Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lam, P. M.
Right arrow Articles by Haines, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lam, P. M.
Right arrow Articles by Haines, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Reproduction, Vol. 18, No. 11, 2264-2269, November 2003
© 2003 European Society of Human Reproduction and Embryology

Increased mRNA expression of vascular endothelial growth factor and its receptor (flt-1) in the hydrosalpinx

Po Mui Lam1,3, Christine Briton-Jones2, Che Kwok Cheung2, Lai See Po2, Lai Ping Cheung1 and Christopher Haines2

1 Department of Obstetrics and Gynecology, Prince of Wales Hospital (PWH) and 2 Department of Obstetrics and Gynaecology, The Chinese University of Hong Kong (CUHK), Hong Kong

3 To whom correspondence should be addressed at: Department of Obstetrics and Gynecology, Prince of Wales Hospital, 30–32 Ngan Shing Street, Shatin, New Territories, Hong Kong. e-mail: Lampomui{at}cuhk.edu.hk


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
BACKGROUND: The adverse effects of hydrosalpinx on the outcomes of IVF have been well documented, but the mechanisms of hydrosalpinx fluid formation remain unclear. This study compares the mRNA expression of vascular endothelial growth factor (VEGF) and its receptors (KDR and flt-1) in the hydrosalpinx with that in the healthy oviduct. METHODS: Oviduct tissue was collected from 10 infertile women with hydrosalpinx and 10 parous women with healthy oviduct. The mRNA expression of VEGF and its receptors in isolated oviduct epithelial cells were analysed using semi-quantitative reverse–transcriptase PCR. RESULTS: mRNA expression of VEGF and its receptor flt-1 in the hydrosalpinx was significantly higher than that in the healthy oviduct, but no significant difference was demonstrated for the KDR receptor. CONCLUSIONS: This study supports the notion that VEGF may play an important role in the hydrosalpinx fluid formation, possibly by promoting vascular and epithelial permeability and therefore serum transudation.

Key words: hydrosalpinx/mRNA/RT–PCR/VEGF


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Hydrosalpinx, as diagnosed by hysterosalpingography or laparoscopy, is present in about one-quarter of infertile patients with tubal problems (Blazar et al., 1997Go). It was previously assumed that pregnancy rate should approach that of a normal population when the damaged tubes were bypassed by IVF (Lenton et al., 1992Go). Numerous studies, however, have convincingly demonstrated an adverse effect of hydrosalpinx on the implantation and pregnancy rates of IVF cycles (Zeyneloglu et al., 1998Go; Camus et al., 1999Go). Thus, salpingectomy before IVF is suggested to eliminate the detrimental effects of hydrosalpinx. A randomized multicentre trial has shown a statistically significant benefit of salpingectomy for ultrasound-visible hydrosalpinx prior to IVF (Strandell et al., 1999Go; 2001Go). Nevertheless, it is usually difficult for the infertile couples to accept the option of salpingectomy and the procedure itself carries some operative risks. In this way, an understanding of the mechanisms of hydrosalpinx fluid formation may be essential in developing a more rational therapy that is less invasive and more acceptable to patients.

Oviductal fluid is a complex mixture of plasma-derived constituents and proteins synthesized by the oviduct epithelium (Verhage et al., 1988Go; Willis et al., 1994Go). Analysis of hydrosalpinx fluid reveals electrolyte concentrations similar to those in serum but with lower levels of total protein and albumin (Ng et al., 1997Go; Granot et al., 1998Go). Thus, serum transudation may be the main mechanism for the formation of hydrosalpinx fluid, with reduced protein synthesis in the damaged oviduct epithelium. Vascular endothelial growth factor (VEGF), a known permeability enhancing factor, has been localized in human oviductal epithelium (Gordon et al., 1996Go). We have also shown that VEGF expression in the healthy oviduct is parallel to the regional and temporal modulation of oviductal fluid secretion (Lam et al., 2003Go). This finding suggests that VEGF may be a controller of oviductal secretion by promoting vascular and epithelial permeability and thereby serum transudation into the oviduct lumen. Also, recent studies have shown that VEGF expression can be up-regulated by bacterial lipopolysaccharide (van Der Flier et al., 2000Go; Morozumi et al., 2001Go; Nielsen et al., 2001Go). In this way, VEGF may play an important role in pelvic inflammatory disease for the subsequent hydrosalpinx fluid formation.

This study compares the mRNA expression of VEGF and its receptors (VEGF-R), flt-1 and KDR, in the hydrosalpinx with that in the healthy oviduct, using semi-quantitative reverse–transcriptase PCR (RT–PCR) analysis. The results may help in the understanding of the mechanisms of hydrosalpinx fluid formation.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The study was approved by the Clinical Research Ethics Committee of the Chinese University of Hong Kong.

Subjects
Ten infertile women with ultrasound-visible hydrosalpinx, who underwent laparoscopic salpingectomy before IVF cycle, were recruited as the study group. Another ten parous women with no tubal pathology, who underwent laparoscopic tubal sterilization, were recruited as the control group. All subjects had regular monthly menstrual cycles and were not on any exogenous hormone in the past three months. The cycle was divided into five stages that were determined by the date of commencement of last menstrual period (LMP) and were confirmed by appropriate serum concentrations of luteinizing hormone (LH), follicle stimulating hormone (FSH), estradiol (E2) and progesterone. Two women in the study group, one in the early follicular stage and the other in the periovulatory stage, as well as one woman in the control group who was in the early follicular stage, were excluded because their LMP did not correspond with the serum LH, FSH, E2 and progesterone concentrations.

The stages of the ovulatory cycle, at which the oviduct tissue was collected were matched in the study group and the control group. In each group, there were two women in each stage, namely stage 1 (early follicular phase, day 1–5), stage 2 (mid-follicular phase, day 6–12), stage 3 (periovulatory phase, day 13–17), stage 4 (early or mid-luteal phase, day 18–23), and stage 5 (late luteal phase, day 24–28). Informed consent was obtained from each participant.

Oviduct tissue dissection and preparation
Oviduct tissue was excised in the operation of laparoscopic salpingectomy for removal of hydrosalpinx or for sterilization. Excised tissue was immediately placed in 20 ml of HEPES-buffered Quinn’s human tubal fluid (Irvine Scientific, Santa Ana, CA). This medium was used for all tissue manipulation that was carried out at room temperature. The ampullary part of oviduct tissue, which was defined as the parts 4–6 cm from the proximal ends (Lam et al., 2003Go), was collected because it is the site of fertilization and early embryo development.

The lumen of the oviduct was exposed by incising along the antimesenteric border, and the tissue was rinsed to minimize the contamination by hydrosalpinx fluid or blood cells. Only the mucosal layer was dissected off macroscopically. The mucosal strips were cut into 1 mm3 pieces and digested by trypsinization (0.05% trypsin and 0.53 mmol/l ethylenediaminetetraacetic acid; Gibco-BRL, Carlsbad, CA). Immunohistochemistry confirmed that >95% of the cells stained positively for the specific marker cytokeratin, supporting the epithelial cell origin. An aliquot of the cell suspension was placed into an Eppendorf tube and stored at –70°C for subsequent mRNA isolation.

Only two of the investigators performed the tissue dissection and preparation, and the technique was closely monitored to ensure accurate replication. The duration and conditions of the isolation procedures of oviduct mucosal cells were the same for the hydrosalpinx and the healthy oviduct tissue. The procedures were performed under room conditions, and the cells were not subjected to any culture or hypoxic conditions.

Semi-quantitative RT–PCR
mRNA was extracted from the epithelial cells of ampullary regions of oviduct using the Oligotex Direct mRNA kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Integrity of RNA was checked by electrophoresis of samples in a 2% agarose gel stained with ethidium bromide. mRNA (1.6 µg) was treated with 1 U of RNase-free DNase (Boehringer Mannheim/Hoffman-La Roche, Basel, Switzerland) before reverse transcription to remove contaminating genomic DNA. Then, the DNase was inactivated by incubating for 5 min at 90°C, and 100 ng of mRNA was used for cDNA synthesis with Multiscribe reverse transcriptase (PE Biosystems, Foster City, CA). All the resultant cDNA was then used for PCR with Amplitaq Gold DNA polymerase (PE Biosystems). Each PCR cycle consisted of denaturation at 95°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 1 min. Thirty cycles were performed, followed by a final extension at 72°C for 5 min.

Forward and reverse primers specific to VEGF were derived from the published primer sequences (Krussel et al., 2000Go). The sequences of the oligonucleotide primers were forward GGGCAGAATCAT CACGA, and reverse TGGTCTGCATTCACATTTG (Mwgag Biotech, Ebersberg, Germany). To ensure that the detected product resulted from the amplification of cDNA rather than contaminating genomic DNA, primers have been designed to cross exon–exon boundaries. It was shown that VEGF165 and, to a lesser extent, VEGF121 are the predominant isoforms of VEGF in bovine oviduct; however, each of the VEGF isoforms showed the same pattern of expression in oviduct (Gabler et al., 1999Go). Therefore, primers have been specifically designed to detect all VEGF isoforms for increased sensitivity. Primers were tested with cDNA obtained from luteal phase human endometrium, a known source of VEGF mRNA, and the identity of the PCR products was confirmed by sequence analysis (Krussel et al., 2000Go).

Forward and reverse primers specific to the VEGF-R, KDR and flt-1, were also derived from the published cDNA sequences (de Vries et al., 1992Go; Charnock-Jones et al., 1994Go). The sequences of the oligonucleotide primers for KDR were forward ACGCTGACA TGTACGGTCTAT, and reverse GCCAAGCTTGTACCATGTGAG (Mwgag Biotech). The sequences of the oligonucleotide primers for flt-1 were forward GTCACAGAAGAGGATGAAGGTGTCTA, and reverse CACAGTCCGGCACGTAGGTGATT (Mwgag Biotech). Primers have been tested with cDNA obtained from ovarian microvascular endothelium, a known source of VEGF-R mRNA, and the identity of the PCR products has been confirmed by sequence analysis (Ratcliffe et al., 1999Go; Krussel et al., 2000Go).

{beta}-actin was co-amplified with VEGF to provide a semi-quantitative internal control for RNA quantity and PCR efficiency. {beta}-actin is commonly used as a standard when comparing samples under different hormonal conditions (LaPolt et al., 1990Go; Tilly et al., 1992Go; Mattioli et al., 2001Go) as it is constitutively expressed (Soutar et al., 1997Go). It has also been specifically used for human oviduct tissue and its expression is not affected by gonadotropins or sex hormones (Briton-Jones et al., 2001Go). Forward and reverse primers specific to {beta}-actin were also derived from the published primer sequences (Soutar et al., 1997Go). The sequences of the {beta}-actin primers were forward ATCGTGGGGCGCCCCAGGCAC, and reverse CTCCTTAATGTCACGCACGATTTC (Mwgag Biotech).

The RT–PCR assay was validated. The amount of co-amplified product for VEGF or VEGF-R (experimental) and {beta}-actin (internal standard) primer sets was linear and parallel with increasing amounts of cDNA. The cycle number and primers concentrations were optimized in the exponentially increasing phase of detectable product. Thirty cycles of PCR were performed for each cDNA sample with 100 pmol/l VEGF or VEGF-R primer and 5 pmol/l {beta}-actin primer added. In order to estimate within-assay variability, RNA from five oviduct tissues collected from women in various phases of an ovulatory cycle was combined and reverse transcribed to form a pool that was amplified as four replicates during the PCR. Within-assay variability typically ranged from <1 to 12%.

Twenty percent of each PCR was separated by gel electrophoresis on 2% agarose gel with 0.5 µg/ml ethidium bromide in Tris–borate ethelenediaminetetraacetic acid (TBE) buffer. The separated PCR products were visualized under ultraviolet light. A video camera sent the UV-illuminated gel image to a computer, where the software package Gel Doc (Model GS-1000; Bio-Rad Laboratories, Hercules, CA) enabled an image of the gel to be recorded. The integrated optical density (IOD) was determined for each PCR product by the Molecular Analyst Software (Bio-Rad Laboratories). The IOD ratio between the PCR-amplified VEGF or VEGF-R product (297 base pairs for VEGF, 421 base pairs for KDR and 414 base pairs for flt-1) and its simultaneously amplified control {beta}-actin (543 base pairs) was obtained for each sample. The ratio, VEGF/{beta}-actin ratio or VEGF-R/{beta}-actin ratio, was normalized to the lowest value for subsequent analysis.

Hormone assays
Both serum LH and FSH were quantified by using a two-site sandwich immunoassay and direct chemiluminescence technology (Bayer, Tarrytown, NY) (Letellier et al., 1996Go). Serum E2 and progesterone were both quantified using a competitive immunoassay and direct chemiluminescence technology (Bayer) (Levesque et al., 1997Go). The principles of the hormone assays as well as their interassay coefficients of variation were as previously described (Lam et al., 2003Go).

Statistics
The results were analysed using the SPSS software. One-way analysis of variance was used to evaluate the differences in serum hormone concentrations in various menstrual stages. A paired sample t-test was used to examine the differences in serum hormone concentrations between the study group and the control group. The differences in the mRNA expression of VEGF and its receptors between the two groups were evaluated by the independent samples t-test. Statistical significance was accepted at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Clinical characteristics of the participants
The serum concentrations of LH, FSH, E2 and progesterone in each stage of the cycle at which oviductal tissues were collected is summarized in Table I. The serum concentrations of LH, FSH and E2 were significantly higher in the periovulatory stage than in the other menstrual stages. In addition, the serum concentration of progesterone was significantly higher in the early or mid-luteal stage than in the other menstrual stages. These findings confirmed the proper classification of the stages of the ovulatory cycle, which were matched in the study group and the control group. The matching was further supported by the significant correlation (correlation coefficients >0.9, P < 0.01) and lack of significant differences (95% confidence interval: LH, –2.5 to 6.5 IU/ml; FSH, –0.7 to 2.6 IU/ml; E2, –109.0 to 53.6 pmol/l; and progesterone, –0.9 to 1.4 nmol/l) in the serum concentrations of LH, FSH, E2 and progesterone between the two groups.


View this table:
[in this window]
[in a new window]
 
Table I. The serum concentrations of LH, FSH, E2 and progesterone in each stage of the menstrual cycle, at which oviductal tissues were collected
 
The differences in mRNA expression of VEGF and its receptors in the hydrosalpinx and the healthy oviduct
The VEGF/{beta}-actin ratio and the flt-1/{beta}-actin ratio were significantly higher in the hydrosalpinx than in the healthy oviduct (5.7 ± 0.5 versus 2.6 ± 0.2 and 5.6 ± 0.3 versus 2.6 ± 0.2, respectively; P < 0.05). There were no significant differences in the KDR/{beta}-actin ratio between the hydrosalpinx and the healthy oviduct (3.6 ± 0.2 versus 3.1 ± 0.3, respectively; P > 0.05). This is illustrated in Figure 1. The effect of the ovulatory cycle is demonstrated by the boxplots in Figure 2, which show the variation of the VEGF/{beta}-actin ratio and the VEGF-R/{beta}-actin ratio in different menstrual stages for both the hydrosalpinx and the healthy oviduct.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. The mean VEGF/{beta}-actin ratio and VEGF-R/{beta}-actin ratio in the hydrosalpinx and in the healthy oviduct. Error bars show the standard error of the mean. Asterisks indicate a significant difference between the hydrosalpinx and the healthy oviduct (P < 0.05).

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Boxplots showing the variation of the VEGF/{beta}-actin ratio and the VEGF-R/{beta}-actin ratio in different menstrual stages for both the hydrosalpinx and the healthy oviduct. EF = early follicular phase; MF = mid-follicular phase; PO = periovulatory phase; ML = early or mid-luteal phase; LL = late luteal phase.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The adverse effects of hydrosalpinx on the outcome of IVF have been well documented. Patients with hydrosalpinx have a lower implantation and pregnancy rate of IVF cycles and a higher incidence of early pregnancy loss than those without hydrosalpinx (Zeyneloglu et al., 1998Go; Barmat et al., 1999Go; Camus et al., 1999Go). Various hypotheses have been proposed to explain these adverse effects (Strandell and Lindhard, 2002Go). On one hand, the hydrosalpinx fluid may leak into the uterine cavity and prevent the interaction between the embryo and the endometrium through a washout mechanism (Granot et al., 1998Go). On the other hand, the hydrosalpinx fluid may be toxic to the embryo itself (Li et al., 2000Go) or render the endometrium hostile to the embryo implantation and development (Meyer et al., 1997Go; Freeman et al., 1998Go).

In our study, the observation of increased mRNA expression of VEGF and its receptor flt-1 in the hydrosalpinx supports the notion that VEGF may play an important role in hydrosalpinx fluid formation, possibly mediated via the flt-1 pathway by promoting permeability. The mechanisms of increased VEGF expression in the hydrosalpinx remain unclear. We speculated that up-regulation of VEGF expression by bacterial lipopolysaccharide (van Der Flier et al., 2000Go; Morozumi et al., 2001Go; Nielsen et al., 2001Go) or by paracrine control of other inflammatory cytokines such as interleukin-6 (Cohen et al., 1996Go; Nakahara et al., 2003Go) may play a role. However, the significance of hydrostatic pressure in regulating epithelial VEGF expression in the hydrosalpinx is unclear, as hydrostatic pressure will reduce the VEGF expression in the endothelial cells instead (Gan et al., 2000Go; Conklin et al., 2002Go).

VEGF binds to two tyrosine kinase receptors, flt-1 and KDR (Shibuya et al., 1990Go; Terman et al., 1991Go). There is evidence that flt-1 and KDR may mediate different functions of VEGF. Our results suggest that flt-1 may be the main receptor responsible for the actions of VEGF in the hydrosalpinx. This postulation is supported by the previous finding that flt-1 instead of KDR was implicated in increased expression of serine proteases such as matrix metalloproteinases (Wang and Keiser, 1998Go), a known effect of hydrosalpinx fluid (Jastrow et al., 2002Go).

It is well established that the female reproductive system undergoes a number of programmed cyclical processes along the course of an ovulatory cycle. The cyclical modulation of mRNA expression of VEGF and its receptor flt-1, with the strongest expression in the periovulatory phase, has been demonstrated in healthy oviduct in our previous study (Lam et al., 2003Go). Because of the small sample size (n = 2 in each menstrual stage for each group), our current study was not powered to evaluate this effect of the ovulatory cycle. The boxplots showing the variation of the mRNA expression of VEGF and its receptors in different menstrual stages supported the similar pattern of cyclical modulation in healthy oviduct and possibly in hydrosalpinx as well. However, the effect of the ovulatory cycle on the expression of VEGF and its receptors in hydrosalpinx requires further evaluation with a larger sample size.

It is well established that VEGF, an important angiogenic factor, is up-regulated by hypoxia (Minchenko et al., 1994Go). Therefore, for the study on VEGF, it is very important to control the experimental conditions to minimize the confounding effects by hypoxia. In our study, fresh rather than cultured oviduct mucosal cells were collected, and the isolation procedures of all the samples were performed under the same conditions by only two investigators. Nevertheless, we recognize the limitation that our study has only examined the expression of VEGF at the gene transcriptional level in isolated oviduct mucosal cells. Future studies on VEGF expression at the protein level in intact epithelium of the hydrosalpinx, for example by western blot analysis, will be helpful to confirm the findings in-vivo.

Although VEGF may be an important mediator for hydrosalpinx fluid formation, inhibition of VEGF activities cannot prevent epithelial damage and occlusion of the oviduct after pelvic inflammatory disease. Therefore, the clinical applicability of VEGF inhibitors in preserving fertility potential after pelvic inflammatory disease is very limited. Nevertheless, whether VEGF inhibitors can reduce serum transudation and therefore hydrosalpinx fluid formation, especially in women with mild pelvic infection without tubal occlusion, requires further elucidation. If this potential treatment modality is found to be effective, it may improve the IVF outcomes for infertile women with hydrosalpinx.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Barmat, L., Rauch, E., Spandorfer, S., Kowalik, A., Sills, E., Schattman, G., Liu, H. and Rosenwaks, Z. (1999) The effect of hydrosalpinges on IVF-ET outcome. J. Assist. Reprod. Genet., 16, 350–354.[CrossRef][Web of Science][Medline]

Blazar, A.S., Hogan, J.W., Seifer, D.B., Frishman, G.N., Wheeler, C.A. and Haning, R.V. (1997) The impact of hydrosalpinx on successful pregnancy in tubal factor infertility treated by in vitro fertilization. Fertil. Steril., 67, 517–520.[CrossRef][Web of Science][Medline]

Briton-Jones, C., Lok, I.H., Yuen, P.M., Chiu, T.T., Cheung, L.P. and Haines, C. (2001) Regulation of human oviductin mRNA expression in vivo. Fertil. Steril., 75, 942–946.[CrossRef][Web of Science][Medline]

Camus, E., Poncelet, C., Goffinet, F., Wainer, B., Merlet, F., Nisand, I. and Philippe, H.J. (1999) Pregnancy rates after in-vitro fertilization in cases of tubal infertility with and without hydrosalpinx: a meta-analysis of published comparative studies. Hum. Reprod., 14, 1243–1249.[Abstract/Free Full Text]

Charnock-Jones, D.S., Sharkey, A.M., Boocock, C.A., Ahmed, A., Plevin, R., Ferrara, N. and Smith, S.K. (1994) Vascular endothelial growth factor receptor localization and activation in human trophoblast and choriocarcinoma cells. Biol. Reprod., 51, 524–530.[Abstract]

Cohen, T., Nahari, D., Cerem, L., Neufeld, G. and Levi, B. (1996) Interleukin 6 induces the expression of vascular endothelial growth factor. J. Biol. Chem., 271, 736–741.[Abstract/Free Full Text]

Conklin, B., Zhong, D., Zhao, W., Lin, P. and Chen, C. (2002) Shear stress regulates occludin and VEGF expression in porcine arterial endothelial cells. J. Surg. Res., 102, 13–21.[CrossRef][Web of Science][Medline]

de Vries, C., Escobedo, J.A., Ueno, H., Houck, K., Ferrara, N. and Williams, L.T. (1992) The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science, 255, 989–991.[Abstract/Free Full Text]

Freeman, M., Whitworth, C. and Hill, G. (1998) Permanent impairment of embryo development by hydrosalpinges. Hum. Reprod., 13, 983–986.[Abstract/Free Full Text]

Gabler, C., Einspanier, A., Schams, D. and Einspanier, R. (1999) Expression of vascular endothelial growth factor (VEGF) and its corresponding receptors (flt-1 and flk-1) in the bovine oviduct. Mol. Reprod. Dev., 53, 376–383.[CrossRef][Web of Science][Medline]

Gan, L., Miocic, M., Doroudi, R., Selin-Sjogren, L. and Jern, S. (2000) Distinct regulation of vascular endothelial growth factor in intact human conduit vessels exposed to laminar fluid shear stress and pressure. Biochem. Biophys. Res. Commun., 272, 490–496.[CrossRef][Web of Science][Medline]

Gordon, J.D., Mesiano, S., Zaloudek, C.J. and Jaffe, R.B. (1996) Vascular endothelial growth factor localization in human ovary and fallopian tubes: possible role in reproductive function and ovarian cyst formation. J. Clin. Endocrinol. Metab., 81, 353–359.[Abstract]

Granot, I., Dekel, N., Segal, I., Fieldust, S., Shoham, Z. and Barash, A. (1998) Is hydrosalpinx fluid cytotoxic? Hum. Reprod., 13, 1620–1624.[Abstract/Free Full Text]

Jastrow, N., Chardonnens, D., Araman, M., Meisser, A., Campana, A. and Bischof, P. (2002) Effect of hydrosalpinx fluid on secretion of trophoblastic matrix metalloproteinases. Fertil. Steril., 77, 588–594.[CrossRef][Web of Science][Medline]

Krussel, J., Behr, B., Hirchenhain, J., Wen, Y., Milki, A.A., Cupisti, S., Bielfeld, P. and Polan, M.L. (2000) Expression of vascular endothelial growth factor mRNA in human preimplantation embryos derived from tripronuclear zygotes. Fertil. Steril., 74, 1220–1226.[CrossRef][Web of Science][Medline]

Lam, P., Briton-Jones, C., Cheung, C., Lok, I., Yuen, P., Cheung, L. and Haines, C. (2003) Vascular endothelial growth factor in the human oviduct: localization and regulation of messenger RNA expression in vivo. Biol. Reprod., 68, 1870–1876.[Abstract/Free Full Text]

LaPolt, P.S., Piquette, G.N., Soto, D., Sincich, C. and Hsueh, A.J. (1990) Regulation of inhibin subunit messenger ribonucleic acid levels by gonadotropins, growth factors, and gonadotropin-releasing hormone in cultured rat granulosa cells. Endocrinology, 127, 823–831.[Abstract/Free Full Text]

Lenton, E.A., Cooke, I.D., Hooper, M., King, H., Kumar, A., Monks, N., Turner, K. and Verma, S. (1992) In vitro fertilization in the natural cycle. Baillieres Clin. Obstet. Gynaecol., 6, 229–245.[CrossRef][Web of Science][Medline]

Letellier, M., Levesque, A., Daigle, F. and Grant, A. (1996) Performance evaluation of automated immunoassays on the Technicon Immuno 1 system. Clin. Chem., 42, 1695–1701.[Abstract/Free Full Text]

Levesque, A., Letellier, M., Dillon, P.W. and Grant, A. (1997) Analytical performance of Bayer Immuno 1 estradiol and progesterone assays. Clin. Chem., 43, 1601–1609.[Abstract/Free Full Text]

Li, B., Fuh, G., Meng, G., Xin, X., Gerritsen, M.E., Cunningham, B. and de Vos, A.M. (2000) Receptor-selective variants of human vascular endothelial growth factor. Generation and characterization. J. Biol. Chem., 275, 29823–29828.[Abstract/Free Full Text]

Mattioli, M., Barboni, B., Turriani, M., Galeati, G., Zannoni, A., Castellani, G., Berardinelli, P. and Scapolo, P.A. (2001) Follicle activation involves vascular endothelial growth factor production and increased blood vessel extension. Biol. Reprod., 65, 1014–1019.[Abstract/Free Full Text]

Meyer, W., Castelbaum, A., Somkuti, S., Sagoskin, A., Doyle, M., Harris, J. and Lessey, B. (1997) Hydrosalpinges adversely affect markers of endometrial receptivity. Hum. Reprod., 12, 1393–1398.[Abstract/Free Full Text]

Minchenko, A., Bauer, T., Salceda, S. and Caro, J. (1994) Hypoxic stimulation of vascular endothelial growth factor expression in vitro and in vivo. Lab. Invest., 71, 374–379.[Web of Science][Medline]

Morozumi, T., Kubota, T., Sugita, N., Ohsawa, Y., Yamazaki, K. and Yoshie, H. (2001) Elevated mRNA expression for supervillin and vascular endothelial growth factor in human neutrophils stimulated with lipopolysaccharide from Porphyromonas gingivalis. J. Periodontal Res., 36, 160–168.[CrossRef][Web of Science][Medline]

Nakahara, H., Song, J., Sugimoto, M., Hagihara, K., Kishimoto, T., Yoshizaki, K. and Nishimoto, N. (2003) Anti-interleukin-6 receptor antibody therapy reduces vascular endothelial growth factor production in rheumatoid arthritis. Arthritis Rheum., 48, 1521–1529.[CrossRef][Web of Science][Medline]

Ng, E., Yeung, W. and Ho, P. (1997) The presence of hydrosalpinx may not adversely affect the implantation and pregnancy rates in in vitro fertilization treatment. J. Assist. Reprod. Genet., 14, 508–512.[CrossRef][Web of Science][Medline]

Nielsen, H.J., Werther, K., Mynster, T., Svendsen, M.N., Rosendahl, S., Elley, T. and Skov, F. (2001) Bacteria-induced release of white cell- and platelet-derived vascular endothelial growth factor in vitro. Vox Sang., 80, 170–178.[CrossRef][Web of Science][Medline]

Ratcliffe, K.E., Anthony, F.W., Richardson, M.C. and Stones, R.W. (1999) Morphology and functional characteristics of human ovarian microvascular endothelium. Hum. Reprod., 14, 1549–1554.[Abstract/Free Full Text]

Shibuya, M., Yamaguchi, S., Yamane, A., Ikeda, T., Tojo, A., Matsushime, H. and Sato, M. (1990) Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. Oncogene, 5, 519–524.[Web of Science][Medline]

Soutar, R.L., Dillon, J. and Ralston, S.H. (1997) Control genes for reverse-transcription-polymerase chain reaction: a comparison of beta actin and glyceraldehyde phosphate dehydrogenase. Br. J. Haematol., 97, 247–248.[CrossRef][Web of Science][Medline]

Strandell, A. and Lindhard, A. (2002) Why does hydrosalpinx reduce fertility? The importance of hydrosalpinx fluid. Hum. Reprod., 17, 1141–1145.[Abstract/Free Full Text]

Strandell, A., Lindhard, A., Waldenstrom, U., Thorburn, J., Janson, P.O. and Hamberger, L. (1999) Hydrosalpinx and IVF outcome: a prospective, randomized multicentre trial in Scandinavia on salpingectomy prior to IVF. Hum. Reprod., 14, 2762–2769.[Abstract/Free Full Text]

Strandell, A., Lindhard, A., Waldenstrom, U. and Thorburn, J. (2001) Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial. Hum. Reprod., 16, 2403–2410.[Abstract/Free Full Text]

Terman, B.I., Carrion, M.E., Kovacs, E., Rasmussen, B.A., Eddy, R.L. and Shows, T.B. (1991) Identification of a new endothelial cell growth factor receptor tyrosine kinase. Oncogene, 6, 1677–1683.[Web of Science][Medline]

Tilly, J.L., Kowalski, K.I., Schomberg, D.W. and Hsueh, A.J. (1992) Apoptosis in atretic ovarian follicles is associated with selective decreases in messenger ribonucleic acid transcripts for gonadotropin receptors and cytochrome P450 aromatase. Endocrinology, 131, 1670–1676.[Abstract/Free Full Text]

van Der Flier, M., Coenjaerts, F., Kimpen, J.L., Hoepelman, A.M. and Geelen, S.P. (2000) Streptococcus pneumoniae induces secretion of vascular endothelial growth factor by human neutrophils. Infect. Immun., 68, 4792–4794.[Abstract/Free Full Text]

Verhage, H.G., Fazleabas, A.T. and Donnelly, K. (1988) The in vitro synthesis and release of proteins by the human oviduct. Endocrinology, 122, 1639–1645.[Abstract/Free Full Text]

Wang, H. and Keiser, J.A. (1998) Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: role of flt-1. Circ. Res., 83, 832–840.[Web of Science][Medline]

Willis, P., Sekhar, K.N., Brooks, P. and Fayrer-Hosken, R.A. (1994) Electrophoretic characterization of equine oviductal fluid. J. Exp. Zool., 268, 477–485.[CrossRef][Web of Science][Medline]

Zeyneloglu, H.B., Arici, A. and Olive, D.L. (1998) Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization-embryo transfer. Fertil. Steril., 70, 492–499.[CrossRef][Web of Science][Medline]

Submitted on May 27, 2003; resubmitted on June 23, 2003; accepted on July 22, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lam, P. M.
Right arrow Articles by Haines, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lam, P. M.
Right arrow Articles by Haines, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?