Skip Navigation


Hum. Reprod. Advance Access originally published online on June 9, 2005
Human Reproduction 2005 20(8):2201-2206; doi:10.1093/humrep/dei010
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
20/8/2201    most recent
dei010v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, H.
Right arrow Articles by Zhu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, H.
Right arrow Articles by Zhu, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions{at}oupjournals.org

The derivation of two additional human embryonic stem cell lines from day 3 embryos with low morphological scores

Hong Chen1,*, Kun Qian2,*, Juan Hu2, Denghua Liu1, Wenguo Lu1, Yong Yang1, Dong Wang1, Huajing Yan, Suming Zhang1,3 and Guijin Zhu2,3

1 Neurologic Department and 2 Reproductive Medicine Center, Tongji Hospital, Tongji Medicine College, Huazhong University of Science and Technology, Wuhan, 430030, People's Republic of China

3 To whom correspondence should be addressed. Email: suming_zhang{at}yahoo.com, zhu_guijin{at}sina.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
BACKGROUND: Immune rejection can lead to the failure of human embryonic stem cell (hES cell) transplantation. One approach to address the problem is to establish hES cell line banks. Due to the limited source of human embryos and to ethical reasons, the hES cell lines are not readily available. This study was undertaken to determine whether discarded day 3 embryos with low morphological scores could develop into blastocysts and produce hES cell lines. METHODS: A total of 130 day 3 embryos with low morphological scores were cultured to blastocyst stage, and inner cell masses (ICM) were isolated by immunosurgery. Colonies derived from the ICM were passaged every 4–7 days and evaluated for cell surface markers, differentiation potentials and karyotypes. RESULTS: A total of 19 blastocysts were obtained from 130 embryos (quality score <16), which resulted in the formation of 10 ICM, and two cell lines. Both cell lines satisfied the criteria that characterize pluripotent hES cells. CONCLUSION: Our results suggest that a subset with poor quality day 3 embryos judged on the basis of morphological assessment can form blastocysts and give rise to hES cell lines.

Key words: blastocyst/embryo/embryonic stem cell/inner cell mass


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Embryonic stem cells have immense proliferative capability and can differentiate into all kinds of cells of the body under given conditions (Evans and Kaufman, 1981Go; Thomson et al., 1998Go; Reubinoff et al., 2000Go; Assady et al., 2001Go; Odorico et al., 2001Go). In 1998, hES cell lines were successfully isolated for the first time by Thomson et al. (1998)Go. Their work promised to bring new transplantation strategies for regenerative medicine. But immune rejection has been a major obstacle to cell transplantation. A strategy to deal with the immune rejection problem is to establish hES cell line banks that have cells of various HLA types. However, the establishment of hES cell line banks has been hindered by the limited source of human embryos and ethical reasons.

In our centre, cleavage embryos are transferred on day 3 and all day 3 embryos are scored according to cumulative embryo score (CES) system scoring system (Steer et al., 1992Go). Embryos with high quality scores are transferred or cryopreserved and a large number of poor quality embryos are discarded because of their low development potentiality (Giorgetti et al., 1995Go; Alikani et al., 2000Go; Zeibe et al., 2001Go), low pregnancy rate (Alikani et al., 1999Go; Terriou et al., 2001Go), low implantation rate (Giorgetti et al., 1995Go; Alikani et al., 1999Go), low survival rate in frozen–thawed cycles (Karlstrom et al., 1997Go) and high chromosomal abnormalities (Sandalinas et al., 2001Go). Such embryos include grade 1 embryos, partial grade 2 embryos and retarded developing embryos. Although a morphological grading system is commonly used to assess embryos in most IVF centres, it is not an absolute indication of developmental capacity of embryos.

In this study, an attempt was made to explore the possibility that the day 3 embryos with low morphological scores develop into blastocyst stage embryos and produce hES cell lines.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Embryo culture
With written informed consent and approval by Tongji Hospital research and ethics committee obtained, a total of 130 poor quality day 3 embryos were collected during December 2003 and September 2004; embryos were scored according to the CES system (Steer et al., 1992Go) with a maximum value of 50. The embryos included: (i) embryos with <6 cells, irrespective of fragments; (ii) embryos with >5 cells, fragments >25% and unequal blastomeres. Those embryos were cultured in 50 µl drops of sequence medium G2TM (Vitrolife; Sweden) under oil and were observed at 11:00 on a daily basis. Blastocysts were graded at the time of immunosurgery by using a scale of Gardner et al. (2000)Go.

Immunosurgery
The blastocysts were briefly exposed to pronase (Sigma–Aldrich; Germany) to remove zona pellucida and then exposed to anti-human whole serum antibody (1:4, 30 min; Sigma, USA). Afterwards, they were exposed to guinea-pig complement (1:10, 10 min; Sigma) at 37°C in 5% CO2. Lysed trophectoderm cells were separated from the inner cell mass (ICM) by pipetting through a micropipette.

Initiation and propagation of hES cell lines
Isolated ICM were placed on a mitomycin-treated mouse embryonic fibroblast (MEF) feeder layer. Culture medium consisted of Dulbecco's modified Eagle's medium (pyruvate-free, high glucose formulation; Gibco-BRL, USA) supplemented with 20% fetal bovine serum (FBS; Hyclone, USA), 0.1 mmol/l {beta}-mercaptoethanol (Sigma), 1% non-essential amino acids (Hyclone), 2 mmol/l glutamine (Hyclone), 100 IU/ml penicillin, 100 µg/ml streptomycin (Gibco-BRL), and 4 ng/ml bFGF (Pepro Tech, Inc., USA).

After 5–8 days of culture, colonies derived from the ICM were mechanically disaggregated by using 1 ml 25G syringe and micropipette and then replaced on fresh MEF. During the first five passages of hES cell culture, cells were mechanically dissociated by a 1 ml 25G syringe every 4–7 days. Subsequent colonies after passage 5 were then propagated by incubation in 200 IU/ml collagenase (Sigma) at 37°C for 20 min.

hES cell line cryopreservation
Clumps of hES cells were cryopreserved periodically by employing the slow-freezing method. Dissociated hES cells in pre-cooled cryopreservation medium consisting of 90% serum and 10% dimethylsulphoxide (DMSO; Sigma) were placed in 2 ml pre-cooled freezing vial (Corning Incorporated, Life Sciences, USA) and rapidly transferred to a Cryo 1°C freezing container (Nalgene; Nalge Nunc Int., USA), and then the container was put in a freezer at –70°C overnight. The freezing vial was transferred to liquid nitrogen the following day. When thawed, the cryovial was rapidly put into a 37°C water bath in which it was gently shaken. After washing in 5 ml hES cell culture medium, hES cell clumps were pipetted into 15 ml conical centrifuge tubes and centrifuged at 150 g for 5 min. Clumps were resuspended in hES cell medium and plated onto a fresh feeder layer.

Identification of hES cell lines
Alkaline phosphatase activity
Alkaline phosphatase (AP) activity was detected with an AP-Red Substrate kit (BeiJing ZhongShan Golden Bridge Biotechnology Co. Ltd) by following manufacturer's instructions.

Cell surface markers
The primary antibodies used were against TRA-1-60 and TRA-1-81 (tumour rejection antigen, 1:10 and 1:12 separately, a gift from Dr Peter Andrews, University of Sheffield, England), SSEA-1 and SSEA-4 (stage-specific embryonic antigen, 1:10, Chemicon, International, Inc., USA). Colonies were incubated with primary monoclonal antibodies overnight at 4°C, which was followed by incubation with biotinylated secondary antibodies and then with streptavidin peroxidase reagent (BeiJing ZhongShan Golden Bridge Biotechnology Co. Ltd). Diaminobenzidine (DAB) (Wuhan Boster Biological Technology Co. Ltd) was used to localize the secondary antibodies.

Karyotype analysis of hES cell lines
Giemsa-banding (G-banding) for determining karyotypes of the two hES cell lines at passage level 11 was conducted by the Genetic Laboratory of Tongji Hospital.

Expression of OCT4
Cells were cultured in 35 mm dishes. Total RNA was extracted by using the TRI reagent (Molecular Research Center Inc., USA) according to the manufacturer's instructions. Four micrograms of total RNA was then reversely transcribed in a 30 µl reaction mixture containing 6 µl 5 x RT buffer, 1 µl 10 mmol/l dNTP, 1 µl 0.5 µg/µl Oligo (dT)15, 0.5 µl 50 IU/µl ribonuclease inhibitor, 1 µl 200 IU/µl M-MLV transcriptase (Promega Corp., USA). After reverse transcription, 2 µl of cDNA was amplified in 50 µl of PCR mixture containing 10 x PCR buffer 5 µl, 25 mmol/l MgCl2 3 µl, 10 mmol/l dNTP 1 µl, 5 IU/µl Taq polymerase 0.5 µl (Promega Corp., USA) and 10 pmol/µl of each primer pair 1 µl. The primers were specific for the OCT4 (5'CTTGCTGCAGAAGTGGGTGGAGGAA3', 5'CTGCAGTGTGGGTTTCGGGCA3'), and for G3PDH (5'-GGTCGGAGTCAACGGATTTGGTCG-3', 5'-CTTCCGACGCCTGCTTCACCAC-3'). The PCR reaction was performed as follows: 94°C for 30 s, at different annealing temperatures for 30 s and 72°C for 1 min 20 s, followed by incubation at 72°C for 10 min. Annealing temperature for OCT4 and G3PDH was 60 and 57°C respectively. The PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining under UV light.

In vitro differentiation
Differentiated embryonic stem cells (DEC) were obtained by placing clumps of hES cells in 35 mm plastic dishes (Falcon; Becton Dickinson&Co., USA) in hES cell medium without feeder layer. Embryoid bodies (EB) were generated by culturing hES cell clumps in suspension in hES cell medium.

RNA of DEC and EB were extracted to analyse for expression of specific gene of three embryonic germ layers in 14 day old DEC and 14 day old EB. Undifferentiated hES cells were used as controls. Primers and annealing temperatures were given in Table I.


View this table:
[in this window]
[in a new window]
 
Table I.

 
In vivo differentiation
During routine passage, clumps of ~100 cells with undifferentiated morphology were harvested and injected into hind leg muscles of 4 week old male severe combined immunodeficient (SCID) mice (six mice total). Clump number ranged from 25 to 40 per injection. The mice were killed 8 weeks later and tumours were dissected and fixed in 4% (vol/vol) formaldehyde. Tumours were embedded in paraffin and examined histologically after haematoxylin and eosin staining.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Blastocyst culture
We obtained 130 donated poor quality embryos. The quality score for each embryo was <16 (out of a possible 50). A total of 19 such embryos developed into blastocysts and blastulation rate was 14.62%. Most of the blastocysts cavitated or expanded on day 6 and day 7. Almost all blastocysts had hatching difficulties. A total of 10.17% had full or expanding cavities and 3.85% embryos showed early cavities and then stopped developing with whole embryos turning into fragments. Most ICM and trophectoderm cells were graded C and B (according to Gardner et al., 2000Go). Two best quality blastocysts were scored 4AB and the worst 2CC. The blastulation rate was related to day 3 scores (see Table II).


View this table:
[in this window]
[in a new window]
 
Table II.

 
Establishment of hES cell line
A total of 10 ICM were isolated from 19 blastocysts by using immunosurgery. Five ICM grew into primary colonies. Among these primary colonies, two were successfully propagated and developed into two new cell lines. Two were contaminated before the second passage and one differentiated after the second passage. The fragment, cell number, morphological grades, day 3 quality scores, blastocyst quality, and outcome of establishment of hES cell lines are presented in Table III.


View this table:
[in this window]
[in a new window]
 
Table III.

 
The hES cell colonies were large and flat and the cells were round and small, with a high ratio of nucleus to cytoplasm, and notable presence of one to three nucleoli and typical spacing between the cells (Figure 1A, B). They stained positively for SSEA-4, TRA-1-60 and TRA-1-81 (Figure 1CE) but not SSEA-1 (Figure 1F) and showed high levels of AP activity (Figure 1G) and transcription factor OCT-4 (Figure 1H).



View larger version (73K):
[in this window]
[in a new window]
 
Figure 1. Derivation and characterizations of hES cell lines. (A) Primary colony of hES-8 (24 h before propagation, x40). (B) Primary colony of hES-18 (24 h before propagation, x100). (CG) Staining of hES cell line markers such as: (C) SSEA-4 (hES-8, 17 passages, x100), (D) TRA-1–60 (hES-8, 17 passages, x100), (E) TRA-1–81 (hES-18, 10 passages, x100), (F) SSEA-1 (hES-18, 10 passages, x100); differentiated cells are positively stained while undifferentiated cells are negatively stained; arrow shows undifferentiated cells; and (G) alkaline phosphatase (hES-18, 10 passages). (H) RT–PCR analysis of OCT-4 expression. A: hES-8 (19 passages). B: hES-18 (12 passages). (I) RT–PCR analysis of expression of specific gene involved three embryonic germ layers in 14 day old DEC and 14 day old EB (19 passages for hES-8 and 13 for hES-18). Undifferentiated hES cells were used as controls. A: human skin-keratin. B: human heart cardiac actin; C: human liver {alpha}1 anti-trypsin; D: hCG; M: marker. (JO) Teratoma formed by injection of hES cells into severe combined immunodeficient mice: (J) Neuropiles and neural rosettes (hES-8, 25 passages, x200); (K) epithelium (hES-8, 25 passages, x200); (L) cartilage (hES-8, 25 passages, x100); (M) smooth muscle (hES-18, 13 passages, x200); (N) glands (hES-18, 13 passages, x200). (O) columnar epithelium (hES-18, 13 passages, x400). (P, Q) Normal karyotypes as shown by G-banding: (P) female karyotype, 46,XX (hES-8, 11 passages); (Q) male karyotype, 46,XY (hES-18, 11 passages).

 
When placed on the dishes without feeder layer or cultured in suspension, the cells would differentiate into cells of all three embryonic germ layers. Expressions of human heart cardiac actin, human skin keratin, human liver {alpha}1 anti-trypsin and hCG were detected in 14 day old DEC and EB by RT–PCR (Figure 1I). Both cell lines had potentials to form teratomas in SCID mice (Figure 1J–O) and displayed normal karyotypes, with one being 46,XY and the other 46,XX (Figure 1P, Q).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
So far, there are no unified standards for the assessment of the embryo quality. Like most IVF centres, our centre is currently using morphological scoring on day 3 involving blastomere number, size and fragment of embryos for the assessment.

Several documents have reported compromised clinical outcome of embryos with poor quality scores. The implantation rate of embryos with <5 cells on day 3 is only 22%, while it is 40.1% with those with 7–9 cells (Alikani et al., 2000Go). Racowsky et al. (2003)Go found that the embryos with <7 cells transferred on day 3 produced the lowest rate of live births (3%), compared with embryos with 8 cells (25%) and 7 cells (18%). They also found that embryos with <10% fragments would yield the highest rate of viable offspring (23%) compared with those with 10–25% fragments (11%), and >25% fragments (0.8%) (Racowsky et al., 2003Go). Furthermore, grade 3 and grade 4 embryos were associated with a higher survival rate than those with lower grades after freezing and thawing (Karlstrom et al., 1997Go) and a large number of day 3 embryos with low quality scores are discarded. In our centre, those embryos include embryos with <6 cells, irrespective of fragments and embryos with >5 cells, fragments >25%. However, it was reported that a proportion of such embryos could still develop into blastocysts (Alikani et al., 2000Go; Hardy et al., 2003Go; Racowsky et al., 2003Go). Our data showed that 14.62% of such poor quality embryos could develop into blastocysts, among which 10.17% had full or expanding cavities. The best quality blastocysts were scored 4AB and the worst 2CC. If the blastocysts that develop from those discarded embryos can be used as a source to establish hES cell lines, the problem with availability of human embryos may be eased.

In this study, five primary colonies were obtained from 19 blastocysts and two were successfully propagated. Our percentage of success of hES cell line establishment was 14%, which was not only related to the quality of the embryos but also to the skills of the researchers and culture conditions (Thomson et al., 1998Go; Lanzendorf et al., 2001Go; Park et al., 2003Go; Cowan et al., 2004Go; Stojkovic et al., 2004Go). The two new cell lines were derived from a 3CC and a 3CB blastocyst respectively. The hES cell lines shared some features with human pluripotent stem cells, including a similar morphology, normal karyotypes, expression of alkaline phosphatase, and presence of transcription factor Oct-4 and cell surface markers (SSEA-4, TRA-1-61 and TRA-1-80), abilities to form teratomas in SCID mice and to differentiate into cells of three embryonic germ layers and proliferate continuosly in vitro. Both cell lines could be successfully frozen and thawed. Although chromosomal abnormalities are related to blastomere number and fragments (Munné et al., 1995Go; Magli et al., 2001Go), our results with the two new cell lines were consistent with those obtained by Mitalipova et al. (2003)Go who established cell lines from discarded embryos in that they both had normal karyotypes. So we are led to speculate that only ICM of embryos with normal chromosomes could be successfully propagated.

In conclusion, our findings demonstrated that a proportion of day 3 embryos of poor quality as assessed on a morphological scoring scale can form blastocysts and give rise to new hES cell lines, which may make it possible to set up hES cell line banks worldwide.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
This work was supported in part by the National Natural Science Foundation of China (NSFC, Grant no. 30370505).


    Notes
 
* These two authors have contributed equally to the paper Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Alikani M, Cohen J, Tomkin G et al. (1999) Human embryo fragmentation in vitro and its implications for pregnancy and implantation. Fertil Steril 71, 836–842.[CrossRef][Web of Science][Medline]

Alikani M, Calderon G, Tomkin G et al. (2000) Cleavage anomalies in early human embryos and survival after prolonged culture in-vitro. Hum Reprod 15, 2634–2643.[Abstract/Free Full Text]

Assady S, Maor G, Amit M et al. (2001) Insulin production by human embryonic stem cells. Diabetes 50, 1691–1697.[Abstract/Free Full Text]

Cowan CA, Klimanskaya I, McMahon J et al. (2004) Derivation of embryonic stem-cell lines from human blastocysts. New Engl J Med 350, 1353–1356.[Free Full Text]

Evans MJ and Kaufman MH (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154–156.[CrossRef][Medline]

Gardner DK, Lane M, Stevens J et al. (2000) Blastocyst score affects implantation and pregnancy outcome: towards a single blastocyst transfer. Fertil Steril 73, 1155–1158.[CrossRef][Web of Science][Medline]

Giorgetti C, Terriou P, Auquier P et al. (1995) Embryo score to predict implantation after in-vitro fertilization: based on 957 single embryo transfers. Hum Reprod 10, 2427–2431.[Abstract/Free Full Text]

Hardy K, Stark J, Winston RM et al. (2003) Maintenance of the inner cell mass in human blastocysts from fragmented embryos. Biol Reprod 68, 1165–1169.[Abstract/Free Full Text]

Karlstrom PO, Bergh T, Forsberg AS et al. (1997) Prognostic factors for the success rate of embryo freezing. Hum Reprod 12, 1263–1266.[Abstract/Free Full Text]

Lanzendorf SE, Boyd CA, Wright DL et al. (2001) Use of human gametes obtained from anonymous donors for the production of human embryonic stem cell lines. Fertil Steril 76, 132–137.[CrossRef][Web of Science][Medline]

Magli MC, Gianaroli L and Ferraretti AP (2001) Chromosomal abnormalities in embryos. Mol Cell Endocrinol 183, S29–S34.

Mitalipova M, Calhoun J, Shin S et al. (2003) Human embryonic stem cell lines derived from discarded embryos. Stem Cells 21, 521–526.[Abstract/Free Full Text]

Munné S, Alikani M, Tomkin G et al. (1995) Embryo morphology, developmental rates, and maternal age are correlated with chromosome abnormalities. Fertil Steril 64, 382–391.[Web of Science][Medline]

Odorico JS, Kaufman DS and Thomson JA (2001) Multilineage differentiation from human embryonic stem cell line. Stem Cells 19, 193–204.[Abstract/Free Full Text]

Park JH, Kim SJ, Oh EJ et al. (2003) Establishment and maintenance of human embryonic stem cells on STO, a permanently growing cell line. Biol Reprod 69, 2007–2014.[Abstract/Free Full Text]

Racowsky C, Combelles CM, Nureddin A et al. (2003) Day 3 and day 5 morphological predictors of embryo viability. Reprod Biomed Online 6, 323–331.[Medline]

Reubinoff BE, Pera MF, Fong CY et al. (2000) Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 18, 399–404.[CrossRef][Web of Science][Medline]

Sandalinas M, Sadowy S, Alikani M et al. (2001) Developmental ability of chromosomally abnormal human embryos to develop to the blastocyst stage. Hum Reprod 16, 1954–1958.[Abstract/Free Full Text]

Steer CV, Mills CL, Tan SL et al. (1992) The cumulative embryo score: a predictive embryo scoring technique to select the optimal number of embryos to transfer in an in-vitro fertilization and embryo transfer programme. Hum Reprod 7, 117–119.[Abstract/Free Full Text]

Stojkovic M, Lako M, Stojkovic P et al. (2004) Derivation of human embryonic stem cells from day-8 blastocysts recovered after three-step in vitro culture. Stem Cells 22, 790–797.[Abstract/Free Full Text]

Terriou P, Sapin C, Giorgetti C et al. (2001) Embryo score is a better predictor of pregnancy than the number of transferred embryos or female age. Fertil Steril 75, 525–531.[CrossRef][Web of Science][Medline]

Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147.[Abstract/Free Full Text]

Zeibe S, Loft A, Petersen JH et al. (2001) Embryo quality and developmental potential is compromised by age. Acta Obstet Gynecol Scand 80, 169–174.[CrossRef][Web of Science][Medline]

Submitted on November 25, 2004; resubmitted on March 2, 2005; accepted on March 8, 2005.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cold Spring Harb Symp Quant BiolHome page
A. Raya, I. Rodriguez-Piza, B. Aran, A. Consiglio, P.N. Barri, A. Veiga, and J.C. Izpisua Belmonte
Generation of Cardiomyocytes from New Human Embryonic Stem Cell Lines Derived from Poor-quality Blastocysts
Cold Spring Harb Symp Quant Biol, November 26, 2008; (2008) sqb.2008.73.038v2.
[Abstract] [PDF]


Home page
Hum ReprodHome page
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al.
Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes
Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. T. Scott and R. A. Reijo Pera
The road to pluripotence: the research response to the embryonic stem cell debate
Hum. Mol. Genet., April 15, 2008; 17(R1): R3 - R9.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
X. Zhang, P. Stojkovic, S. Przyborski, M. Cooke, L. Armstrong, M. Lako, and M. Stojkovic
Derivation of Human Embryonic Stem Cells from Developing and Arrested Embryos
Stem Cells, December 1, 2006; 24(12): 2669 - 2676.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
H. Skottman and O. Hovatta
Culture conditions for human embryonic stem cells.
Reproduction, November 1, 2006; 132(5): 691 - 698.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
20/8/2201    most recent
dei010v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, H.
Right arrow Articles by Zhu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, H.
Right arrow Articles by Zhu, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?