Human Reproduction, Vol. 17, No. 9, 2300-2306,
September 2002
© 2002 European Society of Human Reproduction and Embryology
Regulation of 11ß-hydroxysteroid dehydrogenase type 1 gene expression in human ovarian surface epithelial cells by interleukin-1
1 Assisted Conception Programme, Royal Infirmary of Edinburgh, Edinburgh EH16 4SA and 2 Department of Reproductive and Developmental Sciences, University of Edinburgh Centre for Reproductive Biology, 49 Little France Crescent, Edinburgh EH16 4SB, UK
| Abstract |
|---|
|
|
|---|
BACKGROUND: Local modulation of 11ß-hydroxysteroid dehydrogenase (11ßHSD) activity, to promote increased availability of anti-inflammatory glucocorticoids, is proposed as a compensatory response to inflammatory stimuli. Human 11ßHSD type 1 (11ßHSD1) is principally an 11-oxoreductase that reversibly reduces cortisone to cortisol. METHODS: Since ovulation is an acute inflammatory process, we examined the influence of pro-inflammatory cytokines on expression of 11ßHSD1 mRNA and metabolism of cortisone to cortisol by human ovarian surface epithelium (HOSE) in vitro. RESULTS: Northern analysis showed an
1.5 kb-sized 11ßHSD1 mRNA transcript in total RNA that was up-regulated
3-fold by interleukin (IL)-1
(0.5 ng/ml) at 24 h. By real-time RTPCR, induction of 11ßHSD1 mRNA by IL-1
was measurable at 6 h and maximal at 12 h. Primary HOSE cell cultures also showed low-level 11-oxoreductase activity that was stimulated time- and dose-dependently by IL-1
and IL-1ß. The 11ßHSD1 mRNA and 11-oxoreductase responses to 0.5 ng/IL
were both suppressed by IL-1 receptor antagonist (25 ng/ml). CONCLUSIONS: Cultured HOSE cells express IL-1-responsive 11ßHSD1 and 11-oxoreductase activity mRNA in vitro. An 11ßHSD1-catalysed increase in anti-inflammatory glucocorticoid activity caused by pro-inflammatory cytokines could contribute to the local resolution of inflammation during ovulation.
Key words: cytokines/inflammation/ovarian surface epithelium/ovulation
| Introduction |
|---|
|
|
|---|
Mammalian ovulation is a natural inflammatory reaction (Espey, 1994
The ovarian surface epithelium (OSE) is the outermost cellular layer breached during ovulation and is therefore intimately involved in the tissue remodelling that occurs (Auersperg et al., 2001
; Murdoch et al., 2001
). OSE cells near the site of stigma formation undergo apoptosis followed by inflammatory necrosis and slough off before the surface is ruptured (Murdoch et al., 1999
). After which, adjacent OSE cells proliferate and recolonize the affected area (Osterholzer et al., 1985
; Gillett et al., 1992
). Repeated episodes of ovulation-associated injury and repair are presumed to underlie the high frequency of ovarian carcinoma arising from the OSE (Fathalla, 1971
; Salazar et al., 1995
), which account for 90% of all ovarian cancers (Ozols et al., 1991
). Since factors related to inflammation of the OSE have been associated with increased risk of ovarian cancer (Ness and Cottreau, 1999
; Ness et al., 2000
), it is critically important to understand how inflammatory cell damage is normally resolved in the OSE.
Exposure to inflammatory stimuli increases 11ß -hydroxysteroid dehydrogenase type 1 (11ßHSD1) gene expression and enzymic activity in various epithelial cell types (Schleimer, 1991
; Escher et al., 1997
; Feinstein and Schleimer, 1999
; Cai et al., 2001
), including ovarian granulosa cells (Tetsuka et al., 1999
). Since 11ßHSD1 is predominantly an 11-oxoreductase that reversibly metabolizes cortisone to cortisol (Tannin et al., 1991
; Stewart and Mason, 1995
), its increased expression at sites of inflammation has been proposed as part of a compensatory mechanism that promotes anti-inflammatory actions of glucocorticoids (Andersen and Hornnes, 1994
; Escher et al., 1997
; Hillier and Tetsuka, 1998
). The ovulation-inducing LH surge triggers local production of inflammatory cytokines (Adashi, 1998
), to which the OSE is inevitably exposed during ovulation. Thus, we sought to determine if cultured human OSE (HOSE) cells undertake cytokine-responsive 11ßHSD1 gene expression and 11-oxoreduction of cortisone to cortisol in vitro, focusing on founder members of the interleukin (IL)-1 gene family: IL-1
, IL-1ß and IL1-receptor antagonist (IL1-RA) (Sims et al., 2001
).
| Subjects and methods |
|---|
|
|
|---|
Patients
OSE cells were obtained from normal ovaries of premenopausal women (age range 3346 years) undergoing laparotomy for benign gynaecological conditions, and in whom there had not been exposure to exogenous hormones in the 2 months prior to surgery. Sampling was random with respect to stage of menstrual cycle (Table I). The specimens were obtained at the start of the operation before any surgical dissection so as to minimize blood contamination and devascularization. If oophorectomy was planned, the specimen was obtained before removal of the ovary. All specimens were obtained with informed consent, and local ethics committee approval was granted for the study. Experiments on HOSE cells collected and cultured from 15 patients are reported.
Collection and culture of HOSE cells
The exposed ovarian surface was gently scraped using a sterile Ayres spatula to remove a portion of the OSE layer, taking great care to avoid follicular rupture during handling. The specimen comprising `flakes' of OSE in peritoneal fluid, as a consequence of the sampling technique, was rinsed from the spatula into sterile culture medium, before being transported to the laboratory. The culture medium consisted of Medium 199:MCDB105 (1:1, v/v) supplemented with fetal calf serum (15% v/v), streptomycin (50 µg/ml), penicillin (50 IU/ml), nystatin (500 IU/ml) and 1mmol/l L-glutamine (Kruk et al., 1990
). All culture materials were from Gibco BRL (Life Technologies Ltd, Renfrewshire, UK) or Sigma Chemical Co. (Poole, Dorset, UK). The HOSE cells in culture medium were transferred to a serum-precoated 75 cm2 culture flask (Corning Inc. Glass Works, Corning, NY, USA) and incubated at 37°C in a humidified tissue culture incubator gassed with 95% air5% CO2, for up to 28 days. The culture medium was renewed every 7 days. In this primary culture system, HOSE cells typically develop into cell monolayers within 24 days (Hillier et al., 1998
). Immunocytochemical staining with an anti-human cytokeratin (CAM 5.2) monoclonal antibody (kit no. 92-0005; Becton Dickinson Immunocytometry Systems Europe, Erembodegem, Belgium), which recognizes cytokeratin proteins 8 and 18, confirmed the epithelial origin of the HOSE cell cultures (Van Niekerk et al., 1993
; Tsao et al., 1995
; Auersperg et al., 2001
).
Confluent HOSE cell monolayers were trypsinized using a solution of 0.05% (w/v) Trypsin and 0.02% EDTA in modified Puck's saline A (Gibco). The resulting cell suspension was washed in culture medium, then centrifuged at 800 g for 5 min, and resuspended in fresh culture medium. Cell counting was performed in a haemocytometer, using Trypan Blue exclusion to estimate viability, which ranged from 80 to 97%. The mean cellular yield was 3.9x106 viable cells per culture flask trypsinized. Replicate portions of the cell suspension containing 105 cells in 0.5 ml medium were then distributed into 24-well polystyrene culture dishes (Corning) and incubated for 24 h. The serum-containing medium was then replaced with serum-free culture medium containing 0.1% bovine serum albumin and incubated for a further 24 h.
To start experiments, human recombinant IL-1
or IL-1ß (R&D Systems, Europe Ltd, Abingdon, Oxon, UK) was added to the culture medium at a final concentration of 0.0250 ng/ml. IL-1 receptor antagonist (R&D Systems) was used at a concentration of 25 ng/ml. Incubation was at 37°C for 24 h, unless time (648 h) was the dependent variable. All treatments were in triplicate or duplicate, depending on available cell numbers. After removing spent culture medium, total RNA was extracted for analysis of 11ßHSD1 mRNA or prewarmed (37°C) medium (0.5 ml) containing substrate [1,2,6,7-3H]cortisone was added to HOSE monolayers to initiate the 11-oxoreductase assay, as described below.
Northern analysis
Total RNA for Northern analysis was extracted from HOSE cell monolayers using RNAzol BTM (Tel-Test, Friendswood, TX, USA) following the manufacturer's recommendations. Total RNA (20 µg) was size-fractionated on a 1.0% agarose gel containing 2.2 mol/l formaldehyde and transferred onto nylon membrane (Hybond-N; Amersham Pharmacia Biotech, Little Chalfont, Buckhamshire, UK) by capillary transfer. An 11ßHSD1 cDNA probe encompassing the entire coding region of 11ßHSD1 was excised with HindIII and XbaI from pcDNA I-11ßHSD1 cDNA, which was constructed (Mason and Stewart, 1995) from a 11ßHSD1 cDNA generously provided by Dr Perrin White, Dallas, TX, USA. The probe was labelled with 32P-dCTP (Redivue; Amersham) using the Prime-It II (Stratagene Europe, Amsterdam, The Netherlands) random primer labelling kit, and then passed through a NICK column (Amersham) to remove unincorporated 32P-labelled nucleotides. Hybridization was carried out overnight at 42°C using UltrahybTM (Ambion Europe Ltd, Huntingdon, Cambs, UK) containing ~1x106 cpm cDNA probe/ml.
Membranes were washed in stringency wash solution containing 2x standard saline citrate (SSC) and 0.1% sodium dodecyl sulphate (SDS) for 2x5 min at 42°C, then washed in stringency wash solution containing 0.1xSSC and 0.1% SDS for 2x15 min at 42°C. The membranes were exposed to autoradiographic film (Kodak XAR-5; Eastman Kodak, Rochester, NY, USA) for 6 days at 70°C against an intensifying screen. The radioactivity of each signal was then quantified by electronic autoradiography (Instant Imager; Packard, Downers, Grove, IL, USA). The membranes were then stripped and the process repeated using a 32P-labelled human 18S ribosomal RNA cDNA probe donated by Dr G.Scobie (MRC Human Reproductive Sciences Unit, Edinburgh, UK), as an index of uniformity of RNA gel loading and transfer to the membrane. Total RNA from human luteinising granulosa cells (Tetsuka et al., 1997
) was the 11ßHSD1 mRNA positive control.
Real-time quantitative RTPCR
Real-time quantitative RTPCR was used to quantify the effects of interleukins on 11ßHSD1 mRNA expression, since insufficient total RNA from treated HOSE cells was available for replicate Northern analyses. Tri Reagent (Sigma) was used to obtain total RNA for this purpose. The abundance of 11ßHSD1 mRNA was quantified using the TaqMan RTPCR system (ABI PRISM 7700 Sequence Detection System; Applied Biosystems, Warrington, UK), in which a specific PCR product is generated using a 5' nuclease fluorogenic probe and primers (Livak et al., 1995
). Commercial reagents (TaqMan PCR Reagent Kit; Perkin-Elmer) and conditions were used according to the manufacturer's instructions. Total RNA (1 µg) from each sample was reverse-transcribed for subsequent PCR analysis. A total of 1 µl of the resulting RT reaction mixture with oligonucleotides at a final concentration of 300 nmol/l of primers and 200 nmol/l of TaqMan hybridization probe were analysed in a 25 µl volume. Primer Express software (Perkin-Elmer) was used to design the oligonucleotides using uniform selection parameters that allow application of standard cycle conditions. Target (11ßHSD1) mRNA was quantified in relation to 18S ribosomal RNA abundance in each sample, using placental 11ßHSD1 mRNA as the internal standard. The 11ßHSD1 primers and TaqMan probes used were as follows. 11ßHSD1 forward: AGCTCTGCGCCAAGAAGAAGT; 11ßHSD1 reverse: AGGATCTTCCTGCATG-GATTTC; 11ßHSD1 TaqMan probe: TGACAGCTCACTCTGGACCACTCTTCTGA.
11-Oxoreductase assay
Conversion of [1,2,6,7-3H]cortisone to [1,2,6,7-3H]cortisol was the index of 11-oxoreductase activity, measured as previously described (Thomas et al., 1998
). In brief, culture medium containing substrate cortisone (50 pmol), including 0.1 µCi [3H]cortisone, was added to each well giving a final volume of 0.5 ml. Control incubations containing no cells were also set up. Incubation was for 4 h at 37°C in a humidified atmosphere of 5% CO2 in air. Media from individual wells were then pipetted into glass tubes and vortexed with diethyl ether (3 ml) for 1 min to extract steroids. The extracts were then evaporated under nitrogen in tubes containing 10 nmole carrier, unlabelled cortisone and cortisol. The dried etheric extracts were then transferred in ethyl acetate to silica gel-precoated plastic sheets (PE SIL G; Whatman Ltd, Maidstone, Kent, UK) for thin-layer chromatographic separation of precursor cortisone and product cortisol in the solvent system chloroform:ethanol (92:8 by vol) (BDH Laboratory Supplies, Poole, Dorset, UK).
Cortisone and cortisol bands were identified by visualization under direct UV light, and the corresponding areas were cut out and transferred to a counting vial for determination of radioactivity by ß-scintillation spectrophotometry. Consistently >90% of the total radioactivity added to the incubations was accounted for in the cortisone and cortisol bands. Enzymic activity was expressed as percentage total radioactivity [(product cpm/substrate cpm + product cpm)x100] after correction for values from control (no cell) incubations.
Statistical analysis
Results are expressed as mean ± SEM. Data were analysed by analysis of variance and Student's-t test, taking P < 0.05 to indicate statistically significant differences between mean values.
| Results |
|---|
|
|
|---|
11ßHSD1 mRNA expression
Northern blotting revealed a ~1.5 kb-sized human 11ßHSD1 mRNA transcript in cultured HOSE cell total RNA, the abundance of which was increased almost 3-fold by incubation with IL-1
(0.5 ng/ml) for 24 h. Results from two experiments are shown in Figure 1
|
Time-dependent stimulation of 11ßHSD1 mRNA expression by IL-1
(0.5 ng/ml) was confirmed by real-time RTPCR. Combined data from four experiments are shown in Figure 2
|
The effect of IL-1RA on IL-1
action was tested in two experiments, one of which is shown in Figure 3
-stimulated 11ßHSD1 mRNA expression.
|
11-Oxoreductase activity
Consistent with the presence of 11ßHSD1 mRNA, cultured HOSE cells exhibited low-level 11-oxoreductase activity, which was increased time-dependently by treatment with IL-1
(0.5 ng/ml). Results from a typical experiment are given in Figure 4
had no measurable action on 11-oxoreductase activity at 6 h, but at 12, 24 and 48 h it caused average fold increases (relative to control) of 1.34 (P < 0.05), 1.69 (P < 0.01) and 1.66 (P < 0.01) respectively.
|
The presence of IL-1RA (25 ng/ml) in HOSE cell culture medium significantly suppressed the response to IL-1
(0.5 ng/ml), without affecting basal 11-oxoreductase activity, in 2/2 experiments. Results from one of these experiments are shown in Figure 5
|
Effects of IL-1
and IL-1ß on 11-oxoreductase activity were compared by treating HOSE cells for 24 h with increasing doses of either substance. Combined data from four experiments are shown in Figure 6
|
| Discussion |
|---|
|
|
|---|
We show here that cytokine-activated HOSE cells increasingly express 11ßHSD1 mRNA and undertake metabolism of cortisone to cortisol in vitro. Of the two known human 11ßHSD isoforms, 11ßHSD1 is principally reductive (converts cortisone to cortisol) whereas 11ßHSD2 is strongly oxidative (converts cortisol to cortisone) (Stewart and Mason, 1995
The results from HOSE cell specimens obtained in the follicular and luteal phases of the menstrual cycle did not obviously differ (data not shown) although the opportunistic sampling and need to establish primary HOSE cell cultures precluded meaningful comparisons. We do not know if prolonged culture alters the expression of the 11ßHSD system, but basal and IL-1-responsive 11-oxoreductase activity persist for at least 4 weeks, which is the time required to propagate enough cells from individual patients for experimental analysis in vitro.
Our results also show that HOSE cell IL-1 receptors are functionally coupled to 11ßHSD1 gene expression, since both 11ßHSD1 mRNA and enzyme activity stimulated by IL-1
were suppressed by the presence of IL-RA. HOSE cells are an established site of IL-1 synthesis (Ziltener et al., 1993
), and stimulatory effects of IL-1 on HOSE cell proliferation have been described previously (Marth et al., 1996
). Under the short-term, serum-depleted conditions of IL-1 exposure used here, we saw no IL-1-induced increase in HOSE cell number. However, IL-1 did cause morphological changes tending to a fibroblastic phenotype, which were also reversible by IL-RA (data not shown). Thus our results are consistent with both paracrine and autocrine modes of regulation of the OSE by IL-1 signalling via IL-1 receptors.
The ability of IL-1 to alter steroid metabolism in HOSE extends existing evidence that the development and function of the OSE is influenced by multiple extracellular stimuli (Auersperg et al., 2001
), including GnRH (Kang et al., 2000
), gonadotrophins (Zheng et al., 2000
; Ivarsson et al., 2001b
; Kuroda et al., 2001
; Parrott et al., 2001
) and locally produced growth/differentiation factors (Gordon et al., 1995
; Choi et al., 2001a
,b
; Nilsson et al., 2001
; Wong et al., 2001
). Cultured HOSE cells also produce estradiol and progesterone (Ivarsson et al., 2001a
), and express receptors for both of these steroid hormones (Karlan et al., 1995
; Brandenberger et al., 1998
; Hillier et al., 1998
). Thus any or all of these factors have the potential to interact with IL-1 in the regulation of HOSE 11ßHSD gene expression and enzymatic activity.
We have previously demonstrated that induction of ovulation by treatment with hCG, as a surrogate LH, causes up-regulation of 11ßHSD1 and down-regulation of 11ßHSD2 gene expression in luteinising granulosa cells (Tetsuka et al., 1997
), and that this is associated with increased metabolism by these cells of cortisone to cortisol (Yong et al., 2000
). The results presented here suggest that cytokine-mediated induction of 11ßHSD1 expression in the OSE is part of a co-ordinated ovarian response to LH/hCG. The likely physiological significance is that the OSE is exposed to multiple inflammatory mediators during ovulation, including cytokines (IL-1 and Il-6) that up-regulate the inducible cyclo-oxygenase isozyme prostaglandin-H synthase (PGHS)-2, responsible for prostaglandin (PG)-E2 formation (Morris and Richards, 1995
; Hellberg et al., 1996
). PGE2 formed via PGHS-2 initiates the acute cellular events associated with inflammation and is the product responsible for ovulation (Smith and Langenbach, 2001
). The subsequent biochemical cascade leads to collagen breakdown, apoptotic cell death at the ovarian surface and follicular rupture (Murdoch et al., 1999
). It follows that a compensatory anti-inflammatory mechanism is an obligatory component of this natural injuryrepair process, as summarized in Figure 7
.
|
Glucocorticoids exert anti-inflammatory effects via the ligand-activated glucocorticoid receptor (GR) signalling pathway in inflamed tissues, to antagonise the induction of the pro-inflammatory transcription factor nuclear NF-
B (van der Burg and van der Saag, 1996
Finally, these results cast new light on steroid signalling in the OSE. Until recently, the HOSE was seen as a relatively inert ovarian steroidogenic compartment. However, it seems increasingly likely that locally produced steroids and related molecules play significant roles in co-ordinating the cyclic waves of cellular proliferation, differentiation and death that naturally occur in the OSE. Glucocorticoid metabolism and signalling may hold particular relevance to the pathophysiology of the OSE, not least because of the inflammatory basis of ovulation (Espey, 1994
) and the epidemiological evidence that ovarian epithelial inflammation may play a role in ovarian cancer (Ness and Cottreau, 1999
; Ness et al., 2000
).
| Acknowledgements |
|---|
|
|
|---|
We are grateful to Ms Pawlina Largue for expert technical assistance, and the nursing staff of the Royal Infirmary of Edinburgh gynaecology theatres for assistance with the collection of HOSE specimens. Supported by MRC Programme Grant G0000066 to S.G.H.
| Notes |
|---|
3 To whom correspondence should be addressed. E-mail: s.hillier{at}ed.ac.uk
| References |
|---|
|
|
|---|
Adashi, E.Y. (1998) The potential role of interleukin-1 in the ovulatory process: an evolving hypothesis. Mol. Cell. Endocrinol., 140, 7781.[Web of Science][Medline]
Andersen, C.Y. and Hornnes, P. (1994) Intrafollicular concentrations of free cortisol close to follicular rupture. Hum. Reprod., 9, 19441949.
Andersen, C.Y., Morineau, G., Fukuda, M., Westergaard, L.G., Ingerslev, H.J., Fiet, J. and Byskov, A.G. (1999) Assessment of the follicular cortisol:cortisone ratio. Hum. Reprod., 14, 15631568.
Auersperg, N., Wong, A.S., Choi, K.C., Kang, S.K. and Leung, P.C. (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr. Rev., 22, 255288.
Brandenberger, A.W., Tee, M.K. and Jaffe, R.B. (1998) Estrogen receptor alpha (ER-alpha) and beta (ER-beta) mRNAs in normal ovary, ovarian serous cystadenocarcinoma and ovarian cancer cell lines: down-regulation of ER-beta in neoplastic tissues. J. Clin. Endocrinol. Metab., 83, 10251028.
Bukulmez, O. and Arici, A. (2000) Leukocytes in ovarian function. Hum. Reprod. Update, 6, 115.
Cai, T.Q., Wong, B., Mundt, S.S., Thieringer, R., Wright, S.D. and Hermanowski-Vosatka, A. (2001) Induction of 11beta-hydroxysteroid dehydrogenase type 1 but not -2 in human aortic smooth muscle cells by inflammatory stimuli. J. Steroid. Biochem. Mol. Biol., 77, 117122.[Web of Science][Medline]
Choi, K.C., Kang, S.K., Nathwani, P.S., Cheng, K.W., Auersperg, N. and Leung, P.C. (2001a) Differential expression of activin/inhibin subunit and activin receptor mRNAs in normal and neoplastic ovarian surface epithelium (OSE). Mol. Cell. Endocrinol., 17, 99110.
Choi, K.C., Kang, S.K., Tai, C.J., Auersperg, N, and Leung, P.C. (2001b) The regulation of apoptosis by activin and transforming growth factor-beta in early neoplastic and tumorigenic ovarian surface epithelium. J. Clin. Endocrinol. Metab., 86, 21252135.
Escher, G., Galli, I., Vishwanath, B.S., Frey, B.M. and Frey, F.J. (1997) Tumor necrosis factor alpha and interleukin 1beta enhance the cortisone/cortisol shuttle. J. Exp. Med., 186, 189198.
Espey, L.L. (1994) Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory reaction. Biol. Reprod., 50, 233238.[Abstract]
Fathalla, M.F. (1971) Incessant ovulationa factor in ovarian neoplasia? Lancet, ii, 7716.
Feinstein, M.B. and Schleimer, R.P. (1999) Regulation of the action of hydrocortisone in airway epithelial cells by11beta-hydroxysteroid dehydrogenase. Am. J. Respir. Cell. Mol. Biol., 21, 403408.
Gillett, W.R., Mitchell, A. and Hurst, P.R. (1992) A stereological study of the human ovarian surface epithelium. Hum. Reprod., 7, 446452.
Gordon, A.W., Pegues, J.C., Johnson, G.R., Kannan, B., Auersperg, N. and Stromberg, K. (1995) mRNA phenotyping of the major ligands and receptors of the EGF supergene family in human ovarian epithelial cells. Cancer Lett., 89, 6371.[Web of Science][Medline]
Harlow, C.R., Jenkins, J.M. and Winston, R.M. (1997) Increased follicular fluid total and free cortisol levels during the luteinizing hormone surge. Fertil. Steril., 68, 4853.[Web of Science][Medline]
Hellberg, P., Larson, L., Olofsson, J., Brannstrom, M. and Hedin, L. (1996) Regulation of the inducible form of prostaglandin endoperoxide synthase in the perfused rat. Mol. Hum. Reprod., 2, 111116.
Hillier, S.G. and Tetsuka, M. (1998) An anti-inflammatory role for glucocorticoids in the ovaries? J. Reprod. Immunol., 39, 2127.[Web of Science][Medline]
Hillier, S.G., Anderson, R.A., Williams, A.R. and Tetsuka, M. (1998) Expression of oestrogen receptor alpha and beta in cultured human ovarian surface epithelial cells. Mol. Hum. Reprod., 4, 811815.
Irahara, M., Ando, M., Sirois, J., Saito, J. and Adashi, E.Y. (1999) Glucocorticoid receptor-mediated post-ceramide inhibition of the interleukin-1beta-dependent induction of ovarian prostaglandin, endoperoxide synthase-2 in rats. Biol. Reprod., 60, 946953.
Ivarsson, K., Sundfeldt, K., Brannstrom, M. and Janson, P.O. (2001a) Production of steroids by human ovarian surface epithelial cells in culture: possible role of progesterone as growth inhibitor. Gynecol. Oncol., 82, 116121.[Web of Science][Medline]
Ivarsson, K., Sundfeldt, K., Brannstrom, M., Hellberg, P. and Janson, P.O. (2001b) Diverse effects of FSH and LH on proliferation of human ovarian surface epithelial cells. Hum. Reprod., 18, 23.
Kang, S.K., Choi, K.C., Cheng, K.W., Nathwani, P.S, Auersperg, N. and Leung, P.C. (2000) Related role of gonadotropin-releasing hormone as an autocrine growth factor in human ovarian surface epithelium. Endocrinology, 141, 7280.
Karlan, B.Y., Jones, J., Greenwald, M. and Lagasse, L.D. (1995) Steroid hormone effects on the proliferation of human ovarian surface epithelium in vitro. Am. J. Obstet. Gynecol., 173, 97104.[Web of Science][Medline]
Kuroda, H., Mandai, M., Konishi, I., Tsuruta, Y, Kusakari, T., Kariya, M. and Fujii, S. 2001 Human ovarian surface epithelial (OSE) cells express LH/hCG receptors, and hCG inhibits apoptosis of OSE cells via up-regulation of insulin-like growth factor-1. Int. J. Cancer, 91, 309315.
Kruk, P.A, Maines-Bandiera, S.L. and Auersperg, N. (1990) A simplified method to culture human ovarian surface epithelium. Lab. Invest., 63, 132136.[Web of Science][Medline]
Livak, K.J., Flood, S.J., Marmaro, J., Giusti, W. and Deetz, K. (1995) Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridisation. PCR Methods Appl., 4, 357362.[Web of Science][Medline]
McKay, L.I. and Cidlowski, J.A. (1999) Molecular control of immune/inflammatory responses: interactions between nuclear factor-kappa B and steroid receptor-signaling pathways. Endocr. Rev., 20, 4354359.
Marth, C., Zeimet, A.G., Herold, M., Brumm, C., Windbichler, G., Muller-Holzner, E., Offner, F., Feichtinger, H., Zwierzina, H. and Daxenbichler, G. (1996) Different effects of interferons, interleukin-1beta and tumor necrosis factor-alpha in normal (OSE) and malignant human ovarian epithelial cells. Int. J. Cancer, 67, 826830.[Web of Science][Medline]
Morris, J.K. and Richards, J.S. (1995) Luteinizing hormone induces prostaglandin endoperoxide synthase-2 and luteinization in vitro by A-kinase and C-kinase pathways. Endocrinology, 136, 15491558.[Abstract]
Murdoch, W.J., Wilken, C. and Young, D.A. (1999) Sequence of apoptosis and inflammatory necrosis within the formative ovulatory site of sheep follicles. J. Reprod. Fertil., 117, 325329.
Murdoch,W.J., Townsend, R.S. and McDonnel, A.C. (2001) Ovulation-induced DNA damage in ovarian surface epithelial cells of ewes: prospective regulatory mechanisms of repair/survival and apoptosis. Biol. Reprod., 65, 14171424.
Ness, R.B. and Cottreau, C. (1999) Possible role of ovarian epithelial inflammation in ovarian cancer. J. Natl Cancer Inst., 91, 14591467
Ness, R.B., Grisso, J.A., Cottreau, C., Klapper, J., Vergona, R., Wheeler, J.E., Morgan, M. and Schlesselman, J.J. (2000) Factors related to inflammation of the ovarian epithelium and risk of ovarian cancer. Epidemiology, 1, 111117.
Nilsson, E., Doraiswamy, V., Parrott, J.A. and Skinner, M.K. (2001) Expression and action of transforming growth factor beta (TGFbeta1, TGFbeta2, TGFbeta3) in normal bovine ovarian surface epithelium and implications for human ovarian cancer. Mol. Cell. Endocrinol., 182, 145155.[Web of Science][Medline]
Osterholzer, H.O., Johnson, J.H. and Nicosia, S.V. (1985) An autoradiographic study of rabbit ovarian surface epithelium before and after ovulation. Biol. Reprod., 33, 729738.[Abstract]
Ozols, R.F., Hamilton, T.C., Hoskins, W.J., Bast, R.C. Jr. and Young, R.C. (1991) Summary of symposium: Biology and therapy of ovarian cancer. Semin. Oncol., 18, 297306.[Web of Science][Medline]
Parrott. J.A., Doraiswamy, V., Kim, G., Mosher, R. and Skinner, M.K. (2001) Expression and actions of both the follicle stimulating hormone receptor and the luteinizing hormone receptor in normal ovarian surface epithelium and ovarian cancer. Mol. Cell. Endocrinol., 172, 213222.[Web of Science][Medline]
Salazar, H., Godwin, K., Getts, L.A., Testa, J.R., Daly, M., Rosenblum, N., Hogan, M., Ozols, R.F. and Hamilton, T.C. (1995) Spontaneous transformation of the ovarian surface epithelium and the biology of ovarian cancer. In Sharp, F., Mason, P., Blackett, T. and Berek, J., (eds) Ovarian Cancer 3. Chapman and Hall Medical, London, UK, pp. 145156.
Schleimer, R.P. (1991) Potential regulation of inflammation in the lung by local metabolism of hydrocortisone. Am. J. Respir. Cell Mol. Biol., 4, 166173.[Medline]
Sims, J.E., Nicklin, M.J., Bazan, J.F., Barton, J.L., Busfield, S.J., Ford, J.E., Kastelein, R.A., Kumar, S., Lin, H., Mulero, J.J. et al. (2001) A new nomenclature for IL-1-family genes. Trends Immunol., 22, 536537.[Web of Science][Medline]
Smith, W.L. and Langenbach, R. (2001) Why there are two cyclooxygenase isozymes. J. Clin. Invest., 107, 14911495.[Web of Science][Medline]
Smith, M.P., Mathur, R.S., Keay, S.D., Hall, L., Hull, M.G. and Jenkins, J.M. (2000) Periovulatory human oocytes, cumulus cells, and ovarian leukocytes express type 1 but not type 2 11beta-hydroxysteroid dehydrogenase RNA. Fertil. Steril., 73, 825830.[Web of Science][Medline]
Stewart, P.M. and Mason, J.I. (1995) Cortisol to cortisone: glucocorticoid to mineralocorticoid. Steroids, 60, 143146.[Web of Science][Medline]
Tannin, G.M., Agarwal, A.K., Monder, C., New, M.I. and White, P.C. (1991) The human gene for 11 beta-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localisation. J. Biol. Chem., 266, 1665316658.
Tetsuka, M., Thomas, F.J., Thomas, M.J., Anderson, R.A., Mason, J.I. and Hillier, S.G. (1997) Differential expression of messenger ribonucleic acids encoding 11beta-hydroxysteroid dehydrogenase types 1 and 2 in human granulosa cells. J. Clin. Endocrinol. Metab., 82, 20062009.[Web of Science][Medline]
Tetsuka, M., Haines, L.C., Milne, M., Simpson, G.E. and Hillier, S.G. (1999) Regulation of 11beta-hydroxysteroid dehydrogenase type 1 gene expression by LH and interleukin-1beta in cultured rat granulosa cells. J. Endocrinol., 163, 417423.[Abstract]
Thomas, F.J., Thomas, M.J., Tetsuka, M., Mason, J.I. and Hillier, S.G. (1998) Corticosteroid metabolism in human granulosalutein cells. Clin. Endocrinol. (Oxf.), 48, 509513.[Medline]
Tsao, S.W., Mok, S.C., Fey, E.G., Fletcher, J.A., Wan, T.S., Chew, E.C., Muto, M.G., Knapp, R.C. and Berkowitz, R.S. (1995) Characterization of human ovarian surface epithelial cells immortalized by human papilloma virus oncogenes. (HPV-E6E7 ORFS). Exp. Cell. Res., 218, 499507.[Web of Science][Medline]
van der Burg, B. and van der Saag, P.T. (1996) Nuclear factor-kappa-B/steroid hormone receptor interactions as a functional basis of anti-inflammatory action of steroids in reproductive organs. Mol. Hum. Reprod., 2, 433438.
Van Niekerk, C.C., Ramaekers, F.C., Hanselaar, A.G., Aldeweireldt, J. and Poels, L.G. (1993) Changes in expression of differentiation markers between normal ovarian cells and derived tumors. Am. J. Pathol., 142, 157177.[Abstract]
Wong, A.S., Pelech, S.L., Woo, M.M., Yim, G., Rosen, B., Ehlen, T., Leung, P.C. and Auersperg, N. (2001) Coexpression of hepatocyte growth factor-Met: an early step in ovarian carcinogenesis? Oncogene, 20, 13181328.[Web of Science][Medline]
Yong, P.Y.K., Thong, K.J., Andrew, R., Walker, B.R. and Hillier, S.G. (2000) Development-related increase in cortisol biosynthesis by human granulosa cells. J. Clin. Endocrinol. Metab., 85, 47284733.
Zheng, W., Lu, J.J., Luo, F., Zheng, Y., Feng, Y.J., Felix, J.C., Lauchlan, S.C. and Pike, M.C. (2000) Ovarian epithelial tumor growth promotion by follicle-stimulating hormone and inhibition of the effect by luteinizing hormone. Gynecol. Oncol., 76, 8088.[Web of Science][Medline]
Ziltener, H.J., Maines-Bandiera, S., Schrader, J.W. and Auersperg, N. (1993) Secretion of bioactive interleukin-1, interleukin-6, and colony-stimulating factors by human ovarian surface epithelium. Biol. Reprod., 49, 635641.[Abstract]
Submitted on February 25, 2002; accepted on May 15, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
G. Papacleovoulou, K. Hogg, K. S. Fegan, H. O.D. Critchley, S. G. Hillier, and J. I. Mason Regulation of 3{beta}-hydroxysteroid dehydrogenase type 1 and type 2 gene expression and function in the human ovarian surface epithelium by cytokines Mol. Hum. Reprod., June 1, 2009; 15(6): 379 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, P. Zhu, C. Guo, X. Zhu, and K. Sun Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Human Fetal Lung and Regulation of Its Expression by Interleukin-1{beta} and Cortisol J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 306 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D'Elia, J. Patenaude, and J. Bernier Regulation of glucocorticoid sensitivity in thymocytes from burn-injured mice Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E97 - E104. [Abstract] [Full Text] [PDF] |
||||
![]() |
K S Fegan, M T Rae, H O D Critchley, and S G Hillier Anti-inflammatory steroid signalling in the human peritoneum J. Endocrinol., February 1, 2008; 196(2): 369 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Myers, M. C. Lamont, S. van den Driesche, N. Mary, K. J. Thong, S. G. Hillier, and W. C. Duncan Role of Luteal Glucocorticoid Metabolism during Maternal Recognition of Pregnancy in Women Endocrinology, December 1, 2007; 148(12): 5769 - 5779. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G Hillier Diamonds are forever: the cortisone legacy J. Endocrinol., October 1, 2007; 195(1): 1 - 6. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Rae, O. Gubbay, A. Kostogiannou, D. Price, H. O. D. Critchley, and S. G. Hillier Thyroid Hormone Signaling in Human Ovarian Surface Epithelial Cells J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 322 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Dover, P. W. F. Hadoke, L. J. Macdonald, E. Miller, D. E. Newby, and B. R. Walker Intravascular Glucocorticoid Metabolism during Inflammation and Injury in Mice Endocrinology, January 1, 2007; 148(1): 166 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Jonas, C. Chandras, D. R. E. Abayasekara, and A. E. Michael Role for Prostaglandins in the Regulation of Type 1 11{beta}-Hydroxysteroid Dehydrogenase in Human Granulosa-Lutein Cells Endocrinology, December 1, 2006; 147(12): 5865 - 5872. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bruley, V. Lyons, A. G. F. Worsley, M. D. Wilde, G. D. Darlington, N. M. Morton, J. R. Seckl, and K. E. Chapman A Novel Promoter for the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Gene Is Active in Lung and Is C/EBP{alpha} Independent Endocrinology, June 1, 2006; 147(6): 2879 - 2885. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. C. Duncan, S. G. Hillier, E. Gay, J. Bell, and H. M. Fraser Connective Tissue Growth Factor Expression in the Human Corpus Luteum: Paracrine Regulation by Human Chorionic Gonadotropin J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5366 - 5376. [Abstract] [Full Text] [PDF] |
||||
![]() |
O Gubbay, W Guo, M T Rae, D Niven, A F Howie, A S McNeilly, L Xu, and S G Hillier Anti-inflammatory and proliferative responses in human and ovine ovarian surface epithelial cells Reproduction, November 1, 2004; 128(5): 607 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
M T Rae, D Niven, A Ross, T Forster, R Lathe, H O D Critchley, P Ghazal, and S G Hillier Steroid signalling in human ovarian surface epithelial cells: the response to interleukin-1{alpha} determined by microarray analysis J. Endocrinol., October 1, 2004; 183(1): 19 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Tomlinson, E. A. Walker, I. J. Bujalska, N. Draper, G. G. Lavery, M. S. Cooper, M. Hewison, and P. M. Stewart 11{beta}-Hydroxysteroid Dehydrogenase Type 1: A Tissue-Specific Regulator of Glucocorticoid Response Endocr. Rev., October 1, 2004; 25(5): 831 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Rae, D. Niven, H. O. D. Critchley, C. R. Harlow, and S. G. Hillier Antiinflammatory Steroid Action in Human Ovarian Surface Epithelial Cells J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4538 - 4544. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sasson, E. Rimon, A. Dantes, T. Cohen, V. Shinder, A. Land-Bracha, and A. Amsterdam Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases Mol. Hum. Reprod., May 1, 2004; 10(5): 299 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sun and L. Myatt Enhancement of Glucocorticoid-Induced 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression by Proinflammatory Cytokines in Cultured Human Amnion Fibroblasts Endocrinology, December 1, 2003; 144(12): 5568 - 5577. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.M. Thurston, D.P. Norgate, K.C. Jonas, L. Gregory, P.J. Wood, B.A. Cooke, and A.E. Michael Ovarian modulators of type 1 11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) activity and intra-follicular cortisol:cortisone ratios correlate with the clinical outcome of IVF Hum. Reprod., August 1, 2003; 18(8): 1603 - 1612. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














