Hum. Reprod. Advance Access originally published online on August 27, 2004
Human Reproduction 2004 19(11):2648-2652; doi:10.1093/humrep/deh463
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Association of CYP1A1 gene polymorphism with recurrent pregnancy loss in the South Indian population
1 Centre for Cellular and Molecular Biology, Hyderabad and 2 Infertility Institute and Research Centre, Secunderabad, Andhra Pradesh, India
3 To whom correspondence should be addressed at: Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad, 500 007, India. Email: lalji{at}ccmb.res.in
| Abstract |
|---|
|
|
|---|
BACKGROUND: We investigated the relationship between idiopathic recurrent pregnancy loss (RPL) and genetic polymorphisms in phase I and phase II detoxification genes which include CYP1A1, CYP2D6, GSTM1, GSTP1 and GSTT1. METHOD: A casecontrol study comprised 160 females with RPL and 63 healthy controls with a successful reproductive history. RESULTS: The CYP1A1 variant allele was present at frequencies of 0.61 and 0.44 in cases and controls, respectively (odds ratio = 1.93; P=0.023, 95% confidence interval 1.103.38). The CYP2D6 variant allele was present at a frequency of 0.17 in females with RPL, while in the control population the frequency was 0.16. The GSTM1 and GSTT1 null genotypes were present at frequencies of 0.39 and 0.26 in RPL cases, whereas in controls the frequencies were 0.37 and 0.17, respectively. The mutant GSTP1 frequencies in case and control women were 0.38 and 0.40, respectively. We report a significant association of the CYP1A1*2A allele with RPL which is confirmed by logistic regression analysis. No association was observed for the other polymorphisms or in their combinations studied. CONCLUSIONS: The present study suggests the occurrence of the CYP1A1*2A allele as a probable risk factor in idiopathic recurrent miscarriages.
Key words: detoxification/oxidative stress/polymorphism/recurrent pregnancy loss/ROS
| Introduction |
|---|
|
|
|---|
An adequate amount of blood supply to the implantation site is critical for establishing a successful pregnancy. The maternal circulation through the placenta, however, is more restricted during the first few weeks of gestation. The placental circulation rises sharply to its full level at 1012 weeks of gestation, i.e. towards the end of the first trimester (Jauniaux et al., 2000
It is well known that the risk of miscarriage is enhanced by a variety of environmental as well as lifestyle factors such as stress, smoking, alcohol consumption, etc. (Sokol et al., 1980
; Cnattingius et al., 1985
). All these factors were known to increase the oxidative stress through their activation and elimination by members of detoxification systems. The phase I detoxification activity, mostly carried out by the cytochrome P450 (CYP) family of enzymes, is inevitably associated with the generation of reactive oxygen species (ROS) such as hydroxy radicals, superoxide, peroxides, etc. Among the members of the CYP family, CYP1A1, Cyp1A2, Cyp2C, CYP2D6, Cyp2E1, Cyp2F1, Cyp3A4, Cyp3A5, Cyp3A7 and Cyp4B1 were found to be expressed in the placenta during the first trimester, although the functional activities of Cyp3A and Cyp4B were not detected (Hakkola et al., 1992
). The importance of CYP1A1 and Cyp2E1 in relation to pregnancy is substantiated further by the increased risk of miscarriage with maternal smoking and alcohol consumption. Experimental evidence indicates that during pregnancy, there is increased expression of CYP2D6 (Wadelius et al., 1997
), which metabolizes about one-quarter of clinically important medications. However, the exact role played by the enhanced CYP2D6 levels in pregnancy remains obscure.
The glutathione-S-transferase (GST) family of enzymes, being important members of phase II detoxification pathways, catalyse the conjugation of a variety of electrophilic substances to glutathione, facilitating their elimination from the body. Usually, the foreign substances activated by the phase I reactions are acted upon by the GST enzymes. Moreover, GST enzymes also play an important role in regulation of reduced glutathione levels, and thereby redox reserves of the individual. Hence any decrease in the GST activity can lead to accumulation of the products of phase I activity which can cause severe damage. GST enzymes are believed to play a crucial role in female reproduction as suggested by their presence in placenta and ovarian follicles in excessive amounts (Zusterzeel et al., 1999
). Among the various GST enzymes, GSTP1 is reported to be the predominant isoform in placenta, suggesting a possible role for this enzyme in pregnancy (Knapen et al., 1999a
,b
).
Recurrent pregnancy loss (RPL) is defined as the incidence of three or more spontaneous miscarriages. It is a heterogeneous condition involving several aetiological factors. However, in about half of the cases, the exact reasons remain obscure (Shawky et al., 2000
). An association between RPL and GST gene polymorphisms was suggested by recent reports (Zusterzeel et al., 2000
; Sata et al., 2003
). In the light of the above facts, we investigated the possible role played by CYP1A1, CYP2D6, GSTM1, GSTP1 and GSTT1 gene polymorphisms which are known to alter the activity or level of expression of these enzymes in RPL cases from the South Indian population.
| Materials and methods |
|---|
|
|
|---|
Patients
The present study was performed in 160 South Indian women with three or more first trimester miscarriages. The number of pregnancies lost varied from three to eight. All the females included are primary aborters with no live child. Routine diagnostic procedures such as karyotyping of the partners, torch test, identification of antiphospholipid antibodies and hysteroscopic examination were used to rule out known causes of pregnancy loss. None of them had any pregnancy-related complications such as hypertension, thyroid abnormalities, diabetes, etc. An ethnicity-matched control population of 63 females with at least one successful pregnancy outcome and without any history of spontaneous miscarriage or pregnancy-associated complication was used in the present study for comparing the results. Details regarding lifestyle habits as well as health status were obtained from all these women after personal counselling by the clinician. Informed written consent was obtained from all individuals. This study was approved by the Institutional Review Board.
DNA extraction
Genomic DNA was extracted from the EDTA-anticoagulated peripheral blood by the salting-out procedure (Miller et al., 1988
).
Genotype analysis
The CYP1A1*2A allele was detected by MspI (New England Biolabs, Inc., Beverly, MA) digestion of a 340 bp fragment after PCR amplification using 5'CAGTGAAGAGGTGTAGCCGCT and 5'TAGGGAGTCTTGTCTCATGCCT primers. The CYP2D6*4 allele was detected by BstNI digestion of the PCR product amplified using the 5'GCCTTCGCCAACCACTCCG and 5'AAATCCTGCTCTTCCGAGGC primer pair. The primers used for GSTM1 and GSTT1 genotyping were 5'CGCCATCTTGTGCTACATTGCCCG and 5'TTCTGGATTGTAGCAGATCA for GSTM1, and 5'GCCCTGGCTAGTTGCTGAAG and 5'GCATCTGATTTGGGGACCACA for GSTT1. A 547 bp fragment from the NAT2 gene was co-amplified in each reaction as an internal control during GSTM1 and GSTT1 genotyping. The primer pair used for NAT2 amplification was GCTGGGTCTGGAAGCTCCTC and TTGGGTGATACATACACAAGGG. The wild and heterozygous null genotypes were scored for a 230 bp fragment in the case of GSTM1 and a 112 bp product for GSTT1. For GSTP1 genotyping, a 176 bp fragment obtained by amplification using the ACCCCAGGGCTCTATGGGAA and TGAGGGCACAAGAAGCCCCT primer pair was sequenced with a Taq-Dye deoxyterminator cycle sequencing kit (Applied Biosystems) using an automated ABI 3770 sequencer.
The PCRs were carried out in a total volume of 25 µl containing 10 mmol/l TrisHCl (pH 8.3), 2.5 mmol/l MgCl2, 50 mmol/l KCl, 100 µmol/l each dNTP, 0.5 µmol/l each of the primer pair, 1.25 U of AmpliTaq Gold DNA polymerase (Roche Molecular Biochemicals) and 100 ng of template DNA. After pre-incubation at 94°C for 5 min, the mixture was subjected to 35 cycles of 94°C for 30 s, 59°C for 30 s (63°C for CYP1A1 and 60°C for CYP2D6) and 72°C for 30 s. A final extension at 72°C for 10 min was carried out to complete extension of all DNA fragments.
Statistical analysis
The difference in frequencies between the case and control groups was analysed for statistical significance at the 95% confidence interval using Fisher's two-tailed test. Odds ratios (ORs) were calculated and reported within the 95% confidence limits. Unconditional multinomial logistic regression analysis was performed with different genotypes as well as genotype combinations as the independent factors, with the risk of RPL being the dependent variable. Factors which do not possess a significant Wald statistic, but tend to increase the P-value of the model, were selectively eliminated to obtain the final model. The statistical analyses were performed using SPSS for Windows (version 11.0) software. A P-value of <0.05 was considered as significant in all the analyses.
| Results |
|---|
|
|
|---|
DNA samples obtained from 160 females with RPL and 63 females with a successful pregnancy history were analysed for null genotypes in GSTM1 and GSTT1, and the variant single nucleotide polymorphisms (SNPs) in GSTP1, CYP1A1 and CYP2D6. A post hoc power analysis according to Lalouel and Rohrwasser (2002)
=0.05 for the CYP1A1 variant frequencies observed. The characteristics of the study population are presented in Table I. The case and control groups were similar with respect to age, ethnicity and lifestyle habits. None of the women included in the present study were either smokers or alcohol consumers. The frequencies of various polymorphic alleles and genotypes studied along with the relevant statistical parameters for comparison are presented in Table II. None of the polymorphisms showed a correlation with age, as revealed by a low Pearson's correlation coefficient (P>0.05; data not shown). In the case of GSTM1 and GSTT1 genotyping, the presence of at least one functional allele was scored for the wild genotype. The homozygous and heterozygous mutant frequencies were combined for CYP1A1, CYP2D6 and GSTP1 genotypes as the homozygous mutant frequencies were smaller to study their significance. The frequencies of GSTM1 nulls were 0.39 and 0.37 in the case and control groups, while those for GSTT1 nulls were 0.256 and 0.17, respectively. The mutant genotype frequencies for CYP1A1 were observed to be 0.606 in cases and 0.44 in controls; for CYP2D6, 0.175 in cases and 0.16 in controls; and for GSTP1, 0.381 in cases and 0.40 in controls. Among the various genotypes studied, the mutant CYP1A1 distribution was significantly different between the case and control groups as shown by a low Fisher's two-tailed P-value of 0.023 (<0.05). When the distribution of various genotype combinations and their significance was analysed, none of the genotype combinations achieved association with the risk of RPL at a 95% significant level (data not shown).This can possibly be due to insufficient population size especially in the case of CYP2D6 as the variant allele frequency is very low. The results of multivariate logistic regression analysis of the data are presented in Table III. The developed model was significant at the 95% level (P=0.047) with a pseudo R2 value (Nagelkerke) of 0.106. Among the various factors included in the model, the estimated logit coefficient [which is ln (OR)] for CYP1A1 mutant genotype was found to be significant as revealed by a significant Wald statistic of 6.7 (P=0.01). To validate the significance of CYP1A1 observed in the multivariate logistic regression model, a bivariate logistic regression with the HosmerLemeshow goodness-of-fit test was performed on CYP1A1 distribution, the results of which supported the significance of CYP1A1 with an OR of 1.90 (P=0.03, data not shown).
|
|
|
| Discussion |
|---|
|
|
|---|
Apart from the established risk factors, detoxification mechanisms also play an important role in influencing the success of pregnancy outcome. Studying the effect of phase I as well as phase II gene polymorphisms in the context of oxidative stress influencing embryonic growth, development and hence the pregnancy outcome is gaining importance in recent years (Hong et al., 2002
CYP1A1 is mainly involved in the oxidation of polycyclic aromatic hydrocarbons which include compounds such as benzopyrene, polychlorinated biphenyls, etc. (Hasler et al., 1999
), the common environmental toxicants. The MspI polymorphism (*2A allele) in the CYP1A1 gene is known to cause the high-inducible phenotype (Peterson et al., 1990
; Cosma et al., 1993
), although the exact mechanism is not known. Another member of the CYP family, CYP2D6, also known as debrisoquine hydroxylase, is involved in the metabolism of a number of drugs. The major polymorphisms that are attributable to a decrease in CYP2D6 activity are the 2637deletion (*3) and G1934A transition (*4) (Bartsch et al., 2000
). From the data presented in Table II, we find no association between the CYP2D6*4 allele and the risk of RPL. However, a strong association between the occurrence of the CYP1A1 variant allele and the risk of pregnancy loss with an OR of 1.93 can be observed from the present data. The increased level of CYP1A1 enzyme due to the polymorphic allele can lead to increased risk of oxidative damage especially to the developing embryo. Moreover, during the first trimester of pregnancy, the activities of enzymes such as catalase, glutathione peroxidase and superoxide dismutase, which remove the ROS, are very low in the placenta (Hempstock et al., 2003
). As a result, any kind of oxidative stress imposed upon the developing embryo during the first trimester cannot be handled efficiently by either the embryo or the placenta, leading to severe damage. This can range from DNA damage and chromosomal aberrations to lipid peroxidation, cell lysis and fetal death.
In addition, recent reports indicate the presence of dioxins, which are strong inducers of CYP1A1 expression, in human follicular fluid (Tsutsumi et al., 1998
). This suggests the possibility of constant induction of CYP1A1 at low levels in this tissue. The presence of a hyper-inducible allele in such an instance may increase the levels of CYP1A1 to the extent that it can cause severe damage to the fetus. The variant CYP2D6*4 allele, which is responsible for the poor metabolizer phenotype, does not appear to have a significant relevance in pregnancy.
GSTs conjugate reduced glutathione to a number of elecrophilic substances including the products of phase I detoxification reactions, thereby facilitating their elimination from the body. The deletion polymorphisms in GSTT1 and GSTM1 were reported (Seidegard et al., 1988
; Pemble et al., 1994
) to abolish their activity which, in turn, can lead to an imbalance between the phase I and phase II activities, increasing the risk of xenobiotic toxicity and oxidative stress. The importance of GSTM1 null polymorphism as a possible risk factor in pregnancy loss is validated through recent studies carried out in other populations (Sata et al., 2003
). GSTP1 is the major isoform of GSTs found in the follicular microenvironment (Knapen et al., 1999a
,b
). A functional polymorphism at codon 105 (Ile
Val) in the GSTP1 gene producing a less functional variant was reported to be associated with increased risk of RPL (Zusterzeel et al., 2000
). However, the present study failed to find an association between the risk of RPL and the deletion polymorphism in the GSTM1 and GSTT1 genes as well as the SNP in codon 105 of GSTP1 gene. From the results, GSTT1 and GSTM1 appear to play a minor role in pregnancy loss cases in the South Indian population. These results absolutely do not contradict the importance of decreased GST activity in RPL as suggested by previous studies. The damage that can occur to the early embryo due to decreased GST activity is overshadowed by the severe oxidative threat produced by excessive phase I, in particular CYP1A1, activity in the population studied. A cohort study aimed at measurement of the ROS in the follicular microenvironment in the background of a mutant CYP1A1, however, is necessary to prove the hypothesis.
To summarize, the present study revealed an association between the presence of a variant allele of CYP1A1 and the risk of recurrent early pregnancy loss. Other polymorphisms analysed in the present study failed to show any association. This study demonstrates the importance of detoxification gene polymorphisms in the context of oxidative stress and a threat to the survival of the embryo leading to pregnancy loss. Moreover, the presented data also reveal the importance of ethnicity in pharmacogenomic studies as the GSTP1 variant was not found to be associated with RPL in the South Indian population, unlike the case in many other populations. In addition, this is the first study from the Indian subcontinent regarding the involvement of detoxification gene polymorphisms in RPL. A study using populations from other parts of India will enable us to find the intra-regional variations and their relevance to RPL.
| Acknowledgements |
|---|
|
|
|---|
We sincerely acknowledge Dr Thangaraj and Ms Lakshmi Rao for their valuable suggestions during the study, Ms Kanakavalli and Ms Padmalatha for chromosome analysis, Ms Jayanthi for her help in patient recruitment, Mr Arvind for the computational data analysis, and Mr Nagesh, Dr Manjula and Mr Anilkumar for their assistance during the DNA sequencing experiments. We are grateful to the Council of Scientific and Industrial Research, New Delhi for the financial assistance supporting the study.
| References |
|---|
|
|
|---|
Baranova H, Canis M, Ivaschenko T et al. (1999) Possible involvement of arylamine N-acetyltransferase 2, glutathione S-transferases M1 and T1 genes in the development of endometriosis. Mol Hum Reprod 5, 636641.
Bartsch H, Nair U, Risch A et al. (2000) Genetic polymorphism of CYP genes, alone or in combination, as a risk modifier of tobacco-related cancers. Cancer Epidemiol Biomarkers Prev 9, 328.
Chen SS, Chang LS, Chen HW et al. (2002) Polymorphisms of glutathione S-transferase M1 and male infertility in Taiwanese patients with varicocele. Hum Reprod 17, 718725.
Cnattingius S, Axelsson O, Eklund G et al. (1985) Smoking, maternal age and fetal growth. Obstet Gynecol 66, 449452.[Web of Science][Medline]
Cosma G, Crofts F, Taioli E et al. (1993) Relationship between genotype and function of the human CYP1A1 gene. J Toxicol Environ Health 40, 309316.[Web of Science][Medline]
Genbacev O, Zhou Y, Ludlow JW et al. (1997) Regulation of human placental development by oxygen tension. Science 277, 16691672.
Hadfield RM, Manek S, Weeks DE et al. and the OXEGENE Collaborative Group (2001) Linkage and association studies of the relationship between endometriosis and genes encoding the detoxification enzymes GSTM1, GSTT1 and CYP1A1. Mol Hum Reprod 7, 10731078.
Hakkola J, Raunio H, Purkunen R et al. (1992) Detection of cytochrome P450 gene expression in human placenta in first trimester of pregnancy. Placenta 13(3), 273280.[Web of Science][Medline]
Hasler JA, Estabrook R, Murray M et al. (1999) Human cytochromes P450. Mol Aspects Med 20, 1137.
Hempstock J, Bao Y-P, Bar-Issac M et al. (2003) Intralobular differences in antioxidant enzyme expression and activity reflect the pattern of maternal arterial bloodflow within the human placenta. Placenta 24, 517523.[CrossRef][Web of Science][Medline]
Hong Y, Lee K, Yi C et al. (2002) Genetic susceptibility of term pregnant women to oxidative damage. Toxicol Lett 129, 255262.[CrossRef][Web of Science][Medline]
Jauniaux E, Watson AL, Hempstock J et al. (2000) Onset of maternal arterial blood flow and placental oxidative stress; a possible factor in human early pregnancy failure. Am J Pathol 157, 21112122.
Knapen MFCM, Zusterzeel PLM, Peters WHM et al. (1999a) Glutathione and glutathione-related enzymes in reproduction; a review. Eur J Obstet Gynecol Reprod Biol 82, 171184.[CrossRef][Web of Science][Medline]
Knapen MFCM, Peters WHM, Mulder TPJ et al. (1999b) Glutathione and glutathione related enzymes in decidua and placenta of controls and women with preeclampsia. Placenta 20, 541546.[CrossRef][Web of Science][Medline]
Lalouel J and Rohrwasser A (2002) Power and replication in casecontrol studies. Am J Hypertens 15, 201205.[CrossRef][Web of Science][Medline]
Miller SA, Dykes DD and Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16, 1215.
Pemble S, Schroeder KR, Spencer SR et al. (1994) Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biochem J 300, 271276.
Peterson DD, McKinney CE, Ikeya K et al. (1990) Human CYP1A1 gene: co segregation of the enzyme induciblity phenotype and an RFLP. Am J Hum Genet 48, 720725.
Polak G, Koziol-Montewka M, Gogacz M et al. (2001) Total antioxidant status of peritoneal fluid in infertile women. Eur J Obstet Gynecol Reprod Biol 94, 261263.[CrossRef][Web of Science][Medline]
Sata F, Yamada H, Kondo T et al. (2003) Glutathione S-transferase M1 and T1 polymorphisms and the risk of recurrent pregnancy loss. Mol Hum Reprod 9, 165169.
Seidegard J, Vorachek WK, Pero RW et al. (1988) Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc Natl Acad Sci USA 85, 72937297.
Shawky ZA, Badawy MD, Edith M et al. (2000) Frequency of etiological factors and cost effectiveness of the work up for patients with history of recurrent pregnancy loss. Early pregnancy. Biol Med 4, 253260.
Sokol RJ, Miller SI and Reed G (1980) Alcohol abuse during pregnancy: an epidemiologic study. Alcohol Clin Exp Res 4, 135145.[Web of Science][Medline]
Tsutsumi O, Uechi H, Sone H et al. (1998) Presence of dioxins in human follicular fluid: their possible stage-specific action on the development of preimplantation mouse embryos. Biochem Biophys Res Commmun 250, 498501.[CrossRef][Web of Science][Medline]
Wadelius M, Darj E, Frenne G et al. (1997) Induction of CYP2D6 in pregnancy. Clin Pharmacol Ther 62, 400407.[CrossRef][Web of Science][Medline]
Zusterzeel PLM, Peters WHM, de Bruyn MAH et al. (1999) Glutathione S-transferase isoenzymes in decidua and placenta of preeclamptic pregnancies. Obstet Gynecol 94, 10331038.[CrossRef][Web of Science][Medline]
Zusterzeel PL, Nelen WL, Roelofs HMJ et al. (2000) Polymorphism in biotransformation enzymes and the risk for recurrent early pregnancy loss. Mol Hum Rep 5, 474478.
Submitted on November 11, 2003; resubmitted on May 4, 2004; accepted on July 20, 2004.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||