Human Reproduction, Vol. 19, No. 2, 352-356,
February 2004
© 2004 European Society of Human Reproduction and Embryology
High endometrial aromatase P450 mRNA expression is associated with poor IVF outcome
1 Institute for Reproductive and Developmental Biology, Wolfson & Weston Research Centre for Family Health, Imperial College London, Hammersmith Hospital, Du Cane Road, London W12 ONN, UK, 2 FertiGen, Düsseldorf, Germany, 3 Leuven Institute for Fertility and Embryology, Leuven, Belgium, 4 Sismer, Bologna, Italy, 5 Volvat Medical Center, Oslo, Norway, 6 IVF-Kliniken Öresund, Malmö, Sweden, 7 Institute Pronatal, Prague, Czech Republique, 8 AVA-klinikka, Tampere, Finland and 9 Zentrum für Sterilitätsbetreuung, Innsbruck, Austria
10 To whom correspondence should be addressed. e-mail: j.brosens{at}imperial.ac.uk
| Abstract |
|---|
|
|
|---|
BACKGROUND: The success of IVF treatment is dependent upon embryo quality and coordinated growth and differentiation of the endometrium. Aromatase P450 expression in the human endometrium is thought to be restricted to women with proliferative reproductive tract disorders such as endometriosis, leiomyomas and adenomyosis. METHODS: To determine whether endometrial aromatase P450 mRNA expression is prognostic of IVF outcome, we quantified transcript levels in biopsy specimens from a cohort of subfertile patients awaiting IVF treatment using real-time quantitative PCR. RESULTS: Aromatase P450 transcripts were detected in all endometria examined, although the levels varied considerably between samples, ranging from 0.22 to 486.6 arbitrary units (a.u.). The clinical pregnancy rate in women with high endometrial aromatase P450 mRNA levels (
8.3 a.u.; n = 21) was 9.5% compared with 30.1% in those patients with low expression levels (<8.3 a.u.; n = 101) (P < 0.05). The cycle day of the endometrial biopsy, cause of infertility, age, parity, number of oocytes collected and number of embryos transferred did not differ between patients with high versus low endometrial aromatase P450 mRNA levels (P > 0.1). CONCLUSIONS: Our results indicate that endometrial P450 mRNA levels can identify women at increased risk of IVF treatment failure.
Key words: aromatase/endometrium/IVF/mRNA/pregnancy outcome
| Introduction |
|---|
|
|
|---|
Twenty-five years on from the birth of Louise Brown, over 250 000 IVF treatment cycles are recorded yearly on the European IVF monitoring programme (Nygren et al., 2002
2025% per treatment cycle started (Nygren et al., 2002
v
3 integrin expression on surface epithelium, are prognostic of subsequent pregnancy (Lindhard et al., 2002
The CYP19 gene encodes aromatase P450, a cytochrome P450 enzyme that catalyses three consecutive hydroxylation reactions converting C19 androgens to C18 estrogenic steroids (Sebastian et al., 2001
; Simpson et al., 2002
; Chen et al., 2002
). Previous reports indicated that aromatase P450 mRNA is expressed in the endometrium of women with benign and malignant reproductive tract disorders, but not in endometria of disease-free controls (Noble et al., 1996
; Kitawaki et al., 1997
; 1999
; Dheenadayalu et al., 2002
). We postulated that the abundance of aromatase P450 transcripts in the endometrium could reflect the degree of biochemical impairment and serve as a prognostic marker of IVF outcome. To test this hypothesis, the relative aromatase P450 transcript levels were determined in endometrial biopsies, taken randomly in the cycle, from 150 women prior to starting IVF treatment.
| Materials and methods |
|---|
|
|
|---|
Patients were recruited from eight European IVF centres, written consent was obtained, and the study received approval from the local research ethics committee of each participating centre. All women had regular menstrual cycles and were not on hormonal treatment at the time of biopsy. Endometrial samples were taken 14 months before IVF treament. Biopsy samples were immediately immersed in RNAlater (Ambion) and stored according the manufacturers recommendations until transportation to the central laboratory.
Total RNA was isolated from tissues using STAT-60 (Tel-Test) and treated with DNaseI. Equal amounts of total RNA (2 µg) were reverse transcribed using the Superscript First-Strand Synthesis System for RTPCR (Invitrogen) and the resulting first-strand cDNA was diluted and used as template in the real-time quantitative (RTQ)-PCR analysis. Detection of aromatase P450 and GAPDH expression was performed with an ABI PRISM 7700 Sequence Detection System (Applied Biosystems), using the relative standard curve method. GAPDH represents a non-regulated gene, and its expression served as internal control and was used to normalize for variances in input cDNA. All measurements were performed in triplicate. The following gene-specific primer pairs and probes were designed using the ABI Primer Express software: GAPDH forward primer (GAAGGTGAAGGTCGGAGT), GAPDH reverse primer (GAAGATGGTGATGGGATTTC), GAPDH probe (5'6FAM, 3'TAMRA) (ATTTGGTCGTATTGGGCGCCTGGTCACC), aromatase P450 forward primer (GGCATACCTCCTATGGGTTGTC), aromatase P450 reverse primer (GTAGCCTGGTTCTCTG TGTGAA) and aromatase P450 probe 3 (5'6FAM, 3'TAMRA) (CCAAGCTAGGTGCTATTGGTCATCTGCTCCT).
Statistical analysis was performed using Students t-test for parametric variables and the
2-test for categorical variables. A P-value <0.05 was considered statistically significant. The sample size was calculated on the assumption that 50% of the IVF/ICSI patients would express endometrial aromatase, and that in this group the pregnancy rate per transfer is reduced from 35% to (a) 10% or (b) 15%. With the level of significance of 0.05 and with 80% power, the number needed for (a) is 51 and for (b) 83.
| Results |
|---|
|
|
|---|
Of the 150 patients that started IVF treatment, 17 had no embryo transfer due to failed superovulation (n = 5), failed oocyte collection (n = 5) or non-fertilization (n = 7). The biopsy sample was deemed inadequate for analysis in 11 of 133 (8.2%) patients who had a successful embryo transfer. Aromatase P450 transcripts were detected in all remaining 122 informative cases, although the levels varied considerably between samples, ranging from 0.22 to 486.6 arbitrary units (a.u.) (>2200-fold difference). The overall clinical pregnancy rate, defined as the proportion of women with ultrasound evidence of a viable intrauterine pregnancy, in our study population was 27%. The mean aromatase P450 mRNA levels in women who subsequently became pregnant following IVF treatment was 14.6 a.u. (SD 54), compared with 15.2 a.u. (SD 68.6) in patients with IVF failure (P > 0.05; Figure 1). Aromatase P450 transcripts were also measured in the 17 samples obtained from patients who subsequently had no embryo transfer. The mean aromatase P450 mRNA expression level in this group was 12.6 a.u. (SD 22.9), which was not significantly different from the mean expression levels in patients who were successful in their treatment cycle (P > 0.05).
|
However, the clinical pregnancy rate per embryo transfer in patients with high endometrial aromatase P450 mRNA levels (defined as
8.3 a.u.; n = 21) was 9.5%, compared with 30.1% in those patients with low expression levels (<8.3 a.u.; n = 101) (P < 0.05). This cut-off value was chosen because it best discriminated between successful and failed IVF cycles. Moreover, IVF was successful in eight of 19 (42%) women with very low transcript levels (
1.0 a.u.). Cause of infertility, age, parity, number of oocytes collected and number of embryos transferred did not differ significantly between patients with high versus low endometrial aromatase P450 mRNA levels (Table I). The level of endometrial aromatase P450 transcripts detected did not correlate with the day of the menstrual cycle at the time of biopsy (Figure 2). This was confirmed by subanalysis of transcript levels in endometrial samples from the 33 women who subsequently became pregnant after IVF and, hence, were unlikely to have had significant endometrial pathology at the time of biopsy. One patient with an expression level >300 a.u. was excluded from this analysis. The mean mRNA expression levels before day 14 of the cycle was 3.4 a.u (SD 2.6; n = 17), compared with 3.3 a.u. (SD 4.7; n = 15) on day 14 or later (P > 0.5). These results further demonstrate a lack of correlation between aromatase P450 mRNA expression in total endometrial biopsies and the phase of the cycle.
|
|
| Discussion |
|---|
|
|
|---|
Aromatase P450, the estrogen synthase that converts androgen to estrogen, is physiologically expressed in a variety of tissues, including the ovary, placenta, skin, adipose tissue and brain (Hinshelwood et al., 1997
We hypothesized that the level of aromatase P450 mRNA expression could reflect the degree of biochemical perturbation in the endometrium. To test this, endometrial aromatase P450 transcripts were quantified by RTQ-PCR in a cohort of infertile patients and correlated with subsequent IVF outcome. Twenty-one of 122 (17%) patients had elevated transcript levels (
8.3 a.u), and although IVF outcome was indeed very poor, two successful pregnancies did occur in this group. Our study also demonstrates that aromatase P450 transcripts are detectable in all biopsy samples and throughout the cycle, albeit at relative low level in the majority of cases. Moreover, the cause of infertility did not differ significantly between patients with high versus low endometrial aromatase P450 mRNA levels, but this is not entirely surprising as it is known that categorization of the causes of infertility in current IVF/ICSI practice often lack specificity (Guzick et al., 2001
).
The results of the present study indicate that the level of aromatase P450 expression represents one of a multitude of factors that determine IVF treatment outcome. However, our study is limited in its size, and the prognostic value of measuring endometrial aromatase P450 expression levels for predicting IVF treatment outcome requires further validation in a larger cohort of patients. A number of other potential confounding factors also require further investigation. For instance, endometrial biopsies were, for obvious reasons, not taken during the IVF treatment cycle but in a preceding cycle. At present it is not known whether elevated endometrial aromatase P450 expression fluctuates from cycle to cycle, or whether serial determinations in different cycles would yield a better prognostic value. Moreover, Ishihara et al. (2003)
recently demonstrated that prolonged treatment with GnRH agonists can inhibit endometrial aromatase P450 expression in patients with fibroids and endometriosis, suggesting that the type of ovarian down-regulation and stimulation protocol used in IVF treatment may have a profound impact on subsequent pregnancy rates in affected patients.
This study shows that the endometrium can be an unique source of potential markers that could be exploited clinically to tailor infertility treatment to individual patients. This notion is further supported by recent microarray studies demonstrating an astonishing diversity of endometrial genes that are aberrantly expressed during the implantation window in women with endometriosis compared with healthy controls (Kao et al., 2002
; 2003
). For clinical translation, however, timing of the biopsy sample should ideally not matter, and it appears very likely that powerful screening tools, such as microarrays and proteomics, will uncover additional genes that are aberrantly expressed throughout the cycle. Finally, the observation that a subgroup of infertile women express high levels of aromatase P450 in the endometrium also provides a rational basis to test the use of highly selective aromatase inhibitors, such as letrozole and anastrozole, in the treatment of infertility (de Ziegler, 2003
; Mitwally and Casper, 2003
). However, whether expression at mRNA level correlates with protein level or aromatase P450 enzymatic activity remains to be determined.
| Acknowledgements |
|---|
We thank Dr Mark Christian for his help in assaying the endometrial samples. We are also indebted to Dr Frank Hills for his help with data analysis. J.H. received support from Aventis Pharma Norway and J.B. is supported by the Wellcome Trust (Clinician Scientist Fellowship 54043). The European Fertility Associates (EFA) were responsible for collecting the endometrial samples and clinical data files and contributed to the costs of the assays. EFA are a consortium of European private IVF units dedicated to the promotion of human fertility research. The following EFA members participated in the study: H.Verhoeven (chairman), R.Campo, L.Gianaroli, S.Gordts, L.Hägglund, J.Hazekamp, T.Mardesic, E.Varila and J.Zech. I.B. contributed to the design of the study, coordinated the sample collection and coded the clinical data files. J.B. contributed to study design, laboratory assays, and data analysis and interpretation. All investigators contributed to the writing of the report.
| References |
|---|
|
|
|---|
Chen S, Itoh T, Wu K, Zhou D and Yang C (2002) Transcriptional regulation of aromatase expression in human breast tissue. J Steroid Biochem Mol Biol 83,9399.[CrossRef][Web of Science][Medline]
deZiegler D (2003) The dawning of the non-cancer uses of aromatase inhibitors in gynaecology. Hum Reprod 18,15981602.
Dheenadayalu K, Mak I, Gordts S, Campo R, Higham J, Puttemans P, White J, Christian M, Fusi L and Brosens J (2002) Aromatase P450 messenger RNA expression in eutopic endometrium is not a specific marker for pelvic endometriosis. Fertil Steril 78,825829.[CrossRef][Web of Science][Medline]
Gianaroli L, Magli MC, Ferraretti AP, Fortini D and Grieco N (2003) Pronuclear morphology and chromosomal abnormalities as scoring criteria for embryo selection. Fertil Steril 80,341349.[CrossRef][Web of Science][Medline]
Gurates B, Sebastian S, Yang S, Zhou J, Tamura M, Fang Z, Suzuki T, Sasano H and Bulun SE (2002) WT1 and DAX-1 inhibit aromatase P450 expression in human endometrial and endometriotic stromal cells. J Clin Endocrinol Metab 87,43694377.
Guzick DS, Overstreet JW, Factor-Litvak P, Brazil CK, Nakajima ST, Coutifaris C, Carson SA, Cisneros P, Steinkampf MP, Hill JA et al. (2001) Sperm morphology, motility, and concentration in fertile and infertile men. N Engl J Med 345,13881393.
Hardy K, Wright C, Rice S, Tachataki M, Roberts R, Morgan D, Spanos S and Taylor D (2002) Future developments in assisted reproduction in humans. Reproduction 123,171183.[Abstract]
Hinshelwood MM, Dodson Michael M, Sun T and Simpson ER (1997) Regulation of aromatase expression in the ovary and placenta: a comparison between two species. J Steroid Biochem Mol Biol 61,399405.[CrossRef][Web of Science][Medline]
Ishihara H, Kitawaki J, Kado N, Koshiba H, Fushiki S and Honjo H (2003) Gonadotropin-releasing hormone agonist and danazol normalize aromatase cytochrome P450 expression in eutopic endometrium from women with endometriosis, adenomyosis, or leiomyomas. Fertil Steril 79 (Suppl 1),735742.
Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA and Giudice LC (2002) Global gene profiling in human endometrium during the window of implantation. Endocrinology 143,21192138.
Kao LC, Germeyer A, Tulac S, Lobo S, Yang JP, Taylor RN, Osteen K, Lessey BA and Giudice LC (2003) Expression profiling of endometrium from women with endometriosis reveals candidate genes for disease-based implantation failure and infertility. Endocrinology 144,28702881.
Kitawaki J, Noguchi T, Amatsu T, Maeda K, Tsukamoto K, Yamamoto T, Fushiki S, Osawa Y and Honjo H (1997) Expression of aromatase cytochrome P450 protein and messenger ribonucleic acid in human endometriotic and adenomyotic tissues but not in normal endometrium. Biol Reprod 57,514519.[Abstract]
Kitawaki J, Kusuki I, Koshiba H, Tsukamoto K, Fushiki S and Honjo H (1999) Detection of aromatase cytochrome P-450 in endometrial biopsy specimens as a diagnostic test for endometriosis. Fertil Steril 72,11001106.[CrossRef][Web of Science][Medline]
Lindhard A, Bentin-Ley U, Ravn V, Islin H, Hviid T, Rex S, Bangsboll S and Sorensen S (2002) Biochemical evaluation of endometrial function at the time of implantation. Fertil Steril 78,221233.[CrossRef][Web of Science][Medline]
Mitwally MF and Casper RF (2003) Aromatase inhibition reduces gonadotrophin dose required for controlled ovarian stimulation in women with unexplained infertility. Hum Reprod 18,15881597.
Noble LS, Simpson ER, Johns A and Bulun SE (1996) Aromatase expression in endometriosis. J Clin Endocrinol Metab 81,174179.[Abstract]
Nygren KG and Andersen AN (2002) Assisted reproductive technology in Europe, 1999. Results generated from European registers by ESHRE. Hum Reprod 17,32603274.
Ordi J, Creus M, Quinto L, Casamitjana R, Cardesa A and Balasch J (2003) Within-subject between-cycle variability of histological dating, alpha v beta 3 integrin expression, and pinopod formation in the human endometrium. J Clin Endocrinol Metab 88,21192125.
Sebastian S and Bulun SE (2001) A highly complex organization of the regulatory region of the human CYP19 (aromatase) gene revealed by the Human Genome Project. J Clin Endocrinol Metab 86,46004602.
Sebastian S, Takayama K, Shozu M and Bulun SE (2002) Cloning and characterization of a novel endothelial promoter of the human CYP19 (aromatase P450) gene that is up-regulated in breast cancer tissue. Mol Endocrinol 16,22432254.
Simpson ER and Dowsett M (2002) Aromatase and its inhibitors: significance for breast cancer therapy. Recent Prog Horm Res 57,317338.
Simpson ER, Clyne C, Rubin G, Boon WC, Robertson K, Britt K, Speed C and Jones M (2002) Aromatasea brief overview. Annu Rev Physiol 64,93127.[CrossRef][Web of Science][Medline]
Zeitoun KM and Bulun SE (1999) Aromatase: a key molecule in the pathophysiology of endometriosis and a therapeutic target. Fertil Steril 72,961969.[CrossRef][Web of Science][Medline]
Zeitoun K, Takayama K, Michael MD and Bulun SE (1999) Stimulation of aromatase P450 promoter (II) activity in endometriosis and its inhibition in endometrium are regulated by competitive binding of steroidogenic factor-1 and chicken ovalbumin upstream promoter transcription factor to the same cis-acting element. Mol Endocrinol 13,239253.
Submitted on August 22, 2003; accepted on October 16, 2003.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Colette, J.C. Lousse, S. Defrere, M. Curaba, J.F. Heilier, A. Van Langendonckt, M. Mestdagt, J.M. Foidart, E. Loumaye, and J. Donnez Absence of aromatase protein and mRNA expression in endometriosis Hum. Reprod., September 1, 2009; 24(9): 2133 - 2141. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Purohit, L. Fusi, J. Brosens, L.W.L. Woo, B.V.L. Potter, and M.J. Reed Inhibition of steroid sulphatase activity in endometriotic implants by 667 COUMATE: a potential new therapy Hum. Reprod., February 1, 2008; 23(2): 290 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.J. Margalioth, A. Ben-Chetrit, M. Gal, and T. Eldar-Geva Investigation and treatment of repeated implantation failure following IVF-ET Hum. Reprod., December 1, 2006; 21(12): 3036 - 3043. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kuivasaari, M. Hippelainen, M. Anttila, and S. Heinonen Effect of endometriosis on IVF/ICSI outcome: stage III/IV endometriosis worsens cumulative pregnancy and live-born rates Hum. Reprod., November 1, 2005; 20(11): 3130 - 3135. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Homburg Clomiphene citrate--end of an era? a mini-review Hum. Reprod., August 1, 2005; 20(8): 2043 - 2051. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.M. Wolfler, F. Nagele, A. Kolbus, S. Seidl, B. Schneider, J.C. Huber, and W. Tschugguel A predictive model for endometriosis Hum. Reprod., June 1, 2005; 20(6): 1702 - 1708. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


