Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow An erratum has been published
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yong, P. Y.K.
Right arrow Articles by Hillier, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yong, P. Y.K.
Right arrow Articles by Hillier, S. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Reproduction, Vol. 17, No. 9, 2300-2306, September 2002
© 2002 European Society of Human Reproduction and Embryology

Regulation of 11ß-hydroxysteroid dehydrogenase type 1 gene expression in human ovarian surface epithelial cells by interleukin-1

Peter Y.K. Yong1, Christopher Harlow2, K.J. Thong1 and Stephen G. Hillier2,3

1 Assisted Conception Programme, Royal Infirmary of Edinburgh, Edinburgh EH16 4SA and 2 Department of Reproductive and Developmental Sciences, University of Edinburgh Centre for Reproductive Biology, 49 Little France Crescent, Edinburgh EH16 4SB, UK


    Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
BACKGROUND: Local modulation of 11ß-hydroxysteroid dehydrogenase (11ßHSD) activity, to promote increased availability of anti-inflammatory glucocorticoids, is proposed as a compensatory response to inflammatory stimuli. Human 11ßHSD type 1 (11ßHSD1) is principally an 11-oxoreductase that reversibly reduces cortisone to cortisol. METHODS: Since ovulation is an acute inflammatory process, we examined the influence of pro-inflammatory cytokines on expression of 11ßHSD1 mRNA and metabolism of cortisone to cortisol by human ovarian surface epithelium (HOSE) in vitro. RESULTS: Northern analysis showed an ~1.5 kb-sized 11ßHSD1 mRNA transcript in total RNA that was up-regulated ~3-fold by interleukin (IL)-1{alpha} (0.5 ng/ml) at 24 h. By real-time RT–PCR, induction of 11ßHSD1 mRNA by IL-1{alpha} was measurable at 6 h and maximal at 12 h. Primary HOSE cell cultures also showed low-level 11-oxoreductase activity that was stimulated time- and dose-dependently by IL-1{alpha} and IL-1ß. The 11ßHSD1 mRNA and 11-oxoreductase responses to 0.5 ng/IL{alpha} were both suppressed by IL-1 receptor antagonist (25 ng/ml). CONCLUSIONS: Cultured HOSE cells express IL-1-responsive 11ßHSD1 and 11-oxoreductase activity mRNA in vitro. An 11ßHSD1-catalysed increase in anti-inflammatory glucocorticoid activity caused by pro-inflammatory cytokines could contribute to the local resolution of inflammation during ovulation.

Key words: cytokines/inflammation/ovarian surface epithelium/ovulation


    Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Mammalian ovulation is a natural inflammatory reaction (Espey, 1994Go; Morris and Richards, 1995Go; Hellberg et al., 1996Go). The ovulation-inducing gonadotrophin surge triggers target ovarian cells to undergo profound structural and metabolic changes including mobilization of thecal fibroblasts, increased leukocyte migration, release of inflammatory media tors and loosening of connective tissue elements in the follicle wall and overlying tunica (Murdoch et al., 1999Go; Bukulmez and Arici, 2000Go). Within the ovulatory follicle, luteinising granulosa cells divert from estrogen biosynthesis to predominantly progesterone biosynthesis, anticipating formation of the corpus luteum. Simultaneously, granulosa cells increasingly express 11-oxoreductase (Tetsuka et al., 1997Go; Smith et al., 2000Go), the activity of which favours the accumulation of cortisol over cortisone within the follicular fluid (Andersen and Hornnes, 1994Go; Harlow et al., 1997Go; Andersen et al., 1999Go; Yong et al., 2000Go). Since cortisol is a potent anti-inflammatory agent (van der Burg and van der Saag, 1996Go; McKay and Cidlowski, 1999Go), locally activated cortisol may play a role in the resolution of this natural inflammatory event (Andersen and Hornnes, 1994Go; Hillier and Tetsuka, 1998Go; Irahara et al., 1999Go).

The ovarian surface epithelium (OSE) is the outermost cellular layer breached during ovulation and is therefore intimately involved in the tissue remodelling that occurs (Auersperg et al., 2001Go; Murdoch et al., 2001Go). OSE cells near the site of stigma formation undergo apoptosis followed by inflammatory necrosis and slough off before the surface is ruptured (Murdoch et al., 1999Go). After which, adjacent OSE cells proliferate and recolonize the affected area (Osterholzer et al., 1985Go; Gillett et al., 1992Go). Repeated episodes of ovulation-associated injury and repair are presumed to underlie the high frequency of ovarian carcinoma arising from the OSE (Fathalla, 1971Go; Salazar et al., 1995Go), which account for 90% of all ovarian cancers (Ozols et al., 1991Go). Since factors related to inflammation of the OSE have been associated with increased risk of ovarian cancer (Ness and Cottreau, 1999Go; Ness et al., 2000Go), it is critically important to understand how inflammatory cell damage is normally resolved in the OSE.

Exposure to inflammatory stimuli increases 11ß -hydroxysteroid dehydrogenase type 1 (11ßHSD1) gene expression and enzymic activity in various epithelial cell types (Schleimer, 1991Go; Escher et al., 1997Go; Feinstein and Schleimer, 1999Go; Cai et al., 2001Go), including ovarian granulosa cells (Tetsuka et al., 1999Go). Since 11ßHSD1 is predominantly an 11-oxoreductase that reversibly metabolizes cortisone to cortisol (Tannin et al., 1991Go; Stewart and Mason, 1995Go), its increased expression at sites of inflammation has been proposed as part of a compensatory mechanism that promotes anti-inflammatory actions of glucocorticoids (Andersen and Hornnes, 1994Go; Escher et al., 1997Go; Hillier and Tetsuka, 1998Go). The ovulation-inducing LH surge triggers local production of inflammatory cytokines (Adashi, 1998Go), to which the OSE is inevitably exposed during ovulation. Thus, we sought to determine if cultured human OSE (HOSE) cells undertake cytokine-responsive 11ßHSD1 gene expression and 11-oxoreduction of cortisone to cortisol in vitro, focusing on founder members of the interleukin (IL)-1 gene family: IL-1{alpha}, IL-1ß and IL1-receptor antagonist (IL1-RA) (Sims et al., 2001Go).


    Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Patients
OSE cells were obtained from normal ovaries of premenopausal women (age range 33–46 years) undergoing laparotomy for benign gynaecological conditions, and in whom there had not been exposure to exogenous hormones in the 2 months prior to surgery. Sampling was random with respect to stage of menstrual cycle (Table I). The specimens were obtained at the start of the operation before any surgical dissection so as to minimize blood contamination and devascularization. If oophorectomy was planned, the specimen was obtained before removal of the ovary. All specimens were obtained with informed consent, and local ethics committee approval was granted for the study. Experiments on HOSE cells collected and cultured from 15 patients are reported.

Collection and culture of HOSE cells
The exposed ovarian surface was gently scraped using a sterile Ayres spatula to remove a portion of the OSE layer, taking great care to avoid follicular rupture during handling. The specimen comprising `flakes' of OSE in peritoneal fluid, as a consequence of the sampling technique, was rinsed from the spatula into sterile culture medium, before being transported to the laboratory. The culture medium consisted of Medium 199:MCDB105 (1:1, v/v) supplemented with fetal calf serum (15% v/v), streptomycin (50 µg/ml), penicillin (50 IU/ml), nystatin (500 IU/ml) and 1mmol/l L-glutamine (Kruk et al., 1990Go). All culture materials were from Gibco BRL (Life Technologies Ltd, Renfrewshire, UK) or Sigma Chemical Co. (Poole, Dorset, UK). The HOSE cells in culture medium were transferred to a serum-precoated 75 cm2 culture flask (Corning Inc. Glass Works, Corning, NY, USA) and incubated at 37°C in a humidified tissue culture incubator gassed with 95% air–5% CO2, for up to 28 days. The culture medium was renewed every 7 days. In this primary culture system, HOSE cells typically develop into cell monolayers within 24 days (Hillier et al., 1998Go). Immunocytochemical staining with an anti-human cytokeratin (CAM 5.2) monoclonal antibody (kit no. 92-0005; Becton Dickinson Immunocytometry Systems Europe, Erembodegem, Belgium), which recognizes cytokeratin proteins 8 and 18, confirmed the epithelial origin of the HOSE cell cultures (Van Niekerk et al., 1993Go; Tsao et al., 1995Go; Auersperg et al., 2001Go).

Confluent HOSE cell monolayers were trypsinized using a solution of 0.05% (w/v) Trypsin and 0.02% EDTA in modified Puck's saline A (Gibco). The resulting cell suspension was washed in culture medium, then centrifuged at 800 g for 5 min, and resuspended in fresh culture medium. Cell counting was performed in a haemocytometer, using Trypan Blue exclusion to estimate viability, which ranged from 80 to 97%. The mean cellular yield was 3.9x106 viable cells per culture flask trypsinized. Replicate portions of the cell suspension containing 105 cells in 0.5 ml medium were then distributed into 24-well polystyrene culture dishes (Corning) and incubated for 24 h. The serum-containing medium was then replaced with serum-free culture medium containing 0.1% bovine serum albumin and incubated for a further 24 h.

To start experiments, human recombinant IL-1{alpha} or IL-1ß (R&D Systems, Europe Ltd, Abingdon, Oxon, UK) was added to the culture medium at a final concentration of 0.02–50 ng/ml. IL-1 receptor antagonist (R&D Systems) was used at a concentration of 25 ng/ml. Incubation was at 37°C for 24 h, unless time (6–48 h) was the dependent variable. All treatments were in triplicate or duplicate, depending on available cell numbers. After removing spent culture medium, total RNA was extracted for analysis of 11ßHSD1 mRNA or prewarmed (37°C) medium (0.5 ml) containing substrate [1,2,6,7-3H]cortisone was added to HOSE monolayers to initiate the 11-oxoreductase assay, as described below.

Northern analysis
Total RNA for Northern analysis was extracted from HOSE cell monolayers using RNAzol BTM (Tel-Test, Friendswood, TX, USA) following the manufacturer's recommendations. Total RNA (20 µg) was size-fractionated on a 1.0% agarose gel containing 2.2 mol/l formaldehyde and transferred onto nylon membrane (Hybond-N; Amersham Pharmacia Biotech, Little Chalfont, Buckhamshire, UK) by capillary transfer. An 11ßHSD1 cDNA probe encompassing the entire coding region of 11ßHSD1 was excised with HindIII and XbaI from pcDNA I-11ßHSD1 cDNA, which was constructed (Mason and Stewart, 1995) from a 11ßHSD1 cDNA generously provided by Dr Perrin White, Dallas, TX, USA. The probe was labelled with 32P-dCTP (Redivue; Amersham) using the Prime-It II (Stratagene Europe, Amsterdam, The Netherlands) random primer labelling kit, and then passed through a NICK column (Amersham) to remove unincorporated 32P-labelled nucleotides. Hybridization was carried out overnight at 42°C using UltrahybTM (Ambion Europe Ltd, Huntingdon, Cambs, UK) containing ~1x106 cpm cDNA probe/ml.

Membranes were washed in stringency wash solution containing 2x standard saline citrate (SSC) and 0.1% sodium dodecyl sulphate (SDS) for 2x5 min at 42°C, then washed in stringency wash solution containing 0.1xSSC and 0.1% SDS for 2x15 min at 42°C. The membranes were exposed to autoradiographic film (Kodak XAR-5; Eastman Kodak, Rochester, NY, USA) for 6 days at –70°C against an intensifying screen. The radioactivity of each signal was then quantified by electronic autoradiography (Instant Imager; Packard, Downers, Grove, IL, USA). The membranes were then stripped and the process repeated using a 32P-labelled human 18S ribosomal RNA cDNA probe donated by Dr G.Scobie (MRC Human Reproductive Sciences Unit, Edinburgh, UK), as an index of uniformity of RNA gel loading and transfer to the membrane. Total RNA from human luteinising granulosa cells (Tetsuka et al., 1997Go) was the 11ßHSD1 mRNA positive control.

Real-time quantitative RT–PCR
Real-time quantitative RT–PCR was used to quantify the effects of interleukins on 11ßHSD1 mRNA expression, since insufficient total RNA from treated HOSE cells was available for replicate Northern analyses. Tri Reagent (Sigma) was used to obtain total RNA for this purpose. The abundance of 11ßHSD1 mRNA was quantified using the TaqMan RT–PCR system (ABI PRISM 7700 Sequence Detection System; Applied Biosystems, Warrington, UK), in which a specific PCR product is generated using a 5' nuclease fluorogenic probe and primers (Livak et al., 1995Go). Commercial reagents (TaqMan PCR Reagent Kit; Perkin-Elmer) and conditions were used according to the manufacturer's instructions. Total RNA (1 µg) from each sample was reverse-transcribed for subsequent PCR analysis. A total of 1 µl of the resulting RT reaction mixture with oligonucleotides at a final concentration of 300 nmol/l of primers and 200 nmol/l of TaqMan hybridization probe were analysed in a 25 µl volume. Primer Express software (Perkin-Elmer) was used to design the oligonucleotides using uniform selection parameters that allow application of standard cycle conditions. Target (11ßHSD1) mRNA was quantified in relation to 18S ribosomal RNA abundance in each sample, using placental 11ßHSD1 mRNA as the internal standard. The 11ßHSD1 primers and TaqMan probes used were as follows. 11ßHSD1 forward: AGCTCTGCGCCAAGAAGAAGT; 11ßHSD1 reverse: AGGATCTTCCTGCATG-GATTTC; 11ßHSD1 TaqMan probe: TGACAGCTCACTCTGGACCACTCTTCTGA.

11-Oxoreductase assay
Conversion of [1,2,6,7-3H]cortisone to [1,2,6,7-3H]cortisol was the index of 11-oxoreductase activity, measured as previously described (Thomas et al., 1998Go). In brief, culture medium containing substrate cortisone (50 pmol), including 0.1 µCi [3H]cortisone, was added to each well giving a final volume of 0.5 ml. Control incubations containing no cells were also set up. Incubation was for 4 h at 37°C in a humidified atmosphere of 5% CO2 in air. Media from individual wells were then pipetted into glass tubes and vortexed with diethyl ether (3 ml) for 1 min to extract steroids. The extracts were then evaporated under nitrogen in tubes containing 10 nmole carrier, unlabelled cortisone and cortisol. The dried etheric extracts were then transferred in ethyl acetate to silica gel-precoated plastic sheets (PE SIL G; Whatman Ltd, Maidstone, Kent, UK) for thin-layer chromatographic separation of precursor cortisone and product cortisol in the solvent system chloroform:ethanol (92:8 by vol) (BDH Laboratory Supplies, Poole, Dorset, UK).

Cortisone and cortisol bands were identified by visualization under direct UV light, and the corresponding areas were cut out and transferred to a counting vial for determination of radioactivity by ß-scintillation spectrophotometry. Consistently >90% of the total radioactivity added to the incubations was accounted for in the cortisone and cortisol bands. Enzymic activity was expressed as percentage total radioactivity [(product cpm/substrate cpm + product cpm)x100] after correction for values from control (no cell) incubations.

Statistical analysis
Results are expressed as mean ± SEM. Data were analysed by analysis of variance and Student's-t test, taking P < 0.05 to indicate statistically significant differences between mean values.


    Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
11ßHSD1 mRNA expression
Northern blotting revealed a ~1.5 kb-sized human 11ßHSD1 mRNA transcript in cultured HOSE cell total RNA, the abundance of which was increased almost 3-fold by incubation with IL-1{alpha} (0.5 ng/ml) for 24 h. Results from two experiments are shown in Figure 1Go.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 1. Northern analysis of 11ßHSD1 mRNA in HOSE cells. Cultured cell monolayers were incubated for 24 h in absence (control) or presence of IL-1{alpha} (0.5 ng/ml) before isolation of total RNA for Northern analysis. RNA from human luteinised granulosa cells (LGC) was the positive control. Total RNA (20 µg/lane) was size-fractionated on a 1.0% agarose gel containing 2.2 mol/l formaldehyde, blotted on to a nylon membrane and hybridized with 32P-labelled 11ßHSD1 (upper panel) and 18S rRNA (lower panel) cDNA probes, as described in Materials and methods. Experiments (Exp. 1, Exp. 2) on HOSE cell cultures of two patients are shown. Note the increased abundance of 11ßHSD1 mRNA due to IL-1{alpha} in both cases.

 
Time-dependent stimulation of 11ßHSD1 mRNA expression by IL-1{alpha} (0.5 ng/ml) was confirmed by real-time RT–PCR. Combined data from four experiments are shown in Figure 2Go. Stimulation (2.9-fold relative to control) occurred at 6 h, increasing to 5.6-fold at 12 h (P < 0.01) and dropping to 2.3-fold at 24 h (P < 0.05).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Time-dependent stimulation of 11ßHSD1 mRNA expression by IL-1{alpha} in cultured HOSE cells. HOSE cells were cultured for 6, 12 or 24 h in absence (control) and presence ofIL-1{alpha} (0.5 ng/ml), before isolation of total RNA for measurement of 11ßHSD1 mRNA abundance relative to 18S rRNA by TaqMan RT–PCR, as described in Materials and methods. Combined data (mean ± SEM) from four individual experiments. Asterisks indicate significant stimulation by IL-1 (*P < 0.05; **P < 0.01).

 
The effect of IL-1RA on IL-1{alpha} action was tested in two experiments, one of which is shown in Figure 3Go. On both occasions, the presence of IL-1RA in HOSE cell culture medium completely blocked IL-1{alpha}-stimulated 11ßHSD1 mRNA expression.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of IL-1{alpha}-stimulated 11ßHSD1 mRNA expression by IL-1 receptor antagonist (IL-1RA) in culturedHOSE cells. HOSE cells were cultured for 24 h in absence (control) and presence of IL-1{alpha} (0.5 ng/ml), without (–IL-1RA) or with (+IL-1RA) IL-1RA (25 ng/ml). Total RNA was isolated for measurement of 11ßHSD1 mRNA abundance relative to 18S rRNA by TaqMan RT–PCR, as described in Materials and methods. Mean (± SEM, if visible) values (n = 3) from a representative experiment. Asterisk indicates significant inhibition by IL-1RA(*P < 0.01).

 
11-Oxoreductase activity
Consistent with the presence of 11ßHSD1 mRNA, cultured HOSE cells exhibited low-level 11-oxoreductase activity, which was increased time-dependently by treatment with IL-1{alpha} (0.5 ng/ml). Results from a typical experiment are given in Figure 4Go. In 4/4 experiments, IL-1{alpha} had no measurable action on 11-oxoreductase activity at 6 h, but at 12, 24 and 48 h it caused average fold increases (relative to control) of 1.34 (P < 0.05), 1.69 (P < 0.01) and 1.66 (P < 0.01) respectively.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Time-dependent stimulation of 11-oxoreductase activity by IL-1{alpha} in cultured HOSE cells. HOSE cells were cultured for6, 12, 24 or 48 h in absence (control) and presence of IL-1{alpha}(0.5 ng/ml) before determining 11-oxoreductase activity, as described in Materials and methods. Combined data (mean ± SEM) from four individual experiments. Asterisks indicate significant stimulation by IL-1 (*P < 0.01).

 
The presence of IL-1RA (25 ng/ml) in HOSE cell culture medium significantly suppressed the response to IL-1{alpha} (0.5 ng/ml), without affecting basal 11-oxoreductase activity, in 2/2 experiments. Results from one of these experiments are shown in Figure 5Go.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Inhibition of IL-1{alpha}-stimulated 11-oxoreductase activity by IL-1 receptor antagonist in cultured HOSE cells. HOSE cells were cultured for 6, 12, 24 or 48 h without treatment (control)or in presence of IL-RA (25 ng/ml), IL-1{alpha} (0.5 ng/ml) or IL-1{alpha} (0.5 ng/ml) plus IL-RA (25 ng/ml), before determining 11-oxoreductase activity as described in Materials and methods. Mean (± SEM, if visible) values (n = 3) from a representative experiment. Asterisk indicates significant inhibition by IL-1RA(*P < 0.01).

 
Effects of IL-1{alpha} and IL-1ß on 11-oxoreductase activity were compared by treating HOSE cells for 24 h with increasing doses of either substance. Combined data from four experiments are shown in Figure 6Go. Both cytokines elicited similar effects, with maximal stimulation (average ~1.7-fold, relative to control) occurring at 0.5 ng IL-1/ml.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 6. Dose-dependent stimulation of 11-oxoreductase activity by IL-1{alpha} and IL-1ß in cultured HOSE cells. HOSE cells were cultured for 24 h in absence and presence of increasing concentrations of IL-1{alpha} or IL-1ß before determining 11-oxoreductase activity, as described in Materials and methods. Combined data (mean ± SEM) from four individual experiments, normalized to the corresponding `0'-treatment value. Asterisks indicate significant stimulation by IL-1 (*P < 0.05; **P < 0.01).

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
We show here that cytokine-activated HOSE cells increasingly express 11ßHSD1 mRNA and undertake metabolism of cortisone to cortisol in vitro. Of the two known human 11ßHSD isoforms, 11ßHSD1 is principally reductive (converts cortisone to cortisol) whereas 11ßHSD2 is strongly oxidative (converts cortisol to cortisone) (Stewart and Mason, 1995Go). Thus the present data are consistent with cytokine-induced up-regulation of 11ßHSD1 enzymatic activity in HOSE cells.

The results from HOSE cell specimens obtained in the follicular and luteal phases of the menstrual cycle did not obviously differ (data not shown) although the opportunistic sampling and need to establish primary HOSE cell cultures precluded meaningful comparisons. We do not know if prolonged culture alters the expression of the 11ßHSD system, but basal and IL-1-responsive 11-oxoreductase activity persist for at least 4 weeks, which is the time required to propagate enough cells from individual patients for experimental analysis in vitro.

Our results also show that HOSE cell IL-1 receptors are functionally coupled to 11ßHSD1 gene expression, since both 11ßHSD1 mRNA and enzyme activity stimulated by IL-1{alpha} were suppressed by the presence of IL-RA. HOSE cells are an established site of IL-1 synthesis (Ziltener et al., 1993Go), and stimulatory effects of IL-1 on HOSE cell proliferation have been described previously (Marth et al., 1996Go). Under the short-term, serum-depleted conditions of IL-1 exposure used here, we saw no IL-1-induced increase in HOSE cell number. However, IL-1 did cause morphological changes tending to a fibroblastic phenotype, which were also reversible by IL-RA (data not shown). Thus our results are consistent with both paracrine and autocrine modes of regulation of the OSE by IL-1 signalling via IL-1 receptors.

The ability of IL-1 to alter steroid metabolism in HOSE extends existing evidence that the development and function of the OSE is influenced by multiple extracellular stimuli (Auersperg et al., 2001Go), including GnRH (Kang et al., 2000Go), gonadotrophins (Zheng et al., 2000Go; Ivarsson et al., 2001bGo; Kuroda et al., 2001Go; Parrott et al., 2001Go) and locally produced growth/differentiation factors (Gordon et al., 1995Go; Choi et al., 2001aGo,bGo; Nilsson et al., 2001Go; Wong et al., 2001Go). Cultured HOSE cells also produce estradiol and progesterone (Ivarsson et al., 2001aGo), and express receptors for both of these steroid hormones (Karlan et al., 1995Go; Brandenberger et al., 1998Go; Hillier et al., 1998Go). Thus any or all of these factors have the potential to interact with IL-1 in the regulation of HOSE 11ßHSD gene expression and enzymatic activity.

We have previously demonstrated that induction of ovulation by treatment with hCG, as a surrogate LH, causes up-regulation of 11ßHSD1 and down-regulation of 11ßHSD2 gene expression in luteinising granulosa cells (Tetsuka et al., 1997Go), and that this is associated with increased metabolism by these cells of cortisone to cortisol (Yong et al., 2000Go). The results presented here suggest that cytokine-mediated induction of 11ßHSD1 expression in the OSE is part of a co-ordinated ovarian response to LH/hCG. The likely physiological significance is that the OSE is exposed to multiple inflammatory mediators during ovulation, including cytokines (IL-1 and Il-6) that up-regulate the inducible cyclo-oxygenase isozyme prostaglandin-H synthase (PGHS)-2, responsible for prostaglandin (PG)-E2 formation (Morris and Richards, 1995Go; Hellberg et al., 1996Go). PGE2 formed via PGHS-2 initiates the acute cellular events associated with inflammation and is the product responsible for ovulation (Smith and Langenbach, 2001Go). The subsequent biochemical cascade leads to collagen breakdown, apoptotic cell death at the ovarian surface and follicular rupture (Murdoch et al., 1999Go). It follows that a compensatory anti-inflammatory mechanism is an obligatory component of this natural injury–repair process, as summarized in Figure 7Go.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Proposed role of 11ßHSD1 in the resolution of LH-induced inflammation at the ovarian surface during ovulation. Ovulation is viewed as a natural injury repair process. The ovulation-inducing LH surge induces an acute inflammatory response through increasing the local production of inflammatory cytokines (IL-1) and prostaglandins (PG), leading to proteolytic breakdown of the follicle wall and apoptosis of overlying ovarian surface epithelial cells. LH-induced IL-1 simultaneously up-regulates the expression of 11ßHSD1 in granulosa cells and OSE cells, serving to increase the metabolism of `inactive' cortisone (E) into anti-inflammatory cortisol (F). The increased local availability of cortisol is hypothesized to play a role in the resolution of this acute inflammatory event.

 
Glucocorticoids exert anti-inflammatory effects via the ligand-activated glucocorticoid receptor (GR) signalling pathway in inflamed tissues, to antagonise the induction of the pro-inflammatory transcription factor nuclear NF-{kappa}B (van der Burg and van der Saag, 1996Go; McKay and Cidlowski, 1999Go). A growing body of evidence suggests that sites of inflammation express relatively high levels of 11ßHSD1, which presumably promotes ligand access to GR through its 11-oxoreductive catalytic activity (Escher et al., 1997Go). Stimulation of 11ßHSD1 mRNA expression by pro-inflammatory cytokines has been observed in cultured glomerular mesangial (Escher et al., 1997Go), aortic smooth muscle cells (Cai et al., 2001Go), bronchial airway epithelial cells (Feinstein and Schleimer, 1999Go), ovarian granulosa cells (Tetsuka et al., 1999Go), and now HOSE cells. Thus an up-regulation of 11ßHSD1-associated 11-oxoreductase activity may be a generalized response to inflammation that ensures maximal accessibility of anti-inflammatory glucocorticoids to sites of tissue injury. It remains to be determined if the increased 11ßHSD1 mRNA response of HOSE to IL-1 is associated with a corresponding down-regulation of 11ßHSD2 expression, as occurs in IL-1-treated granulosa cells. If so, the attendant reduction in cortisol inactivation by 11ßHSD2 would be expected to reinforce the proposed anti-inflammatory function of 11ßHSD1.

Finally, these results cast new light on steroid signalling in the OSE. Until recently, the HOSE was seen as a relatively inert ovarian steroidogenic compartment. However, it seems increasingly likely that locally produced steroids and related molecules play significant roles in co-ordinating the cyclic waves of cellular proliferation, differentiation and death that naturally occur in the OSE. Glucocorticoid metabolism and signalling may hold particular relevance to the pathophysiology of the OSE, not least because of the inflammatory basis of ovulation (Espey, 1994Go) and the epidemiological evidence that ovarian epithelial inflammation may play a role in ovarian cancer (Ness and Cottreau, 1999Go; Ness et al., 2000Go).


    Acknowledgements
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
We are grateful to Ms Pawlina Largue for expert technical assistance, and the nursing staff of the Royal Infirmary of Edinburgh gynaecology theatres for assistance with the collection of HOSE specimens. Supported by MRC Programme Grant G0000066 to S.G.H.


    Notes
 
3 To whom correspondence should be addressed. E-mail: s.hillier{at}ed.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Adashi, E.Y. (1998) The potential role of interleukin-1 in the ovulatory process: an evolving hypothesis. Mol. Cell. Endocrinol., 140, 77–81.[Web of Science][Medline]

Andersen, C.Y. and Hornnes, P. (1994) Intrafollicular concentrations of free cortisol close to follicular rupture. Hum. Reprod., 9, 1944–1949.[Abstract/Free Full Text]

Andersen, C.Y., Morineau, G., Fukuda, M., Westergaard, L.G., Ingerslev, H.J., Fiet, J. and Byskov, A.G. (1999) Assessment of the follicular cortisol:cortisone ratio. Hum. Reprod., 14, 1563–1568.[Abstract/Free Full Text]

Auersperg, N., Wong, A.S., Choi, K.C., Kang, S.K. and Leung, P.C. (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr. Rev., 22, 255–288.[Abstract/Free Full Text]

Brandenberger, A.W., Tee, M.K. and Jaffe, R.B. (1998) Estrogen receptor alpha (ER-alpha) and beta (ER-beta) mRNAs in normal ovary, ovarian serous cystadenocarcinoma and ovarian cancer cell lines: down-regulation of ER-beta in neoplastic tissues. J. Clin. Endocrinol. Metab., 83, 1025–1028.[Abstract/Free Full Text]

Bukulmez, O. and Arici, A. (2000) Leukocytes in ovarian function. Hum. Reprod. Update, 6, 1–15.[Abstract/Free Full Text]

Cai, T.Q., Wong, B., Mundt, S.S., Thieringer, R., Wright, S.D. and Hermanowski-Vosatka, A. (2001) Induction of 11beta-hydroxysteroid dehydrogenase type 1 but not -2 in human aortic smooth muscle cells by inflammatory stimuli. J. Steroid. Biochem. Mol. Biol., 77, 117–122.[Web of Science][Medline]

Choi, K.C., Kang, S.K., Nathwani, P.S., Cheng, K.W., Auersperg, N. and Leung, P.C. (2001a) Differential expression of activin/inhibin subunit and activin receptor mRNAs in normal and neoplastic ovarian surface epithelium (OSE). Mol. Cell. Endocrinol., 17, 99–110.

Choi, K.C., Kang, S.K., Tai, C.J., Auersperg, N, and Leung, P.C. (2001b) The regulation of apoptosis by activin and transforming growth factor-beta in early neoplastic and tumorigenic ovarian surface epithelium. J. Clin. Endocrinol. Metab., 86, 2125–2135.[Abstract/Free Full Text]

Escher, G., Galli, I., Vishwanath, B.S., Frey, B.M. and Frey, F.J. (1997) Tumor necrosis factor alpha and interleukin 1beta enhance the cortisone/cortisol shuttle. J. Exp. Med., 186, 189–198.[Abstract/Free Full Text]

Espey, L.L. (1994) Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory reaction. Biol. Reprod., 50, 233–238.[Abstract]

Fathalla, M.F. (1971) Incessant ovulation—a factor in ovarian neoplasia? Lancet, ii, 7716.

Feinstein, M.B. and Schleimer, R.P. (1999) Regulation of the action of hydrocortisone in airway epithelial cells by11beta-hydroxysteroid dehydrogenase. Am. J. Respir. Cell. Mol. Biol., 21, 403–408.[Abstract/Free Full Text]

Gillett, W.R., Mitchell, A. and Hurst, P.R. (1992) A stereological study of the human ovarian surface epithelium. Hum. Reprod., 7, 446–452.[Abstract/Free Full Text]

Gordon, A.W., Pegues, J.C., Johnson, G.R., Kannan, B., Auersperg, N. and Stromberg, K. (1995) mRNA phenotyping of the major ligands and receptors of the EGF supergene family in human ovarian epithelial cells. Cancer Lett., 89, 63–71.[Web of Science][Medline]

Harlow, C.R., Jenkins, J.M. and Winston, R.M. (1997) Increased follicular fluid total and free cortisol levels during the luteinizing hormone surge. Fertil. Steril., 68, 48–53.[Web of Science][Medline]

Hellberg, P., Larson, L., Olofsson, J., Brannstrom, M. and Hedin, L. (1996) Regulation of the inducible form of prostaglandin endoperoxide synthase in the perfused rat. Mol. Hum. Reprod., 2, 111–116.[Abstract/Free Full Text]

Hillier, S.G. and Tetsuka, M. (1998) An anti-inflammatory role for glucocorticoids in the ovaries? J. Reprod. Immunol., 39, 21–27.[Web of Science][Medline]

Hillier, S.G., Anderson, R.A., Williams, A.R. and Tetsuka, M. (1998) Expression of oestrogen receptor alpha and beta in cultured human ovarian surface epithelial cells. Mol. Hum. Reprod., 4, 811–815.[Abstract/Free Full Text]

Irahara, M., Ando, M., Sirois, J., Saito, J. and Adashi, E.Y. (1999) Glucocorticoid receptor-mediated post-ceramide inhibition of the interleukin-1beta-dependent induction of ovarian prostaglandin, endoperoxide synthase-2 in rats. Biol. Reprod., 60, 946–953.[Abstract/Free Full Text]

Ivarsson, K., Sundfeldt, K., Brannstrom, M. and Janson, P.O. (2001a) Production of steroids by human ovarian surface epithelial cells in culture: possible role of progesterone as growth inhibitor. Gynecol. Oncol., 82, 116–121.[Web of Science][Medline]

Ivarsson, K., Sundfeldt, K., Brannstrom, M., Hellberg, P. and Janson, P.O. (2001b) Diverse effects of FSH and LH on proliferation of human ovarian surface epithelial cells. Hum. Reprod., 18, 23.

Kang, S.K., Choi, K.C., Cheng, K.W., Nathwani, P.S, Auersperg, N. and Leung, P.C. (2000) Related role of gonadotropin-releasing hormone as an autocrine growth factor in human ovarian surface epithelium. Endocrinology, 141, 72–80.[Abstract/Free Full Text]

Karlan, B.Y., Jones, J., Greenwald, M. and Lagasse, L.D. (1995) Steroid hormone effects on the proliferation of human ovarian surface epithelium in vitro. Am. J. Obstet. Gynecol., 173, 97–104.[Web of Science][Medline]

Kuroda, H., Mandai, M., Konishi, I., Tsuruta, Y, Kusakari, T., Kariya, M. and Fujii, S. 2001 Human ovarian surface epithelial (OSE) cells express LH/hCG receptors, and hCG inhibits apoptosis of OSE cells via up-regulation of insulin-like growth factor-1. Int. J. Cancer, 91, 309–315.

Kruk, P.A, Maines-Bandiera, S.L. and Auersperg, N. (1990) A simplified method to culture human ovarian surface epithelium. Lab. Invest., 63, 132–136.[Web of Science][Medline]

Livak, K.J., Flood, S.J., Marmaro, J., Giusti, W. and Deetz, K. (1995) Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridisation. PCR Methods Appl., 4, 357–362.[Web of Science][Medline]

McKay, L.I. and Cidlowski, J.A. (1999) Molecular control of immune/inflammatory responses: interactions between nuclear factor-kappa B and steroid receptor-signaling pathways. Endocr. Rev., 20, 435–4359.[Abstract/Free Full Text]

Marth, C., Zeimet, A.G., Herold, M., Brumm, C., Windbichler, G., Muller-Holzner, E., Offner, F., Feichtinger, H., Zwierzina, H. and Daxenbichler, G. (1996) Different effects of interferons, interleukin-1beta and tumor necrosis factor-alpha in normal (OSE) and malignant human ovarian epithelial cells. Int. J. Cancer, 67, 826–830.[Web of Science][Medline]

Morris, J.K. and Richards, J.S. (1995) Luteinizing hormone induces prostaglandin endoperoxide synthase-2 and luteinization in vitro by A-kinase and C-kinase pathways. Endocrinology, 136, 1549–1558.[Abstract]

Murdoch, W.J., Wilken, C. and Young, D.A. (1999) Sequence of apoptosis and inflammatory necrosis within the formative ovulatory site of sheep follicles. J. Reprod. Fertil., 117, 325–329.[Abstract/Free Full Text]

Murdoch,W.J., Townsend, R.S. and McDonnel, A.C. (2001) Ovulation-induced DNA damage in ovarian surface epithelial cells of ewes: prospective regulatory mechanisms of repair/survival and apoptosis. Biol. Reprod., 65, 1417–1424.[Abstract/Free Full Text]

Ness, R.B. and Cottreau, C. (1999) Possible role of ovarian epithelial inflammation in ovarian cancer. J. Natl Cancer Inst., 91, 1459–1467[Abstract/Free Full Text]

Ness, R.B., Grisso, J.A., Cottreau, C., Klapper, J., Vergona, R., Wheeler, J.E., Morgan, M. and Schlesselman, J.J. (2000) Factors related to inflammation of the ovarian epithelium and risk of ovarian cancer. Epidemiology, 1, 111–117.

Nilsson, E., Doraiswamy, V., Parrott, J.A. and Skinner, M.K. (2001) Expression and action of transforming growth factor beta (TGFbeta1, TGFbeta2, TGFbeta3) in normal bovine ovarian surface epithelium and implications for human ovarian cancer. Mol. Cell. Endocrinol., 182, 145–155.[Web of Science][Medline]

Osterholzer, H.O., Johnson, J.H. and Nicosia, S.V. (1985) An autoradiographic study of rabbit ovarian surface epithelium before and after ovulation. Biol. Reprod., 33, 729–738.[Abstract]

Ozols, R.F., Hamilton, T.C., Hoskins, W.J., Bast, R.C. Jr. and Young, R.C. (1991) Summary of symposium: Biology and therapy of ovarian cancer. Semin. Oncol., 18, 297–306.[Web of Science][Medline]

Parrott. J.A., Doraiswamy, V., Kim, G., Mosher, R. and Skinner, M.K. (2001) Expression and actions of both the follicle stimulating hormone receptor and the luteinizing hormone receptor in normal ovarian surface epithelium and ovarian cancer. Mol. Cell. Endocrinol., 172, 213–222.[Web of Science][Medline]

Salazar, H., Godwin, K., Getts, L.A., Testa, J.R., Daly, M., Rosenblum, N., Hogan, M., Ozols, R.F. and Hamilton, T.C. (1995) Spontaneous transformation of the ovarian surface epithelium and the biology of ovarian cancer. In Sharp, F., Mason, P., Blackett, T. and Berek, J., (eds) Ovarian Cancer 3. Chapman and Hall Medical, London, UK, pp. 145–156.

Schleimer, R.P. (1991) Potential regulation of inflammation in the lung by local metabolism of hydrocortisone. Am. J. Respir. Cell Mol. Biol., 4, 166–173.[Medline]

Sims, J.E., Nicklin, M.J., Bazan, J.F., Barton, J.L., Busfield, S.J., Ford, J.E., Kastelein, R.A., Kumar, S., Lin, H., Mulero, J.J. et al. (2001) A new nomenclature for IL-1-family genes. Trends Immunol., 22, 536–537.[Web of Science][Medline]

Smith, W.L. and Langenbach, R. (2001) Why there are two cyclooxygenase isozymes. J. Clin. Invest., 107, 1491–1495.[Web of Science][Medline]

Smith, M.P., Mathur, R.S., Keay, S.D., Hall, L., Hull, M.G. and Jenkins, J.M. (2000) Periovulatory human oocytes, cumulus cells, and ovarian leukocytes express type 1 but not type 2 11beta-hydroxysteroid dehydrogenase RNA. Fertil. Steril., 73, 825–830.[Web of Science][Medline]

Stewart, P.M. and Mason, J.I. (1995) Cortisol to cortisone: glucocorticoid to mineralocorticoid. Steroids, 60, 143–146.[Web of Science][Medline]

Tannin, G.M., Agarwal, A.K., Monder, C., New, M.I. and White, P.C. (1991) The human gene for 11 beta-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localisation. J. Biol. Chem., 266, 16653–16658.[Abstract/Free Full Text]

Tetsuka, M., Thomas, F.J., Thomas, M.J., Anderson, R.A., Mason, J.I. and Hillier, S.G. (1997) Differential expression of messenger ribonucleic acids encoding 11beta-hydroxysteroid dehydrogenase types 1 and 2 in human granulosa cells. J. Clin. Endocrinol. Metab., 82, 2006–2009.[Web of Science][Medline]

Tetsuka, M., Haines, L.C., Milne, M., Simpson, G.E. and Hillier, S.G. (1999) Regulation of 11beta-hydroxysteroid dehydrogenase type 1 gene expression by LH and interleukin-1beta in cultured rat granulosa cells. J. Endocrinol., 163, 417–423.[Abstract]

Thomas, F.J., Thomas, M.J., Tetsuka, M., Mason, J.I. and Hillier, S.G. (1998) Corticosteroid metabolism in human granulosa–lutein cells. Clin. Endocrinol. (Oxf.), 48, 509–513.[Medline]

Tsao, S.W., Mok, S.C., Fey, E.G., Fletcher, J.A., Wan, T.S., Chew, E.C., Muto, M.G., Knapp, R.C. and Berkowitz, R.S. (1995) Characterization of human ovarian surface epithelial cells immortalized by human papilloma virus oncogenes. (HPV-E6E7 ORFS). Exp. Cell. Res., 218, 499–507.[Web of Science][Medline]

van der Burg, B. and van der Saag, P.T. (1996) Nuclear factor-kappa-B/steroid hormone receptor interactions as a functional basis of anti-inflammatory action of steroids in reproductive organs. Mol. Hum. Reprod., 2, 433–438.[Abstract/Free Full Text]

Van Niekerk, C.C., Ramaekers, F.C., Hanselaar, A.G., Aldeweireldt, J. and Poels, L.G. (1993) Changes in expression of differentiation markers between normal ovarian cells and derived tumors. Am. J. Pathol., 142, 157–177.[Abstract]

Wong, A.S., Pelech, S.L., Woo, M.M., Yim, G., Rosen, B., Ehlen, T., Leung, P.C. and Auersperg, N. (2001) Coexpression of hepatocyte growth factor-Met: an early step in ovarian carcinogenesis? Oncogene, 20, 1318–1328.[Web of Science][Medline]

Yong, P.Y.K., Thong, K.J., Andrew, R., Walker, B.R. and Hillier, S.G. (2000) Development-related increase in cortisol biosynthesis by human granulosa cells. J. Clin. Endocrinol. Metab., 85, 4728–4733.[Abstract/Free Full Text]

Zheng, W., Lu, J.J., Luo, F., Zheng, Y., Feng, Y.J., Felix, J.C., Lauchlan, S.C. and Pike, M.C. (2000) Ovarian epithelial tumor growth promotion by follicle-stimulating hormone and inhibition of the effect by luteinizing hormone. Gynecol. Oncol., 76, 80–88.[Web of Science][Medline]

Ziltener, H.J., Maines-Bandiera, S., Schrader, J.W. and Auersperg, N. (1993) Secretion of bioactive interleukin-1, interleukin-6, and colony-stimulating factors by human ovarian surface epithelium. Biol. Reprod., 49, 635–641.[Abstract]

Submitted on February 25, 2002; accepted on May 15, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
G. Papacleovoulou, K. Hogg, K. S. Fegan, H. O.D. Critchley, S. G. Hillier, and J. I. Mason
Regulation of 3{beta}-hydroxysteroid dehydrogenase type 1 and type 2 gene expression and function in the human ovarian surface epithelium by cytokines
Mol. Hum. Reprod., June 1, 2009; 15(6): 379 - 392.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Z. Yang, P. Zhu, C. Guo, X. Zhu, and K. Sun
Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Human Fetal Lung and Regulation of Its Expression by Interleukin-1{beta} and Cortisol
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 306 - 313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. D'Elia, J. Patenaude, and J. Bernier
Regulation of glucocorticoid sensitivity in thymocytes from burn-injured mice
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E97 - E104.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
K S Fegan, M T Rae, H O D Critchley, and S G Hillier
Anti-inflammatory steroid signalling in the human peritoneum
J. Endocrinol., February 1, 2008; 196(2): 369 - 376.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Myers, M. C. Lamont, S. van den Driesche, N. Mary, K. J. Thong, S. G. Hillier, and W. C. Duncan
Role of Luteal Glucocorticoid Metabolism during Maternal Recognition of Pregnancy in Women
Endocrinology, December 1, 2007; 148(12): 5769 - 5779.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. G Hillier
Diamonds are forever: the cortisone legacy
J. Endocrinol., October 1, 2007; 195(1): 1 - 6.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. T. Rae, O. Gubbay, A. Kostogiannou, D. Price, H. O. D. Critchley, and S. G. Hillier
Thyroid Hormone Signaling in Human Ovarian Surface Epithelial Cells
J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 322 - 327.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. R. Dover, P. W. F. Hadoke, L. J. Macdonald, E. Miller, D. E. Newby, and B. R. Walker
Intravascular Glucocorticoid Metabolism during Inflammation and Injury in Mice
Endocrinology, January 1, 2007; 148(1): 166 - 172.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. C. Jonas, C. Chandras, D. R. E. Abayasekara, and A. E. Michael
Role for Prostaglandins in the Regulation of Type 1 11{beta}-Hydroxysteroid Dehydrogenase in Human Granulosa-Lutein Cells
Endocrinology, December 1, 2006; 147(12): 5865 - 5872.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Bruley, V. Lyons, A. G. F. Worsley, M. D. Wilde, G. D. Darlington, N. M. Morton, J. R. Seckl, and K. E. Chapman
A Novel Promoter for the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Gene Is Active in Lung and Is C/EBP{alpha} Independent
Endocrinology, June 1, 2006; 147(6): 2879 - 2885.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. C. Duncan, S. G. Hillier, E. Gay, J. Bell, and H. M. Fraser
Connective Tissue Growth Factor Expression in the Human Corpus Luteum: Paracrine Regulation by Human Chorionic Gonadotropin
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5366 - 5376.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
O Gubbay, W Guo, M T Rae, D Niven, A F Howie, A S McNeilly, L Xu, and S G Hillier
Anti-inflammatory and proliferative responses in human and ovine ovarian surface epithelial cells
Reproduction, November 1, 2004; 128(5): 607 - 614.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M T Rae, D Niven, A Ross, T Forster, R Lathe, H O D Critchley, P Ghazal, and S G Hillier
Steroid signalling in human ovarian surface epithelial cells: the response to interleukin-1{alpha} determined by microarray analysis
J. Endocrinol., October 1, 2004; 183(1): 19 - 28.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. W. Tomlinson, E. A. Walker, I. J. Bujalska, N. Draper, G. G. Lavery, M. S. Cooper, M. Hewison, and P. M. Stewart
11{beta}-Hydroxysteroid Dehydrogenase Type 1: A Tissue-Specific Regulator of Glucocorticoid Response
Endocr. Rev., October 1, 2004; 25(5): 831 - 866.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. T. Rae, D. Niven, H. O. D. Critchley, C. R. Harlow, and S. G. Hillier
Antiinflammatory Steroid Action in Human Ovarian Surface Epithelial Cells
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4538 - 4544.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R. Sasson, E. Rimon, A. Dantes, T. Cohen, V. Shinder, A. Land-Bracha, and A. Amsterdam
Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases
Mol. Hum. Reprod., May 1, 2004; 10(5): 299 - 311.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Sun and L. Myatt
Enhancement of Glucocorticoid-Induced 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression by Proinflammatory Cytokines in Cultured Human Amnion Fibroblasts
Endocrinology, December 1, 2003; 144(12): 5568 - 5577.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
L.M. Thurston, D.P. Norgate, K.C. Jonas, L. Gregory, P.J. Wood, B.A. Cooke, and A.E. Michael
Ovarian modulators of type 1 11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) activity and intra-follicular cortisol:cortisone ratios correlate with the clinical outcome of IVF
Hum. Reprod., August 1, 2003; 18(8): 1603 - 1612.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow An erratum has been published
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yong, P. Y.K.
Right arrow Articles by Hillier, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yong, P. Y.K.
Right arrow Articles by Hillier, S. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?