Human Reproduction, Vol. 17, No. 7, 1918-1924,
July 2002
© 2002 European Society of Human Reproduction and Embryology
Is estradiol cardioprotection a nitric oxide-mediated effect?
1 University Departments of Obstetrics and Gynaecology, Queen Mother's Hospital, Yorkhill, Glasgow G3 8SJ, 2 Medicine and Therapeutics, Western Infirmary, Glasgow and 3 Obstetrics and Gynaecology, The Rosie Hospital, Cambridge, UK
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
BACKGROUND: Estradiol exerts a number of biological effects that support extensive observational data suggesting a protective role for estrogen in cardiovascular disease prevention. These include effects on lipid and carbohydrate metabolism, coagulation/fibrinolysis as well as a possible effect on vascular reactivity. It has been proposed that this might be mediated by vascular endothelial nitric oxide (NO) production. Accordingly, we designed complementary in-vivo and in-vitro studies to investigate this hypothesis further. METHODS: Firstly, in a group of 10 healthy post-menopausal women, bilateral venous occlusion plethysmography was used to examine forearm vasoconstrictor responses to intrabrachial NG-monomethyl-l-arginine (l-NMMA; a substrate inhibitor of nitric oxide synthase) both before and after 4 weeks of treatment with transdermal 17ß-estradiol (E2) (80 µg/day). Secondly, we examined the direct effects of acute (24 h) and chronic (7 days) treatment with E2 (10 pmol/l and 10 nmol/l) on endothelial nitric oxide synthase (eNOS) gene expression in cultured human aortic endothelial cells. RESULTS: No significant differences were observed between the vasoconstrictor responses to l-NMMA (2, 4, 8 µmol/min) before and after E2 treatment. Comparison of E2-treated endothelial cells with control cells showed no significant increase in eNOS mRNA expression following either acute or chronic estradiol treatment. CONLUSIONS: The present studies do not provide evidence for an eNOS-mediated cardioprotective response to estrogen and therefore suggest that additional mechanisms other than the endothelial NO system may have an important role in the cardiovascular effects of estrogen.
Key words: cardiovascular disease/hormone replacement therapy/menopause/nitric oxide/oestrogen
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Coronary heart disease (CHD) is rare in non-diabetic pre-menopausal women but becomes increasingly prevalent after the menopause (Gordon et al., 1978
). A potential preventative role for sex steroids was first suggested over half a century ago (Levy and Boas, 1986), and subsequently extensive observational studies have consistently reported that estrogen-based hormone replacement therapy (HRT) is associated with a reduction in CHD in post-menopausal women (Stampfer and Colditz, 1991; Grodstein and Stampfer, 1995; Grodstein et al., 1996). A number of animal (Haarbo et al., 1991; Jiang et al., 1991) and more recently human (Williams et al., 1990; Rosano et al., 1993) studies are in support of these observational data. However, considerable uncertainty remains as the only randomized controlled trial published to date showed no benefit of a combination of conjugated equine estrogen with medroxyprogesterone acetate in the secondary prevention of CHD (Hulley et al., 1998).
The mechanisms underlying apparently favourable effects of estrogen on the cardiovascular system (Ross, 1993; St Clair, 1997) are incompletely understood. Although they have commonly been attributed to changes in primary cardiovascular risk factors resulting in beneficial changes in lipid profiles (Bush et al., 1987; Stevenson et al., 1993), a number of other biological effects have also been proposed. These include changes in glucose and insulin metabolism (Walton et al., 1993), body fat distribution (Ley et al., 1992), coagulation and fibrinolysis (Winkler, 1992) and in addition vascular endothelial function (Farhat et al., 1996).
The endothelium produces a plethora of vasoactive mediators, including prostaglandins, endothelins, angiotensin II, adrenomedullin and nitric oxide (NO). In the present study, we were interested in the effects of estrogen on NO as there is now evidence from both animal (Wennmalm, 1994; Gislard et al., 1998) and human (Hayasha et al., 1992, Herrington et al. 1994) studies that estrogen may be capable of acting via the L-arginine/NO pathway. Nitric oxide, synthesized constitutively by the endothelial isoform of the enzyme NO synthase (eNOS), and released by the vascular endothelium (Guetta et al., 1997), is thought to protect against the development of atherosclerosis by a number of mechanisms including maintaining vascular tone, preventing platelet aggregation and inhibiting smooth muscle cell proliferation (Vallance and Collier, 1994).
Estrogen acts principally by binding to specific nuclear receptors, which influence downstream events modulating gene expression. Until recently, only a single major form of the estrogen receptor (ER
) had been identified (Greene et al., 1986); however, a second protein encoding a separate subtype (ERß) has now been identified (Mosselman et al., 1996; Enmark et al., 1997). The ß receptor is smaller than the receptor although there is similar conservation of amino acid sequences suggesting similar modes of action despite differing in their distribution and affinity for estrogen. Recent evidence suggests that estrogen receptors are not confined to the reproductive system, with differential expression of the receptor subtypes in a variety of tissues. ER is found principally in the reproductive tissues (uterus, breast and ovaries), liver and central nervous system, whereas ERß is found primarily in blood vessels, bone, and urogenital tissues with some expression in the ovary and central nervous system, which may explain the selective actions of estrogen in target tissues. The presence of estrogen receptors in vascular tissues was originally inferred by a number of animal studies which demonstrated specific binding of estrogen to vascular cells (Colburn and Buonassisi, 1978; Nakao et al., 1981; Horwitz and Horwitz, 1982). Subsequently, functional estrogen receptors have been identified in a variety of vascular tissues including vascular smooth muscle and endothelial cells (Karas et al., 1994; Venkov et al., 1996), supporting a receptor-dependent action. However, estrogen-mediated vascular effects have also been reported which are independent of the estrogen receptor (Austin, 2000).
The aims of this study were: (i) to examine the effect of estrogen on basal endothelial NO production by examining the forearm vasoconstrictor responses to intrabrachial NG- monomethyl-L-arginine (L-NMMA), a substrate inhibitor of nitric oxide synthase (NOS), in healthy post-menopausal women before and after transdermal 17ß-estradiol (E2) therapy; and (ii) to examine the effect of acute (24 h) and chronic (7 days) E2 (10 pmol/l and 10 nmol/l) treatment on endothelial NO messenger RNA (eNOS mRNA) expression in cultured human aortic endothelial cells using Northern analysis. In addition, the estrogen receptor status of the cells was determined using RT–PCR to amplify ER and ERß mRNA.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Study 1. In-vivo study in healthy post-menopausal women
The study protocol conformed to the Declaration of Helsinki and was approved by the ethical committee of the West Glasgow Hospitals University NHS Trust. All women gave prior written informed consent.
Thirteen post-menopausal women (FSH >30 IU/l) were recruited either following total abdominal hysterectomy and bilateral salpingo-oophorectomy for a benign indication (n = 8) or by advertisement locally (n = 5). The women who participated were non-obese, had no personal history of cardiovascular disease, hypertension or diabetes mellitus, had no contraindications to E2, and were deemed to be fit on the basis of physical examination, ECG and routine haematological and biochemical screening investigations, including standard hormone assays. The pre-HRT study was conducted at 3–6 weeks post-operatively, to allow for stabilization of gonadotrophins and other metabolic processes, without unnecessarily delaying the relief of symptoms. Women who were previous HRT users (n = 3) were asked to discontinue their HRT (Trisequens; Novo Nordisk) for 4 weeks prior to the initial assessment. All women attended for two identical study days 4 weeks apart, before and after 4 weeks administration of transdermal E2 (80 µg) (Fematrix 80; Solvay Healthcare Limited, Southampton, Hants, UK). Women were asked to fast from midnight on the evening prior to each study day, and to avoid caffeine-containing beverages in the preceding 24 h. Body mass index (BMI) and baseline measurements of pulse and blood pressure were recorded using an automated blood pressure monitoring device (Dinamap; Critikon, Tampa, FL, USA) after resting supine for 5 min. Circulating estradiol concentrations were measured using a chemiluminescence method (Immulite; DPC, Glyn Rhonwy, Wales).
Forearm blood flow (FBF) during intra-arterial (brachial) infusion of L-NMMA was measured by bilateral forearm venous occlusion plethysmography using standard protocols as previously described by our group (Petrie et al., 1998). After 30 min of stabilization (saline infusion), two sets of measurements at 10 min intervals were used as a measurement of baseline FBF. Ascending doses of L-NMMA (2, 4, 8 µmol/min) were then infused for periods of 7 min each. Blood flow measurements were recorded over a 3 min period commencing 3 min from the start of each infusion.
Forearm blood flow was derived from the gradient of the plethysmographic trace according to a published method (Whitney, 1953). Each blood flow measurement was the mean of five sequential recordings. Co-ordinates of data points were acquired using MacChart software (AD Instruments) and pasted into a customized spreadsheet (Microsoft Excel). Data were expressed as the percentage change in FBF ratio from baseline. A mean response across doses was used as a summary measure.
Study 2. In-vitro study using cultured human aortic endothelial cells
Human aortic endothelial cells (HAEC) were purchased from Clonetics Inc. (UK supplier: TCS Biologicals, Claydon, Buckinghamshire, UK), and cultured in growth medium (Clonetics) following standard protocols as previously described by our group (Devlin et al., 1998). Cells were initially recovered and grown in 25 cm2 flasks. Cells were characterized as endothelial cells on the basis of positive immunostaining with antibodies specific for von Willebrand factor and also on the basis of morphology (Wagner et al., 1982; Polak and Van Noorden, 1996).
Total RNA was extracted from the cells using RNAzol B (Biogenesis Ltd., Poole, Dorset, UK) (Chomczynski and Sacchi, 1987). The integrity of the RNA was demonstrated by ethidium bromide stained agarose gel electrophoresis and the RNA yield was quantified spectrophotometrically using an Ultraspec 2000 UV/Visual Spectrophotometer (Pharmacia Biotech, St Albans, Herts, UK).
RT–PCR was carried out using 2.6 µg of RNA and primers specific for ER and ERß cDNA. The primers for ER nested RT–PCR have recently been described (McLaren et al., 1996). Primer 1 (GGAGACATGAGAGCTGCCAA) and primer 4 (TCATCATGCGGAACCGAGAT) were used for the first round and primer 2 (CCAGCAGCATGTCGAAGATC) and primer 3 (CTTTGGCCAAGCCCGCTC) for the second round. First round PCR profile: 95°C, 1 min (95°C, 30 s; 60°C, 30 s; 72°C, 30 s)x20 cycles, 72°C, 3 min. The product of the first round was diluted 1:20 for the second round reaction, performed with the following profile: 95°C, 1 min (95°C, 30 s; 58°C, 30 s; 72°C, 30 s)x20 cycles, 72°C, 3 min. Primers for ERß were designed from the published sequence [primer 1, TTACAGCATTCCCAGCAATG; primer 2, GAACCTGGACCAGTAACAG; 95°C, 1 min (95°C, 30 s; 56°C, 30 s; 72°C, 30 s)x30 cycles, 72°C, 3 min] and the amplified product verified by cloning and sequencing.
Using 10 mg of RNA, Northern blots were prepared according to a standard glyoxalation method previously described by our group. Human eNOS (pHu NOS endo PM831221) (Marsden et al., 1992) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; internal control) probes were prepared using a random priming kit (Gibco, Life Technologies, UK) with radiolabelled dCTP as previously described (Devlin et al., 1998). After probing, blots were exposed to radiographic film (Kodak X-Omatic) overnight, and subsequently scanned into a Biorad Phosphoimager (Biorad, UK, Hemel Hempstead, Herts, UK). The eNOS mRNA signal was then quantified densitometrically with respect to GAPDH by outlining the band to be measured, selecting a volumetric integration of the area defined, and expressing the signal in relation to the background density.
The effect of acute and chronic E2 treatment on eNOS mRNA levels was determined following exposure of the cells (passages 3–6) to 10 pmol/l and 10 nmol/l concentrations of soluble E2 (Sigma, Poole, Dorset, UK) for 24 h and 7 days, prior to Northern analysis and probing with a human eNOS probe (pHu NOS endo PM831221) (Devlin et al., 1998). The results of five separate experiments performed under identical conditions are presented.
Unless otherwise indicated, results are expressed as mean ± SD. Statistical significance was assessed using the Student's t-test. P < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Study 1
Ten healthy, non-obese (BMI 24.8 ± 4.7 kg/m2), normotensive (mean blood pressure 120/70 mmHg) women aged 50 ± 8 years, all of whom were non-smokers, completed the study. A further three women (one hysterectomized/two non-hysterectomized) were recruited but brachial artery cannulation could not be repeated after the treatment cycle. Circulating estradiol concentrations (measured by a standard clinical laboratory radioimmunoassay) were <50 pmol/l in all subjects at baseline and rose to 243 ± 170 pmol/l during the treatment cycle. No statistically significant differences in the vasoconstrictor responses to L-NMMA were observed before and after E2 treatment (Figure 1
). These data have an 85% power to exclude a 10% absolute increase in basal NO release after estradiol treatment.
|
Study 2
The presence of mRNA encoding both ER
and ERß in HAEC was demonstrated by RT–PCR (Figure 2). The PCR product for ER was 417 bp long and that for ERß 260 bp. Both were identified by cloning and sequencing. Although expression of both ER and ERß mRNA was present, it would appear that expression of ERß was relatively more abundant than ER, in keeping with previous reports on estrogen receptor distribution, although this cannot be confirmed with complete confidence as the method used was not quantitative.
|
Figure 3
shows a typical radiograph of a Northern blot after probing for GAPDH and eNOS genes. The GAPDH and eNOS signals were readily detectable and quantifiable. No significant change in eNOS gene expression was observed following short-term or chronic treatment with E2. This was independent of the dose of E2 or duration of treatment (control: 0.50 ± 0.24; 10 nmol/l, 24 h: 0.42 ± 0.24; 10 nmol/l, 7 days: 0.35 ± 0.17; 10 pmol/l, 24 h: 0.24 ± 0.13; 10 pmol/l, 7 days: 0.29 ± 0.08).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In the present study, we have demonstrated that basal eNOS production (as assessed by intra-arterial infusion of L-NMMA) is not increased in post-menopausal women after 4 weeks of transdermal E2 (80 µg/day) treatment. In addition, we have demonstrated that eNOS gene expression in human aortic endothelial cells is not up-regulated by short- or long-term treatment with E2 despite the presence of both ER
and ERß in these cells. The results of the present studies do not support the hypothesis that estrogen has a receptor-mediated action to improve vascular function by enhancing basal NO release in post-menopausal women.
Basal release of NO from the vasculature is generally greater in vessels from female animals than in those from males, suggesting that female sex hormone status is important in regulation of basal vasomotor tone (Sudhir et al., 1996). A cyclical variation in expired NO production in women, with levels peaking in the middle of the menstrual cycle, is also highly suggestive of an influence of gonadal hormones on the synthesis and release of NO (Kharitonov et al., 1994).
The vascular response to estrogen depends on the animal species and also the vascular bed studied. Oestrogen induces endothelium-dependent relaxation of vessels. Oestrogen facilitates the normal vasodilator response to acetylcholine (ACh) in rabbit femoral arteries (Gislard et al., 1998) and in porcine coronary vessels (Bell et al., 1995). Acute (Williams et al., 1990) and chronic (Williams et al., 1992) oestrogen administration attenuates or reverses the vasoconstriction effect of ACh in ovariectomized cynomolgus monkeys with coronary atherosclerosis.
In humans, there is also a suggestion of a role for the endothelium in the mediation of estrogen-induced vessel relaxation. Studies of the coronary vasculature have shown that estrogen attenuates or abolishes ACh-induced vasoconstriction when administered acutely in post-menopausal women with angiographically proven coronary artery disease (Reis et al., 1994; Collins et al., 1995). Similar responses to acute intracoronary E2 have been reported in post-menopausal women in healthy coronary vessels (Gilligan et al., 1994). The response of coronary arteries is also gender dependent, with evidence of E2-induced modulation of ACh-induced coronary artery responses of female but not male atherosclerotic coronary arteries (Collins et al., 1995). Studies of the peripheral vasculature, most commonly the forearm, have also reported beneficial effects of estrogen on vascular reactivity. A study of 40 post-menopausal women, of whom half had risk factors for vascular dysfunction, assessed forearm vascular responses to the endothelium-dependent vasodilator ACh, before and during intra-arterial infusion of E2. Potentiation of the vasodilator response to ACh in both healthy and potentially diseased blood vessels (Gilligan et al., 1994) occurred following the E2 administration. Similar findings have been reported using forearm plethysmography. The response to an intra-arterial infusion of ACh was augmented after 3 months of estrogen replacement therapy (50 µg transdermal estradiol), in a small group of women (10 subjects) after bilateral oopherectomy (Pinto et al., 1997). Endogenous estrogen deprivation following bilateral oophorectomy resulted in a reduction in ACh-induced vasodilation compared with baseline, but this was subsequently restored by estrogen supplementation. In contrast to these findings, a small randomized double-blind, placebo-controlled study, also examining FBF using venous occlusion plethysmography, showed no evidence of any alteration in the vasodilator responses to ACh following estrogen supplementation (2 mg estradiol valerate daily for 8 weeks duration) (Sudhir et al., 1996). However, enhanced vasoconstrictor response to the NO synthase inhibitor L-NMMA was observed, suggesting that there was enhanced basal NO release in the forearm vasculature of peri-menopausal women following estrogen supplementation.
There are several reasons for the difference between the results of the present study and the previously documented studies. One possible explanation for these differences may be the route of administration of estrogen. Transdermal estrogen avoids any first pass metabolism, whereas oral E2 passes from the gut directly to the liver via the portal circulation giving high local concentrations, which profoundly affect hepatic metabolism. Hence any indirect effects of estrogen on endothelial function mediated by changes in hepatic lipid metabolism will be much greater. Although this study did not demonstrate an effect of transdermal estrogen in the forearm vascular bed, it clearly does not exclude an effect of estrogen on the forearm vasculature if delivered by an alternative route, or indeed an effect on a different vascular bed when delivered by the same route.
An up-regulation of eNOS protein levels in response to E2 has been observed in human aortic endothelial cells using Western blotting (Hayashi et al., 1995). In this study, the level of eNOS protein was determined after short (8 h)- and long (48 h)-term pre-treatment of cells prior to measurement of calcium-stimulated (ionomycin) NO production. Similar findings have been observed in human umbilical vein endothelial cells and bovine aortic endothelial cells (Hishikawa et al., 1995). These investigators reported an increase in eNOS protein using Western blot analysis following estrogen pre-treatment for a minimum of 8 h, an effect which was inhibited by addition of the estrogen receptor antagonist tamoxifen. These effects were consistent in both of the cell populations studied. These findings suggest an involvement of the classic estrogen receptor ER, a hypothesis which is supported by observation that knock-out mice lacking ER have reduced NO production (Freay et al., 1995). More recently, another group demonstrated that estrogens increase transcription of the human eNOS gene and has suggested that this may be mediated as a consequence of enhanced activity of transcription factor Sp 1 (Kleinert et al., 1998).
This study examined eNOS mRNA expression in human endothelial cells following incubation with E2 using RNase protection assays. They also examined eNOS protein levels using Western blotting techniques. However, in the present study we were unable to detect any up-regulation of the human eNOS gene in cultured human endothelial cells. As with previous studies (Venkov et al., 1996) we have confirmed the presence of mRNA for both ER and ERß receptors in human endothelial cell cultures, suggesting that our negative findings are not a result of low or absent estrogen receptor expression.
As in the present study, another team (Arnal et al., 1996) did not find a role for eNOS in the cardioprotective effect of estrogen; rather, they found an increase in the expression of the superoxide dismutase (SOD) gene, which, by scavenging the free radical superoxide, would improve vascular compliance by preventing the scavenging of NO.
In summary, the results of our present studies do not provide evidence for a role for an eNOS-mediated cardioprotective response to estrogen. Alternative cellular mechanisms whereby estrogen can protect the vascular system may include a role in preventing apoptosis, by inhibiting mitogen actuated protein (MAP) kinase, reducing levels of cytokines such as tumour necrosis factor- or by acting as a free radical scavenger; however, a great deal of estrogen cellular and molecular biology remains to be elucidated.
|
Notes |
|---|
4 To whom correspondence should be addressed. E-mail: M.A.Lumsden{at}clinmed.gla.ac.uk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Arnal, J.F., Clamens, S., Pechet, C. Negre-Salvayare, A., Allera, C., Giorobibi, J.P., Salvayare, R. and Bayard, F. (1996) Ethinyloestradiol does not enhance the expression of nitric oxide synthase in bovine endothelial cells but increases the release of bioactive nitric oxide by inhibiting superoxide anion production. Proc. Natl Acad. Sci. USA, 96, 4108–4113.
Austin, C.E. (2000) Chronic and acute effects of oestrogen on vascular contractility. J. Hypertens., 18, 1365–1378.[Web of Science][Medline]
Bell, D.R., Rensberger, H.J., Koritnik, D.R. and Koshy, A. (1995) Oestrogen pretreatment directly potentiates endothelium-dependent vasorelaxation of porcine coronary arteries. Am. J. Physiol., 268, H377–383.[Web of Science][Medline]
Bush, T.L., Barrett-Conner, E., Cowan, L.D., Criqui, M.H., Wallace R.B., Suchindran, M., Tyroler, H.A. and Rifkind, B.M. (1987) Cardiovascular mortality and non-contraceptive use of oestrogen in women: results from the lipid research clinics program follow up study. Circulation, 75, 1102–1109.
Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–169.[Web of Science][Medline]
Colburn, P. and Buonassisi, V. (1978) Oestrogen binding sites in endothelial cell cultures. Science, 201, 817–819.
Collins, P., Rosano, G.M.C., Sarrel, P.M., Ulrich, L., Adamopoulos, S., Beale, C.M., McNeill, J. and Poole-Wilson, P.A. (1995) 17ß-Oestradiol attenuates acetylcholine-induced coronary arterial constriction in women but not men with coronary heart disease. Circulation, 92, 24–30.
Devlin, A.M., Brosnan, M.J., Graham, D., Morton, J.J., McPhaden, A.R., McIntyre, M., Hamilton, C.A., Reid, J.L. and Dominiczak, A. (1998) Vascular smooth muscle cell polyploidy and cardiomyocyte hypertrophy due to chronic NOS inhibition in vivo. Am. J. Physiol., 274 (1 Pt 2), H52–H59.[Medline]
Enmark, E., Pelto-Huikko, M., Grandien, K., Lagercrantz, S., Fried, G., Nordenskjold, M. and Gustafsson, J. (1997) Human oestrogen receptor ß-gene structure, chromosomal localisation, and expression pattern. J. Clin. Endocrinol. Metab., 82, 4258–4265.
Farhat, M.Y., Lavigne, M.C. and Ramwell, P.W. (1996) The vascular protective effects of oestrogen. FASEB J., 10, 615–624.[Abstract]
Freay, A.D., Korach, K.S, Lubahn, D. and Rubyani, G.M. (1995) Decreased endothelial nitric oxide production and increased smooth muscle reactivity to KCl in aortae of oestrogen receptor knockout mice. Circulation, 92, N8 (abstract).
Gilligan, D.M., Quyyumi, A.A. and Cannon, R.O. (1994) Effects of physiological levels of oestrogen on coronary vasomotor function in postmenopausal women. Circulation, 89, 2545–2551.
Gislard, V., Miller, V.M. and Vanhoutte, P.M. (1998) Effect of 17ß-oestradiol on endothelium dependent responses in the rabbit. J. Pharmacol. Exp. Ther., 244, 19–22.
Gordon, T., Kannel, W.B., Hjortland, M.C. and McNamara, P.M. (1978) Menopause and coronary heart disease. The Framingham study. Ann. Int. Med., 89, 157–161.
Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y. and Shine, J. (1986) Sequence and expression of human oestrogen receptor complementary DNA. Science, 231, 1150–1154.
Grodstein, F. and Stampfer, M.J. (1995) The epidemiology of coronary heart disease and oestrogen replacement in postmenopausal women. Prog. Cardiovasc. Disease, 38, 199–210.[Web of Science][Medline]
Grodstein, F., Stampfer, M.J., Manson, J.E., Colditz, G.A., Willett, W.C., Rosner, B., Speizer, F.E. and Hennekens, C.H. (1996) Postmenopausal oestrogen and progestin use and the risk of cardiovascular disease. N. Engl. J. Med., 335, 453–461.
Guetta, V., Quyyumi, A.A., Prasad, A., Panza, J.A., Waclawiw, M. and Cannon, R.O. (1997) The role of nitric oxide in coronary vascular effects of oestrogen in postmenopausal women. Circulation, 96, 2795–2801.
Haarbo, J., Leth-Espenson, P., Stender, S. and Christiansen, C. (1991) Oestrogen monotherapy and combined oestrogen-progestogen replacement therapy attenuate aortic accumulation of cholesterol in ovariectomised cholesterol fed rabbits. J. Clin. Invest., 87, 1274 –1279.[Web of Science][Medline]
Hayasha, T.L., Fukoto, J.M., Ignarro, L.J. and Chaudhuri, G. (1992) Basal release of nitric oxide from aortic rings is greater in female than in male rabbits; implications for atherosclerosis. Proc. Natl Acad. Sci. USA, 89, 11259–11263.
Hayashi, T., Yamanda, K., Esaki, T., Kuzuya, M., Satakes, S., Ishikawa, T., Hidaki, H. and Iyuchi, A. (1995) Oestrogen increases endothelial nitric oxide synthase by a receptor mediated system. Biochem. Biophys. Res. Commun., 214, 847–855.[Web of Science][Medline]
Herrington, D.M., Braden, G.A., Williams, J.K. and Morgan, T.M. (1994) Endothelium-dependent coronary vasomotor responsiveness in postmenopausal women with and without oestrogen replacement therapy. Am. J. Cardiol., 73, 951–952.[Web of Science][Medline]
Hishikawa, K., Nakaki, T., Marumo, T., Suzuki, H., Kato, R and Saruto, T. (1995) Up-regulation of nitric oxide synthase by oestradiol in human aortic endothelial cells. FEBS Lett., 360, 291–293.[Web of Science][Medline]
Horwitz, K.B. and Horwitz, L.D. (1982) Canine vascular tissues are targets for androgens, oestrogens, progestins and glucocorticoids. J. Clin. Invest., 69, 750–758.[Web of Science][Medline]
Hulley, S., Grady, D., Bush, T., Furberg, C., Herrington, D., Riggs, B. and Vittinghoff, V. (1998) Randomised trials of oestrogen and progestin for secondary prevention of coronary heart disease in postmenopausal women. J. Am. Med. Assoc., 280, 605–613.
Jiang, C., Sarrel, P.M., Lindsay, D.C., Poole-Wilson, P.A. and Collins, P. (1991) Endothelium independent relaxation of rabbit coronary artery by 17 beta-oestradiol in-vitro. Br. J. Pharmacol., 104, 1033–1037.[Web of Science][Medline]
Karas, R.H., Patterson, B.L. and Mendelsohn, M.E. (1994) Human vascular smooth muscle cells contain functional oestrogen receptors. Circulation, 89, 1943–1950.
Kharitonov, S.A., Logan-Sinclair, R.B., Busset, C.M. and Shinebourne, E.A. (1994) Peak expiratory nitric oxide differences in men and women: relation to menstrual cycle. Br. Heart J., 72, 243–245.
Kleinert, H., Wallerath, T., Euchenhofer, C., Ihrig-Biedert, I., Li, H. and Fostermann, U. (1998) Oestrogens increase transcription of the human endothelial NO synthase gene. Hypertension, 31, 582–588.
Levy, H. and Boas, E.P. (1986) Coronary artery disease in women. J. Am. Med. Assoc., 107, 97.
Ley, C.J., Lees, B. and Stevenson, J.C. (1992) Sex and menopause-associated changes in body fat distribution. Am. J. Clin. Nutr., 55, 950–954.
Marsden, P.A., Schappert, K.T., Chen, H.S., Flowers, M., Sundell, C.L., Wilcox, J.N. and Michel, T. (1992) Molecular cloning and characterisation of human endothelial nitric oxide synthase. FEBS Lett. 307, 287–293.
McLaren, J., Prentice, A., Charnock-Jones, D.S., Millicen, S., Muller, K., Sharkey, A.M. and Smith, S. (1996) Vascular endothelial growth factor is produced by peritoneal fluid macrophages in endometriosis and is regulated by steroids. J. Clin. Invest., 98, 482–489.[Web of Science][Medline]
Mosselman, S., Polman, J. and Dijkema, R. (1996) ER-ß: identification and characterisation of a novel human oestrogen receptor. FEBS Lett., 392, 49–53.[Web of Science][Medline]
Nakao, J., Chang, W.C., Murota, S.I. and Orimo, H. (1981) Estradiol-binding sites in rat aortic smooth muscle cells in culture. Atherosclerosis, 38, 75–80.[Web of Science][Medline]
Petrie, J.R., Ueda, S., Morris, A.D., Elliot, H. and Connell, J. (1998) How reproducible is bilateral forearm plethysmography? Br. J. Clin. Pharmacol., 45, 131–169.[Web of Science][Medline]
Pinto, S., Virdis A., Ghiadoni, L., Bernini, G., Lombardo, M., Petraglia, F., Genazzani, A.R., Taddei, S. and Salvetti, A. (1997) Endogenous oestrogen and acetylcholine-induced vasodilation in normotensive women. Hypertension, 29, 268–273.
Polak, J.M. and Van Noorden, S. (1996) Immunostaining by the indirect method. In Introduction to Immunocytochemistry, 2nd edn. BIOS Scientific Publishers Ltd., Oxford.
Reis, S.E., Gloth, S.T., Blumenthal, R.S., Resar, J.R., Zacur, H.A., Gerstenblith, G. and Brinker, J.A. (1994) Ethinyl oestradiol acutely attenuates abnormal coronary vasomotor responses to acetylcholine in postmenopausal women. Circulation, 89, 52–60.
Rosano, G.M., Sarrel, P.M., Poole-Wilson, P.A. and Collins, P. (1993) Beneficial effects of oestrogen on exercise induced myocardial ischaemia in women with coronary artery disease. Lancet, 342, 133–136.[Web of Science][Medline]
Ross, R. (1993) The pathogenesis of atherosclerosis: a perspective for the 1990's. Nature, 362, 801–809.[Medline]
St Clair, R.W. (1997) Pathogenesis of atherosclerosis. Cardiol. Rev., 5, 14–24.[Medline]
Stampfer, M.J. and Colditz, G.A. (1991) Oestrogen replacement therapy and coronary heart disease: a quantitative assessment of the epidemiological evidence. Prev. Med., 20, 47–63.[Web of Science][Medline]
Stevenson, J.C., Crook, D.C. and Godsland, I.F. (1993) Influence of age and menopause on serum lipids and lipoproteins in healthy women. Atherosclerosis, 98, 83–90.[Web of Science][Medline]
Sudhir, K., Jennings, G.L., Funder, J.W. and Komesaroff, P.A. (1996) Oestrogen enhances basal nitric oxide release in the forearm vasculature in perimenopausal women. Hypertension, 28, 330–334.
Vallance, P. and Collier, J. (1994) Biology and clinical relevance of nitric oxide. Br. Med. J., 309, 453–457.
Venkov, C.D., Rankin, A.B. and Vaughn, D.E. (1996) Identification of authentic oestrogen receptors in cultured endothelial cells. Circulation, 94, 727–733.
Wagner, D.D., Olmsted, J.B. and Marder, V. J. (1982) Immunolocalisation of von Willebrand protein in Weibel-Palade bodies of human endothelial cells. J. Cell Biol., 95, 355–360.
Walton, C., Godsland, I.F., Proudler, A.J., Wynn, C. and Stevenson, J.C. (1993) The effects of the menopause on insulin sensitivity, secretion and elimination in non-obese, healthy women. Eur. J. Clin. Invest., 23, 466–473.[Web of Science][Medline]
Wennmalm, A. (1994) Endothelial nitric oxide and cardiovascular disease. J. Int. Med., 235, 317–327.[Web of Science][Medline]
Whitney, R.J. (1953) The measurement of volume changes in human limbs. J. Physiol., 121, 1–27.
Williams, J.K., Adams, M.R. and Klopfenstein, H.S. (1990) Oestrogen modulates responses of atherosclerotic coronary arteries. Circulation, 81, 1680–1687.
Williams, J.K., Adams, M.R., Herrington, D.M. and Clarkston, T.B. (1992) Short-term administration of oestrogen and vascular responses of atherosclerotic coronary arteries. J. Am. Coll. Cardiol., 20, 452–457.[Abstract]
Winkler, U.H. (1992) Menopause, hormone replacement therapy and cardiovascular disease: a review of haemostaseological findings. Fibrinolysis, 6 (Suppl. 3), 5–10.[Web of Science]
Submitted on July 24, 2001; accepted on March 14, 2002.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||