Human Reproduction, Vol. 18, No. 2, 262-266,
February 2003
© 2003 European Society of Human Reproduction and Embryology
Influence of the catechol-O-methyltransferase (COMT) codon 158 polymorphism on estrogen levels in women
Department of Obstetrics and Gynaecology, Vienna University Hospital, Waehringer Guertel 1820, 1090 Vienna, Austria
1 To whom correspondence should be addressed. e-mail: michael.sator{at}akh-wien.ac.at
| Abstract |
|---|
|
|
|---|
BACKGROUND: Catechol-O-methyltransferase (COMT) is the principal enzyme in the conjugation pathway for hydroxylated estrogens. We hypothesize that blood 17
-estradiol (E2) and estrone (E1) levels in postmenopausal women receiving an oral E2 preparation are dependent on the enzyme activity of COMT. METHODS: To determine the influence of this enzyme on E2 serum levels three groups of 12 selected from 159 healthy normotensive postmenopausal women were selected according to their codon 158 COMT genotype (COMTHH, COMTHL, COMTLL) which is known to be associated with enzyme activity. All selected women received one 2 mg tablet estradiol valerate and blood samples were taken before treatment and after 1, 3 and 48 h. RESULTS: After 3 h the serum levels of E2 were significantly higher in women with the COMTLL genotype (median 69 pg/ml, range 5891) and the COMTHL genotype (median 69 pg/ml, range 4384) compared with women with the COMTHH genotype (median 45 pg/ml, range 1568, P < 0.005). In a univariate analysis of variance, considering age, body weight, and COMT genotype, body weight (P = 0.034) and COMT genotype (P < 0.001) were independently related to the increase of serum E2 levels, whereas age was not. CONCLUSIONS: Our data demonstrate that serum E2 levels significantly correlate with the COMT genotype. Differences in COMT genotype might be involved in causing variable effects of estrogens on diseases such as hormone-dependent cancers, coronary heart disease and on efficacy of hormone replacement therapy.
Key words: codon 158 polymorphism/COMT/estrogen levels/hormone replacement therapy/menarche
| Introduction |
|---|
|
|
|---|
Catechol-O-methyltransferase (COMT) is involved in catechol homeostasis, which plays both a regulatory and protective role (Männistö and Kaakkola, 1999
17
-estradiol (E2) is metabolized by two major pathways, via 16-alpha hydroxylation or via the formation of catechol estrogens (2-hydroxy and 4-hydroxy derivates) (Ball and Knuppen, 1980
; Martucci and Fishman, 1993
). Generally, these two catecholestrogens are inactivated by O-methylation, which is catalysed by the COMT enzyme (Yager and Liehr, 1996
). Catecholestrogens can be oxidized to semiquinones and quinones. The 3,4-catecholquinones, which are said to be carcinogenic and originate from the 4-hydroxycatecholestradiol, are able to react with DNA and form depurinated adducts (Cavalieri et al., 1997
). Thus, low COMT activity, resulting in higher concentrations of catecholestrogens, might relate to an increased carcinogenic burden (Lavigne et al., 2001
).
COMT is found in various mammalian tissues, with high levels in the liver, kidney, endometrium and breast, and significant amounts in red blood cells (Weisz, 1994
). A guanine to adenine transition at COMT codon 158 in the membrane bound form (or 108 in the soluble form) resulting in an amino acid change (valine to methionine) has been linked to a 34-fold decrease of the methylation activity of the enzyme (Weinshilboum and Raymond, 1977
; Boudikova et al., 1990
; Dawling et al., 2001
). Homozygous and heterozygous carriage of this polymorphism is found in 25 and 50% of Caucasians respectively (Palmatier et al., 1999
).
To date, there is no data on the effect of the COMT genotype on E2 serum levels in women, although the molecular mechanism of COMT with respect to the metabolism of estrogen is well described. The aim of the present study was to demonstrate the influence of the COMT genotype on the levels of E2 and E1 after the administration of 2 mg E2 valerate in postmenopausal women. We assume that estrogen serum levels might correlate with COMT activity.
| Materials and methods |
|---|
|
|
|---|
Subjects
Blood was collected and analysed for the COMT genotype from 159 healthy, normotensive (World Health Organization criteria) Caucasian women, with intact uterus, visiting our outpatient department for menopausal disorders. All women had been amenorrhoeic for at least 6 months, had a FSH >30 IU/ml, and no history of cardiovascular, metabolic, endocrinological or malignant diseases, as assessed in a personal interview. This study was conducted with the approval of our institutional review board, and informed consent was obtained from all participants.
From this pool of 159 women, a total of 36 were selected and divided into three groups of twelve representing the COMT alleles LL, LH and HH. Randomization into the three groups was carried out with a computer generated table of random numbers for each of the three COMT genotypes separately. The examiner was blinded to the COMT genotypes of the women.
All 36 women met the following inclusion criteria: (i) no hormone therapy during the past 12 months; (ii) 17
-estradiol serum levels <50 pg/ml and FSH serum levels >30 mIU/ml; (iii) amenorrhoea (>1 year); (iv) age 4570 years; (v) good health (normal medical history and physical examination); (vi) no past reproductive endocrine problems (e.g. galactorrhoea) or infertility; (vii) body mass index (BMI) between 2035 kg/m2; (viii) non smoking; (ix) mammogram indicating no suspicious signs within the last 6 months; (x) no clinically relevant abnormalities in haematological, hepatic (aminotransferase, alkaline phosphatase levels out of the upper limit) or renal functions (serum creatinine levels of >1.5 mg/ml), (xi) glucose metabolism (fasting plasma glucose levels >100 mg/dl), (xii) prolactin (>25 ng/ml) and thyreotropin (TSH) levels (<0.1 ng/ml or >4 ng/ml).
Study design
From all 36 women participating in the study an antecubital venous blood sample was taken using a Vacutainer system (Becton Dickinson, Meylan, France) for the examination of aminotransferase, alkaline phosphatase, creatinine, glucose, TSH, free thyroxine, prolactin, 17
-estradiol, estrone (E1), FSH and LH at 8.00 a.m. after at least 10 h of fasting. After this procedure 2 mg E2 valerate (Progynova®) was given orally and blood was collected after 1, 3 and 48 h. At each consecutive blood sampling 17
-estradiol and E1 were measured. The women had refrained from consuming alcohol 24 h before sampling.
Hormone measurements
Serum 17
-estradiol was determined immediately after sampling using an Electro-Chemilumescence-ImmunoAssay (ECLIA) on an Elecsys 2010 immunoassay analyser (Boehringer-Mannheim GmbH, D-682298 Mannheim, Germany). 17
-estradiol levels below the detection limit of this test (<10 pg/ml) were set to zero. Estrone levels were determined using a commercially available radioimmunoassay kit (DSL-8700; Webster, Texas, USA). The assay for 17
-estradiol and E1 did not show any significant cross-reaction with other substances and had an intra-assay precision of <6.5 and <9.4% respectively. The inter-assay precision were <9 and <11.1% respectively.
Genotyping methodology
Genomic DNA, extracted from anticoagulated blood by the use of a commercially available system (QiAmp Blood Midi Kit; Quiagen, Germany) was analysed for the presence of the G-to-A transition in codon 158 of the COMT gene by a polymerase chain reaction (PCR) based restriction fragment length polymorphism (RFLP) assay. A 237 bp genomic fragment, including the part of exon 4 that contains the polymorphic site, was amplified by PCR using the forward primer TACTGTGGCTACTCAGCTGTGC (positions 18271848) (Tenhunen et al., 1994
) and the reverse primer GTGAACG TGGTGTGAACACC [positions 20442063, (Tenhunen et al., 1994
)]. Amplification reactions were performed on a Perkin-Elmer GeneAmp PCR System 2400 in a total reaction volume of 50 µl containing 100 ng genomic DNA template, 25 pmol of each primer, 250 µmol/l deoxyribonucleoside triphosphates (dNTPs), 1X SuperTaq Buffer (ViennaLab, Austria) and 0.5 units SuperTaq DNA Polymerase (ViennaLab). The amplification profile was as follows: 94°C for 30 s, 56°C for 30 s and 72°C for 30 s, 35 cycles. To simplify the performance and to increase the reproducibility of PCR, PCR-mastermixes containing primers, dNTPs and buffer were prepared and used in all amplification reactions. In addition, tubes containing all PCR components and distilled water instead of DNA served as negative controls to check for the presence of DNA that may have been carried over from prior reactions. A total of 5 µl of each PCR product was run on agarose gels to ensure that the expected 237 bp product was generated. The remaining 45 µl was purified by combined ammoniumacetate/ethanol precipitation and digested overnight with 10 IU Nla III (New England Biolabs, MA, USA) at 37°C. The products of the restriction digest were separated on agarose gels (4% SB Fine Gel Agarose; Severn Biotech Ltd., UK) and visualized by SYBR Green I (Molecular Probes Inc., OR, USA). Restriction fragments of 27, 42 and 54 bp were present in every digested sample (Figure 1). In the presence of a G at position 1947 (Tenhunen et al., 1994
) an additional 114 bp fragment was present, which was cut by Nla III into 96 and 18 bp fragments when position 1947 contained an A (Figure 1).
|
Statistical analysis
Statistical data was evaluated using SPSS 10.0 for windows (SPSS Inc., Chicago, IL, USA). Values are given as the median plus minimum and maximum. Linear correlation analysis (Spearman rank) was used to identify correlations in the parameters tested. The MannWhitney U-test and KruskalWallis test was applied for comparisons between the independent groups. Hormone data are shown as box and whisker plots. The upper and lower edges of the box indicate the 25th and 75th percentiles respectively, whereas the median is shown in the box. The whiskers represent minimum and maximum values. We performed a univariate analysis of variance in order to examine whether womens age, body weight, and COMT genotype influence the increase of E2 after 3 h. The continuous variables used for the univariate analysis showed P-values at a level of >0.53 in the Kolmogorov-Smirnov test, which means that normal distribution can be assumed. All tests were two tailed and a statistical value of P < 0.05 was considered to be significant.
| Results |
|---|
|
|
|---|
From the 159 women analysed for the COMT genotype, the distribution was as follows: the frequency of the low activity allele (COMTL) was 194 (61%) and of the high activity (COMTH) allele 124 (39%). A total of 76 women (48%) were heterozygote (COMTHL), 24 women (15%) were homozygote for COMTH and 59 women (37%) were homozygote for COMTL.
Of the 36 women for whom consecutive blood E2 levels were measured, the median age was 56.5 years (range 4570) and the median BMI 27.8 kg/m2 (range 2135). The age, menopause, menarche, partus, abortus, BMI and weight did not differ significantly between the three groups (Table I). The pre-treatment E2 levels were associated with BMI and age but not with any COMT genotype. A higher BMI showed significantly higher basal levels of E1 (r = 0.458, P < 0.01), whereas a higher age was correlated with decreased basal levels of E2 (r = 0.535, P < 0.002). The menarche was significantly younger in women with COMTLL when compared with those with COMTHL (P = 0.04) and COMTHH genotypes (P = 0.02) (Figure 2).
|
|
The E2 levels of the three COMT genotype groups measured before receiving 2 mg estradiol valerate and after 1, 3 and 48 h are shown in Figure 3. After 3 h the levels of 17
- E2 were significantly higher in women with the COMTLL (69 pg/ml, range 5891) and COMTHL (69 pg/ml, range 4384) genotype (P < 0.005) higher than COMTHH (45 pg/ml, range 1568 pg/ml). The pre-treatment, 1 and 48 h E2 values of the women with different COMT genotypes did not differ significantly.
|
The increase in the E2 levels in women with COMTLL and COMTHL genotypes were significantly higher with 63 pg/ml (range 4283, P < 0.001) and 58 pg/ml (range 2584, P = 0.003) after 3 h than in women with COMTHH (25 pg/ml, range 535). The differences in the increase of E2 after 1 and 3 h were not, however, significant when women with COMTLL and COMTHL genotypes were compared (P = 0.26 and P = 0.54 respectively). The E1 serum levels of the women with the different COMT genotypes did not differ significantly at any time.
To study the compound effect of COMT and demographic characteristics on the increase of E2 after 3 h, a univariate analysis of variance was performed. The increase of E2 levels at 3 h was used as the dependent variable, age, body weight and COMT genotype were used as the independent variables. Body weight (P = 0.034) and COMT genotype (P < 0.001), but not age, were independently related to the increase in E2.
| Discussion |
|---|
|
|
|---|
Fluctuation of serum E2 is a characteristic feature of the female reproductive cycle. Consequently, blood E2 levels are controlled by a sensitive feedback mechanism to maintain cycle regularity and reproductive function, controlled by several enzymes involved in the synthesis and degradation of E2.
COMT participates in the metabolism of estrogens after their hydroxylation to catecholestrogens by forming O- methylated derivatives. Contrary to these derivates, hydroxylated estrogens can be oxidized to semiquinones and quinones. For example, estrogen-3,4-quinone, which has been shown to bind to DNA, can form depurinating adducts. These adducts may fall off quickly, taking the adenine and guanine bases of the DNA. The gaps formed by this process have a strong potential to create gene mutations and eventually cause cancer (Cavalieri et al., 1997
). Although the formation of 4-OH-estrogens is very low in humans, it is unclear how large a risk this metabolic pathway creates. However, a decreased methylation of hydroxylated estrogens may theoretically increase mutagenic estrogen metabolites.
Mono-O-methylated estrogens have little or no affinity for estrogen receptors, (Merriam et al., 1980
), thus O-methylation of catecholestrogens is primarily a detoxification pathway. However, 2-methoxy estradiol inhibits the proliferation of several cancer cell lines (Cushman et al., 1995
; Klauber et al., 1997
). It is one of the most potent endogenous inhibitors of angiogenesis known (Klauber et al., 1997
).
Our present data demonstrate the influence of the COMT codon 158 polymorphism on E2 serum levels in postmenopausal women. Serum E2 levels before treatment were correlated with age, and serum E1 levels were correlated with the BMI due to the extragonadal conversion of androgens to E1. After a single oral dose of estradiol valerate, serum E2 levels vary significantly, depending on the genotype. After 3 h, E2 values were higher in the group with at least one low activity allele (COMTLL and COMTHL) compared with women who were homozygote for the COMTHH genotype.
Another interesting point is the correlation between the COMTLL genotype and the early onset of menarche. This phenomenon could be due to the influence of catecholestrogens on the control of gonadotrophin and prolactin release (Ladosky et al., 1983
). It could also be caused by changes in the metabolism of dopamine and noradrenaline by COMT (Napolitano et al., 1995
) since these transmitters stimulate GnRH release and can induce puberty. A microdialysis study, using rats, demonstrated that the release of dopamine is maximal at the age of sexual maturation (Nakano and Mizuno, 1996
). The stimulating or inhibiting effects of catecholamines such as epinephrine and norepinephrine on the hypothalamicpituitarygonadal axis seem to depend on the steroidal milieu (DeMaria et al., 2000
). It has been demonstrated that norepinephrine suppresses GnRH release in ovariectomized rats, whereas it stimulates GnRH and LH secretion in ovariectomized rats treated with estrogen/progestogens. At present, we are trying to verify our observation on the influence of the COMT genotype on the onset of menarche.
The relationship between E2 levels and the COMT genotype might have an impact on the treatment of postmenopausal women with hormone replacement therapy (HRT). It is a well known fact that the levels of estrogen in the blood during HRT depend on different factors, such as the time of the intake of the tablets and the route of administration, but also on the individual degradation (Tuimala and Vihtamäki, 1996
). This imbalance and supraphysiological E2 levels are responsible for bleeding irregularity (Lethaby et al, 2000
), mood changes, and the incidence of hot flushes (van de Weijer et al., 1999
). COMT genotype seems to play an independent role in the regulation of estrogen blood levels, which might result in an individual response to HRT with respect to a specific allele. Recently, Mitrunen et al. (2002
) were able to demonstrate that specific COMT genotypes combined with glutathione-S-transferase (GST) genotypes can be used to identify women taking HRT, who are at a high risk of developing breast cancer.
As far as we know this is the first study focusing on the relationship between E2 levels in postmenopausal women and the COMT codon 158 polymorphism. As significant differences in estrogen levels between women with different COMT alleles could be demonstrated, our data might be of importance for the understanding of inter-individual differences between estrogen levels and hormone dependent cancers, coronary heart disease, and the efficacy of HRT.
| Acknowledgements |
|---|
We are indebted to Dr Clemens Tempfer for his support and Dr Ernst Rücklinger for his help in statistical analysis.
| References |
|---|
|
|
|---|
Ball, P. and Knuppen, R. (1980) Catecholoestrogens (2-and 4-hydroxyoestrogens): chemistry, biogenesis, metabolism, occurrence and physiological significance. Acta Endocrinol. Suppl. (Copenh), 232, 1127.
Boudikova, B., Szumlanski, C., Maidak B. and Weinshilboum, R. (1990) Human liver catechol-O-methyltransferase pharmacogenetics. Clin. Pharmacol. Ther., 48, 381389.[Web of Science][Medline]
Cavalieri, E.L., Stack, D.E., Devanesan, P.D., Todorovic, R., Dwivedy, I., Higginbotham, S., Johansson, S.L., Patil, K.D., Gross, M.L., Gooden, J.K. et al. (1997) Molecular origin of cancer: catechol estrogen-3,4-quinones as endogenous tumor initiators. Proc. Natl Acad. Sci., 94, 1093710942.
Cushman, M., He, H.M., Katzenellenbogen, J.A., Lin, C.M. and Hamel, E. (1995) Synthesis, antitubulin and antimitotic activity, and cytotoxicity of analogs of 2-methoxyestradiol, an endogenous mammalian metabolite of estradiol that inhibits tubulin polymerization by binding to the colchicine binding site. J. Med. Chem., 38, 20412049.[CrossRef][Web of Science][Medline]
Dawling, S., Roodi, N., Mernaugh, R.L., Wang, X. and Parl, F.F. (2001) Catechol-O-methyltransferase (COMT)-mediated metabolism of catechol estrogens: comparison of wild-type and variant COMT isoforms. Cancer Res., 61, 67166722.
DeMaria, J.E., Livingstone, J.D. and Freeman, M.E. (2000) Ovarian steroids influence the activity of neuroendocrine dopaminergic neurons. Brain Res., 879, 139147.[CrossRef][Web of Science][Medline]
Guldberg, H.C. and Marsden, C.A. (1975) Catechol-O-methyltransferase: Pharmacological aspects and physiological role. Pharmacol. Rev., 27, 135206.
Klauber, N., Parangi, S., Flynn, E., Hamel, E. and DAmato, R.J. (1997) Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and taxol. Cancer Res., 57, 8186.
Lavigne, J.A., Goodman, J.E., Fonong, T., Odwin, S., He, P., Roberts, D.W. and Yager, J.D. (2001) The effects of catechol-O-methyltransferase inhibition on estrogen metabolite and oxidative DNA damage levels in estradiol-treated MCF-7 cells. Cancer Res., 61, 74887494.
Ladosky, W., Azambuja, H.M. and Schneider, H.T. (1983) Possible mechanism of action of 2-hydroxylated estradiol on the positive feedback control for LH release in the rat. J. Steroid Biochem., 19, 639644.[CrossRef][Web of Science][Medline]
Lethaby, A., Farquhar, C., Sarkis, A., Roberts, H., Jepson, R. and Barlow, D. (2000) Hormone replacement therapy in postmenopausal women: endometrial hyperplasia and irregular bleeding. Cochrane Database Syst. Rev., 2, CD000402.
Liehr, J.G. and Roy, D. (1990) Free radical generation by redox cycling of estrogens. Free Radical Biol. Med., 8, 415423.[CrossRef][Web of Science][Medline]
Liehr, J.G. and Ricci, M.J. (1996) 4-Hydroxylation of estrogens as marker of human mammary tumors. Proc. Natl. Acad. Sci., 93, 32943296.
Männistö, P.T. and Kaakkola, S. (1999) Catechol-O-methyltransferase (COMT): biochemistry, molecular biology, pharmacology, and clinical efficacy of the new selective COMT inhibitors. Pharmacol. Rev., 51, 593628.
Martucci, C.P. and Fishman, J. (1993) P450 enzymes of estrogen metabolism. Pharmacol. Ther., 57, 237257.[CrossRef][Web of Science][Medline]
Merriam, G.R., MacLusky, N.J., Johnson, L.A. and Naftolin, F. (1980) 2-hydroxyestradiol-17 alpha and 4-hydroxyestradiol-17 alpha, catechol estrogen analogs with reduced estrogen receptor affinity. Steroids, 36, 1320.[CrossRef][Web of Science][Medline]
Mitrunen, K., Kataja, V., Eskelinen, M., Kosma, V.M., Kang, D., Benhamou, S., Vainio, H., Uusitupa, M. and Hirvonen, A. (2002) Combined COMT and GST genotypes and hormone replacement therapy associated breast cancer risk. Pharmacogenetics, 12, 6772.[CrossRef][Web of Science][Medline]
Nakano, M. and Mizuno, T. (1996) Age-related changes in the metabolism of neurotransmitters in rat striatum: a microdialysis study. Mech. Aging Dev., 86, 95104.
Napolitano, A., Cesura, A.M. and Da Prada, M. (1995) The role of monoamine oxidase and catechol O-methyltransferase in dopaminergic neurotransmission. J. Neural. Transm. Suppl., 45, 3545.[Medline]
Palmatier, M.A., Kang, A.M. and Kidd, K.K. (1999) Global variation in the frequencies of functionally different catechol-O-methyltransferase alleles. Biol. Psychiatry, 46, 557567.[CrossRef][Web of Science][Medline]
Tenhunen, J., Salminen, M. and Lundström, K. (1994) Genomic organization of the human catechol O-methyltransferase gene and its expression from two distinct promoters. Eur. J. Biochem., 223, 10491059.[Web of Science][Medline]
Tuimala, R.J. and Vihtamäki, T. (1996) Individual hormone replacement therapy. Maturitas, 23 (Suppl.), S8790.
van de Weijer, P.H., Barentsen, R., de Vries, M. and Kenemans, P. (1999) Relationship of estradiol levels to breakthrough bleeding during continuous combined hormone replacement therapy. Obstet. Gynecol., 93, 551557.[CrossRef][Web of Science][Medline]
Weinshilboum, R. and Raymond, F.A. (1977) Inheritance of low erythrocyte catechol-O-methyltransferase activity in man. Am. J. Hum. Genet., 29, 125135.[Web of Science][Medline]
Weisz, J. (1994) Biogenesis of catecholestrogens: Metabolic activation of estrogens by phase I enzymes. Polycyclic Arom. Comp., 6, 241251.[CrossRef]
Yager, J.D. and Liehr, J.G. (1996) Molecular mechanisms of estrogen carcinogenesis. Annu. Rev. Pharmacol. Toxicol., 36, 203232.[CrossRef][Web of Science][Medline]
Submitted on April 17, 2002; resubmitted on July 23, 2002; accepted on October 15, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. H. Barnett, J. Heron, D. Goldman, P. B. Jones, and K. Xu Effects of Catechol-O-Methyltransferase on Normal Variation in the Cognitive Function of Children Am J Psychiatry, August 1, 2009; 166(8): 909 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Miller and S. P. Duckles Vascular Actions of Estrogens: Functional Implications Pharmacol. Rev., June 1, 2008; 60(2): 210 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Stolk, J. B. J. van Meurs, M. Jhamai, P. P. Arp, J. P. T. van Leeuwen, A. Hofman, F. H. de Jong, H. A. P. Pols, and A. G. Uitterlinden The Catechol-O-Methyltransferase Met158 Low-Activity Allele and Association with Nonvertebral Fracture Risk in Elderly Men J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3206 - 3212. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Skibola, P. M. Bracci, R. A. Paynter, M. S. Forrest, L. Agana, T. Woodage, K. Guegler, M. T. Smith, and E. A. Holly Polymorphisms and Haplotypes in the Cytochrome P450 17A1, Prolactin, and Catechol-O-Methyltransferase Genes and Non-Hodgkin Lymphoma Risk Cancer Epidemiol. Biomarkers Prev., October 1, 2005; 14(10): 2391 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lurie, G. Maskarinec, R. Kaaks, F. Z. Stanczyk, and L. Le Marchand Association of Genetic Polymorphisms with Serum Estrogens Measured Multiple Times During a 2-Year Period in Premenopausal Women Cancer Epidemiol. Biomarkers Prev., June 1, 2005; 14(6): 1521 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-L. Eriksson, S. Skrtic, A. Niklason, L. M. Hulten, O. Wiklund, T. Hedner, and C. Ohlsson Association between the low activity genotype of catechol-O-methyltransferase and myocardial infarction in a hypertensive population Eur. Heart J., March 1, 2004; 25(5): 386 - 391. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







