil. Steril., 70, 397411.[Web of Science][Medline]
Kawaguchi, Y., Okamoto, T., Taniwaki, M., Aizawa, M., Inoue, M., Katayama, S., Kawakami, H., Nakamura, S., Nishimura, M., Akiguchi, I. et al. (1994) CAG expansions in a novel gene for Machado-Joseph disease at chromosome 14q32.1. Nature Genet., 8, 221227.[Web of Science][Medline]
Kazemi-Esfarjani, P., Trifiro, M.A. and Pinsky, L. (1995) Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenic relevance for the (CAG)n-expanded neuronpathies. Hum. Mol. Genet., 4, 523527.
Kim, E.D., Bischoff, F.Z., Lipshultz, L.I. and Lamb, D.J. (1998) Genetic concerns for the subfertile male in the era of ICSI. Prenat. Diagn., 18, 13491365.[Web of Science][Medline]
Koide, R., Ikeuchi, T., Onodera, O., Tanaka, H., Igarashi, S., Endo, K., Takahashi, H., Kondo, R., Ishikawa, A., Hayashi, T. et al. (1994) Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nature Genet., 6, 913.[Web of Science][Medline]
Koob, M.D., Moseley, M.L., Schut, L.J., Benzow, K.A., Bird, T.D., Day, J.W. and Ranum, L.P. (1999) An untranslated CTG expansion causes a novel form of spinocerebellar ataxia (SCA8). Nature Genet., 21, 379384.[Web of Science][Medline]
La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. and Fischbeck, K.H. (1991) Androgen gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 7779.[Medline]
Mifsud, A., Sim, C.K., Boettger-Tong, H., Moreira, S., Lamb, D.J., Lipshultz, L.I. and Yong, E.L. (2001) Trinucleotide (CAG) repeat polymorphisms in the androgen receptor gene: molecular markers of risk for male infertility. Fertil. Steril., 75, 275281.[Web of Science][Medline]
Monckton, D.G., Wong, L.J., Ashizawa, T. and Caskey, C.T. (1995) Somatic mosaicism, germline expansions, germline reversions and intergenerational reductions in myotonic dystrophy males: small pool PCR analyses. Hum. Mol. Genet., 4, 18.[Web of Science][Medline]
Mor-Cohen, R., Magal, N., Gadoth, N., Shohat, T. and Shohat, M. (1997a) Correlation between the incidence of myotonic dystrophy in different groups in Israel and the number of CTG trinucleotide repeats in the myotonic gene. Am. J. Med. Genet., 71, 156159.[Web of Science][Medline]
Mor-Cohen, R., Magal, N., Gadoth, N., Achiron, A., Shohat, T. and Shohat, M. (1997b) The lower incidence of myotonic dystrophy in Ashkenazic Jews compared to North African Jews is associated with a significantly lower number of CTG trinucleotide repeats. Isr. J. Med. Sci., 33, 190193.[Web of Science][Medline]
Nagashima, T., Seko, K., Hirose, K., Mannen, T., Yoshimura, S., Arima, R., Nagashima, K. and Morimatsu, Y. (1988) Familial bulbospinal muscular atrophy associated with testicular atrophy and sensory neuropathy: autopsy case report of two brothers. J. Neurol. Sci., 87, 141152.[Web of Science][Medline]
Pan, H., Lin, H.M., Ku, W.Y., Li, T.C., Li, S.Y. and Hsiao, K.M. (2001) Haplotype analysis of the myotonic dystrophy type 1 (DM1) locus in Taiwan: implications for low prevalence and founder mutations of Taiwanese myotonic dystrophy type 1. Eur. J. Hum. Genet., 9, 638641.[Web of Science][Medline]
Paulson, H.L., Das, S.S., Crino, P.B., Perez, M.K., Patel, S.C., Gotsdiner, D., Fischbeck, K.H. and Pittman, R.N. (1997) Machado-Joseph disease gene product is a cytoplasmic protein widely expressed in brain. Ann. Neurol., 41, 453462.[Web of Science][Medline]
Rebbeck, T.R., Kantoff, P.W., Krithivas, K., Neuhausen, S., Blackwood, M.A., Godwin, A.K., Daly, M.B., Narod, S.A., Garber, J.E., Lynch, H.T. et al. (1999) Modification of BRCA1-associated breast cancer risk by the polymorphic androgen-receptor CAG repeat. Am. J. Hum. Genet., 64, 13711377.[Web of Science][Medline]
Sasaki, M., Dahiya, R., Fujimoto, S., Ishikawa, M. and Oshimura, M. (2000) The expansion of the CAG repeat in exon 1 of the human androgen receptor gene is associated with uterine endometrial carcinoma. Mol. Carcinogen., 27, 237244.[Web of Science][Medline]
Strachan, T. and Read, A.P. (eds) (1999) Human Molecular Genetics, 2nd edn. John Wiley & Sons (Asia), Singapore.
Takano, H., Cancel, G., Ikeuchi, T., Lorenzetti, D., Mawad, R., Stevanin, G., Didierjean, O., Durr, A., Oyake, M., Shimohata, T. et al. (1998) Close association between prevalences of dominantly inherited spinocerebellar ataxia with CAG-repeat expansions and frequencies of large normal CAG alleles in Japanese and Caucasian populations. Am. J. Hum. Genet., 63, 10601066.[Web of Science][Medline]
Timchenko, L.T. and Caskey, C.T. (1996) Trinucleotide repeat disorders in humans: discussions of mechanisms and medical issues. FASEB J., 10, 15891597.[Abstract]
Tishkoff, S.A., Goldman, A., Calafell, F., Speed, W.C., Deinard, A.S., Bonne-Tamir, B., Kidd, J.R., Pakstis, A.J., Jenkins, T. and Kidd, K.K. (1998) A global haplotype analysis of the myotonic dystrophy locus: implications for the evolution of modern humans and for the origin of myotonic dystrophy mutations. Am. J. Hum. Genet., 62, 13891402.[Web of Science][Medline]
Wang, G., Ide, K., Nukina, N., Goto, J., Ichikawa, Y., Uchida, K., Sakamoto, T. and Kanazawa, I. (1997) Machado-Joseph disease gene product identified in lymphocytes and brain. Biochem. Biophys. Res. Commun., 233, 476479.[Web of Science][Medline]
Waring, J.D. and Korneluk, R.G. (1998) Myotonic dystrophy. In Oostra, B.A. (ed.), Trinucleotide Diseases and Instability. Springer-Verlag, Heidelberg.
Yoshida, K.I., Yano, M., Chiba, K., Honda, M. and Kitahara, S. (1999) CAG repeat length in the androgen receptor gene is enhanced in patients with idiopathic azoospermia. Urology, 54, 10781081.[Web of Science][Medline]
Young, I.E., Kurian, K.M., Mackenzie. M.A., Kunkler, I.H., Cohen, B.B., Hooper, M.L., Wyllie, A.H. and Steel, C.M. (2000) The CAG repeat within the androgen receptor gene in male breast cancer patients. J. Med. Genet., 37, 139140.
Yu, H., Bharaj, B., Vassilikos, E.J., Giai, M. and Diamandis, E.P. (2000) Shorter CAG repeat length in the androgen receptor gene is associated with more aggressive forms of breast cancer. Breast Cancer Res. Treat., 59, 153161.[Web of Science][Medline]
Zhang, S., Wu, H., Pan, A., Xiao, C., Zhang, G., Hou, Y. and Chu, J. (2000) Low incidence of myotonic dystrophy in Chinese Hans is associated with a lower number of CTG trinucleotide repeats. Am. J. Med. Genet., 96, 425428.[Web of Science][Medline]
Submitted on March 23, 2001; resubmitted on January 28, 2001; accepted on February 21, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. A. Davis-Dao, E. D. Tuazon, R. Z. Sokol, and V. K. Cortessis Male Infertility and Variation in CAG Repeat Length in the Androgen Receptor Gene: A Meta-analysis J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4319 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kunej, N. Teran, B. Zorn, and B. Peterlin CTG amplification in the DM1PK gene is not associated with idiopathic male subfertility Hum. Reprod., September 1, 2004; 19(9): 2084 - 2087. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Milatiner, D. Halle, M. Huerta, E. J. Margalioth, Y. Cohen, A. Ben-Chetrit, M. Gal, T. Mimoni, and T. Eldar-Geva Associations between androgen receptor CAG repeat length and sperm morphology Hum. Reprod., June 1, 2004; 19(6): 1426 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.L. Dean, S.J. Phillips, P. Chan, S.L. Tan, and A. Ao Reported relationship between increased CTG repeat lengths in myotonic dystrophy and azoospermia Hum. Reprod., November 1, 2002; 17(11): 3003 - 3004. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


