Hum. Reprod. Advance Access originally published online on June 22, 2006
Human Reproduction 2006 21(10):2564-2571; doi:10.1093/humrep/del216
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A comparative approach to somatic cell nuclear transfer in the rhesus monkey
1 State Key Lab of Reproductive Biology, Institute of Zoology, The Chinese Academy of Sciences, Beijing 2 Kunming Primate Research Center and Kunming Institute of Zoology, The Chinese Academy of Sciences, Yunnan, China 3 Institute for Zoo and Wildlife Research (IZW), Berlin, Germany and 4 Oregon National Primate Research Center, Beaverton, OR, USA
5 To whom correspondence should be addressed at: Kunming Primate Research Center and Kunming Institute of Zoology, The Chinese Academy of Sciences, Kunming, Yunnan 650223, China. E-mail: wji{at}mail.kiz.ac.cn
6 To whom correspondence should be addressed at: Oregon National Primate Research Center, Beaverton, OR 97006, USA. E-mail: wolfd{at}ohsu.edu
7 To whom correspondence should be addressed at: State Key Lab of Reproductive Biology, Institute of Zoology, The Chinese Academy of Sciences, Beijing 100860, China. E-mail: qzhou{at}ioz.ac.cn
* The same contribution as first author.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
BACKGROUND: Despite the potential utility of primate somatic cell nuclear transfer (SCNT) to biomedical research and to the production of autologous embryonic stem (ES) cells for cell- or tissue-based therapy, a reliable method for SCNT is not yet available. Employing the rhesus monkey as a clinically relevant animal model, we have compared a conventional electrofusion method for SCNT with a one-step micromanipulation (OSM) method. METHODS: A prospective, randomized trial was conducted using only oocytes that were mature [metaphase II (MII)] at collection and a fibroblast-like cell line as nuclear donor cells (fetal fibroblasts). The embryos produced were characterized for in vitro developmental potential, cell number, karyotype and expression of nuclear mitotic apparatus (NuMA) and OCT-4. RESULTS: An in vitro blastocyst development rate of 24.4% was achieved with the OSM method, significantly higher than the 12.2% obtained following electrofusion. SCNT-produced embryos expressed normal karyotypes, cell numbers and NuMA and OCT-4 proteins in most cases. SCNT with male nuclear donor cells resulted in the production of male, SCNT blastocysts, eliminating the possibility of a parthenogenetic origin. Of the four fibroblast cell lines tested as nuclear donor cells, two supported the routine production of blastocysts following SCNT. CONCLUSIONS: The application of a modified SCNT technique (OSM) followed by embryo culture in hamster embryo culture medium-10 (HECM-10) allows, for the first time, the routine production of SCNT blastocysts, most of which appear normal by immunochemical, cytochemical and in vitro developmental criteria. These embryos will provide a resource for isolating ES cells and for studies of nuclear reprogramming by monkey cytoplasts.
Key words: rhesus monkey/somatic cell nuclei transfer/therapeutic cloning
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Owing to similarities with humans, the rhesus monkey is considered a clinically relevant animal model for biomedical research and for determining the safety and efficacy of new therapies. Somatic cell nuclear transfer (SCNT) if efficient in non-human primates (NHP) would support studies of therapeutic cloning, early primate development, including cell-cycle control and the events associated with nuclear reprogramming, the generation of genetically similar animals, the expansion of endangered or underrepresented genotypes and, when coupled with gene-targeting technology, the creation of loss-of-function monkey models for human genetic diseases in which mouse models have been inadequate or inappropriate (Wolf, 2004
). Therapeutic cloning (Colman and Kind, 2000) relies on SCNT for cloned blastocyst-stage embryos from which embryonic stem (ES) (Thomson et al., 1998) lines are derived. When the donor cell originates from a patient, the resultant ES cells provide a source of the autologous, differentiated cells required in cell- or tissue-based replacement or supplementation of diseased or damaged tissue (Munsie et al., 2000; Wakayama et al., 2001; Hochedlinger and Jaenisch, 2002; Kawase et al., 2000; Rideout et al., 2002).
Remarkable progress has been achieved in mammalian cloning, progressing from the use of relatively undifferentiated embryonic cells derived from preimplantation stage embryos as nuclear donors to differentiated embryonic, fetal and adult cells in at least 11 species (Wilmut et al., 1997; Cibelli et al., 1998; Wakayama et al., 1998; Baguisi et al., 1999; Onishi et al., 2000; Chesne et al., 2002; Shin et al., 2002; Galli et al., 2003; Woods et al., 2003; Zhou et al., 2003). In monkeys, embryonic cells have been used successfully to produce live offspring (Meng et al., 1997), but SCNT has not yet been achieved despite significant efforts (Mitalipov et al., 2002; Simerly and Navara, 2003; Simerly et al., 2003; Ng et al., 2004). Although several parameters such as the type of nuclear donor cell transferred (Kato et al., 2000; Kühholzer et al., 2001; Wakayama et al., 2001; Powell et al., 2004), the culture system employed and the recipient oocyte quality (Gao et al., 2003) are known to affect the outcome of SCNT, failed attempts in the NHP have been attributed to inadequate or inappropriate nuclear reprogramming (Mitalipov et al., 2002).
Another possibility is that the failure of SCNT is related to the techniques used in the removal of the spindle-chromosome complex from the oocyte to create a cytoplast (Wakayama and Yanagimachi, 2001). Two protocols that are currently used to produce viable SCNT embryos involve either cell fusion (Wilmut et al., 1997) or direct injection of the nuclear donor cell (Cibelli et al., 1998). The former involves placing a donor cell in the perivitelline space of a cytoplast and fusing donor and recipient cells with electrical pulses, whereas in the latter, a donor nucleus is isolated and directly injected into the cytoplast. Both approaches require prolonged exposure of cells to in vitro culture conditions, maternal spindle removal and manipulation that may impact on cloning efficiency. It has previously been suggested that the developmental ability of NHP SCNT embryos is limited because of the depletion of microtubule motor and centrosomal proteins during meiotic spindle removal, with subsequent formation of defective mitotic spindles originating from the transferred nucleus (Simerly et al., 2003), a limitation that was overcome, to some degree, by technique alteration (Simerly et al., 2004). Although SCNT embryos that initiate development in vitro have been produced in the monkey, few proceeded beyond the 8-cell stage or the time of the transition from maternal to embryonic control of development (Mitalipov et al., 2002; Simerly et al., 2003, 2004; Ng et al., 2004). Furthermore, none of the four or five blastocysts that were described in these studies were characterized as to karyotype or specific marker expression.
One-step micromanipulation (OSM) is a modified approach to SCNT successfully used in the rat, another species that has been difficult to clone but also an important model for the study of many human diseases (Zhou et al., 2003). This success in the rat (Campbell, 2003) along with limited progress in the monkey (Mitalipov et al., 2002; Simerly et al., 2003, 2004; Ng et al., 2004) suggested to us that modification of nuclear transfer techniques should be considered in efforts to develop a reproducible SCNT protocol in NHP.
In this study, we describe a prospective, randomized trial of two different approaches to the consistent production of SCNT blastocysts in the rhesus monkey. OSM was found to be significantly better than the electrofusion method. SCNT blastocyst normality was evaluated by in vitro developmental progression, cell counts, the ratio of inner cell mass (ICM) to total cells, as well as spindle and karyotype parameters.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Ovarian stimulation and oocyte recovery
All animal procedures were approved in advance by the Institutional Animal Care and Use Committee of Kunming Primate Research Center and Kunming Institute of Zoology. Cycling females were subjected to follicular stimulation using twice-daily intramuscular injections of 37.5 IU of recombinant human FSH (rhFSH) (Gonal FTM, Laboratories Serono SA, Aubonne, Switzerland) for 8 days, with 2000 IU of hCG (Lizhu Groups, Shenzhen, China) injected on day 9. Cumulus-oocyte complexes were collected from animals anaesthetized with ketamine (10–12 mg/kg) by laparoscopic follicular aspiration, 30–34 h following hCG administration. Follicular contents were placed in HEPES-buffered Tyrode’s albumin lactate pyruvate medium (TALP) (Mitalipov et al., 2002
) containing 0.3% bovine serum albumin (BSA) at 37°C. Oocytes were stripped off cumulus cells by pipetting after brief exposure (<1 min) to hyaluronidase (0.5 mg/ml) to allow classification of nuclear maturity as prophase I (PI; intact germinal vesicle), metaphase I (MI; no germinal vesicle, no first polar body), metaphase II (MII; PB1) and atretic (presence of fragmentation or vacuoles in ooplasm). Immature oocytes in either MI or PI were cultured in a 50-µl drop of medium 1066 containing 10% FBS, 10 IU/ml of porcine FSH, 10 IU/ml of ovine LH at 37°C in humidified 5% CO2-balance air for up to 24 h (Zheng et al., 2002). Oocytes that were mature at collection (MII) were placed in chemically defined, protein-free hamster embryo culture medium-10 (HECM-10) (McKiernan and Bavister, 2000) at 37°C in 5% CO2, 5% O2 until SCNT or IVF.
Cell lines
Four fibroblast cell lines (normal XY karyotypes were confirmed before SCNT use) were established as described previously (Hogan et al., 1994). Briefly, fibroblasts were generated from ear skin tissue of four healthy, male, neonatal rhesus monkeys. Tissue samples were washed five times in Ca2+- and Mg2+-free phosphate-buffered saline (PBS) containing 100 IU/ml of penicillin G, streptomycin and once in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco 23700-024, Grand Island, NY, USA) supplemented with 10% newborn calf serum (NCS) (Gibco, Auckland, New Zealand) and then minced into 1-mm3 pieces. The tissue pieces were evenly plated in 50-ml culture flasks containing 5-ml culture medium (DMEM and 10% NCS). Monolayer cells with fibroblast-like morphology were passaged in DMEM with 10% fetal calf serum (FCS) and harvested with PBS containing 0.25% (w/v) trypsin and 0.2% (w/v) EDTA when the culture grew to 100% confluence. Cells were frozen in DMEM with 10% FCS (Hyclone Laboratories, Logan, UT, USA) and 10% dimethylsulphoxide (DMSO) and stored in liquid nitrogen until used. Monkey ES cells (R366.4) were a generous gift from Dr James Thomson.
Spindle removal, nuclear transfer, activation and culture
Cell direct injection method
The OSM technique described previously was employed (Zhou et al., 2003). Briefly, a fibroblast was aspirated into a 10-µm ID blunt-tip pipette during which time the cell membrane lysed. The cell was then injected into an oocyte at the side opposite the MII spindle after the injection pipette was passed through the zona and oolemma using a piezo device; the injection pipette was then slowly withdrawn into proximity to the metaphase chromosomes as visualized by DIC microscopy (Figure 1A). The chromosomes along with a small amount of ooplasm were aspirated into the pipette, removed from the oocyte and stained with Hoechst 33342 in a separate drop to confirm spindle removal. Two hours later, activation was induced by exposure to Ca2+- and Mg2+-free TALP–HEPES buffer containing 5 µM ionomycin for 4 min and then exposure to 2 mM 6-dimethylaminopurine (DMAP) for 5 h at 37°C in 5% CO2-balance air. Activated SCNT embryos were cultured in HECM-10 containing 10% FCS at 37°C in 5% CO2-balance air.
|
Electrofusion method
The MII spindle was removed from MII oocytes in TALP-HEPES without albumin and pyruvate, pH 7.4 (TL) medium containing 10 µg/ml of cytochalasin B (CB) as described earlier, with the exception that the first polar body was also removed. A nuclear donor cell (fibroblast) was introduced into the perivitelline space through a slit in the zona pellucida produced by piezo actuation and electrically fused with the cytoplast using two direct current pulses of 2 kV/cm2 for 20 µs in fusion medium (0.3 M mannitol, 0.1 mM MgSO4, 0.1% polyvinyl alcohol and 0.3% BSA) using BTX electro-cell manipulator 2001 (BTX, San Diego, CA, USA). Reconstructed embryos were cultured in HECM-10, 30–60 min before being activated as described earlier, extensively washed and maintained in this medium for the evaluation of developmental potential.
Parthenogenesis, IVF, ICSI and embryo culture
MII oocytes were inseminated in vitro with capacitated, hyperactivated sperm diluted to a final concentration of 2 x 105 sperm/ml in TALP (Bavister et al., 1983). ICSI was performed as described (Ng et al., 2002). Parthenogenesis was initiated by applying the chemical activation protocol described earlier for SCNT to intact MII oocytes. Fertilized oocytes were cultured in HECM-10 containing 10% FCS at 37°C in 5% CO2-balance air.
Differential staining
The number of nuclei in the ICM and trophectoderm at the blastocyst stage was determined by a double-staining method (Papaioannou and Ebert, 1988). Briefly, zonae pellucidae of day-6 embryos were removed by brief exposure to 0.5% pronase, and embryos were rinsed in HEPES-buffered TALP before exposure to a 1:5 dilution of rabbit anti-monkey whole serum (Sigma, M-0403) for 1 h. After three rinses (5 min) in HEPES-buffered TALP, embryos were transferred into a 1:10 dilution of guinea pig complement (Sigma, S-1639) for 1 h. Propidium iodide (PI) and bisbenzimide were then added to the complement solution to a final concentration of 10 µg/ml. Following a brief rinse in HEPES-buffered TALP and mounting under coverslips, the embryos were examined under UV light using an inverted epifluorescence microscope. The nuclei of the ICM were labelled with bisbenzimide and appeared blue, whereas the trophectoderm nuclei were stained with both fluorochromes and appeared pink.
RT–PCR
Total RNA was extracted from individual, expanded blastocysts using the RNeasy Micro Kit (Qiagen, Germany) or from cell culture media using the TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The presence of OCT-4 transcripts in blastocysts produced by IVF and in monkey ES cells served as controls. The cDNAs were prepared using the SuperScript II reverse transcriptase kit (Invitrogen, Carlsbad, CA, USA) according to the instructions. PCR primers (sense, GGACACCTGGCTTCGGATT; antisense, TTCGCTTTCTCTTTCGGGC) for OCT-4 were designed based on the human sequence (GenBank accession no. Z11898
[GenBank]
) (Mitalipov et al., 2003). PCR was carried out in a 20-µl volume containing a final concentration of 1x Pyrobest buffer (TaKaRa, Dalian, China), 2 mM dNTP mix, 0.2 mM each primer and 5 U of Pyrobest DNA polymerase (TaKaRa). The application conditions were 1.5 min at 94°C, followed by 30 cycles at 94°C for 30 s, 67°C for 45 s and 68°C for 1.5 min. Positive controls were carried out using primers for glyceraldehyde-3-phosphatedehydrogenase (GAPDH: sense, TGAAGGTCGGAGTCAACGGA; antisense, TGGTGCAGGAGGCATTGCTG). The PCR product was electrophoresed through a 2% agarose gel, stained with 0.1 µg/ml of ethidium bromide, visualized on an UV transilluminator and imaged using a Gel Doc 2000 (Bio-Rad, Richmond, CA, USA).
Immunofluorescence
After fixation in 4% paraformaldehyde in PBS for 30 min at 37°C and permeabilization in 0.2% Triton X-100/PBS at 37°C for 1 h, embryos were blocked in PBS buffer containing 2% BSA and incubated with anti-nuclear mitotic apparatus (NuMA) antibody (1:500, U.S. Biological, Swampscott, MA, USA) or anti-OCT-4 antibody (1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA) or anti-beta-tubulin-fluorescein isothiocyanate (FITC) (1:500, Sigma) overnight at 4°C. Nuclear DNA was detected by exposure to 25 µg/ml of PI containing 1 mg/ml Rnase A in PBS for 20 min at 37°C. Finally, the embryos were mounted on glass slides and examined using a Zeiss LSM 510 META laser scanning confocal microscope. IVF-produced and parthenogenetic embryos served as controls.
Statistical analysis
Cell numbers in blastocysts were expressed as mean ± SD. Results were analysed by analysis of variance (ANOVA), Fisher’s protected least significant difference (LSD) or unpaired t-test, with P < 0.05 considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Prospective comparison of nuclei transfer methods
To minimize oocyte factors in this comparison, MII oocytes available at the time of collection were pooled from each animal and randomly assigned to the two approaches using fibroblast-like cell lines (K3MC) as nuclear donor cells. Nuclear donor cells were transferred to cytoplasts derived from MII oocytes by direct injection (OSM) or fusion (electrofusion). Micromanipulation times with OSM were substantially reduced over the electrofusion method to <1 min per oocyte. Although SCNT-derived blastocysts were generated from both methods, OSM resulted in significantly higher recoveries (24.4 versus 12.2%, P < 0.05; Table I). The electrofusion approach was impacted by a relatively low reconstruction rate (59%) secondary to failed donor cell fusion with the cytoplast. However, reconstructed embryos derived from the electrofusion method produced higher rates of development to the 2-cell stage than was seen with OSM (88.5 versus 67.4%, respectively, P < 0.05). Overall, SCNT-derived blastocyst in vitro development rates were 7.2% (6/83) and 23.6% (21/89) expressed relative to the number of oocytes used for electrofusion and OSM, respectively, P < 0.01. The range in efficiency of producing blastocysts relative to the number of manipulated oocytes was 0–62.5% by OSM and 0–16.7% by electrofusion. Two of the four fibroblast donor cell lines tested supported SCNT, and two, also with normal karyotypes, produced reconstructed embryos that arrested before the 4-cell stage. In addition to K3MC (Table I), the S1 line supported a SCNT blastocyst rate of 21.5% (29/135) expressed relative to the number of surviving injected cytoplasts or 30% (29/96) relative to the number of cleaving, reconstructed SCNT embryos.
|
Characteristics of SCNT-produced embryos
In vitro developmental potential, morphology and cell counts
The in vitro developmental potential of SCNT-produced embryos in HECM-10 was compared with embryos generated by IVF or by ICSI, a procedure that also involves oocyte manipulation (Table II). In these studies, a mixed population of oocytes was employed in efforts to maximize the recovery of blastocysts, that is, oocytes that were matured in vitro before manipulation in addition to those that were MII at collection. The timing of development to the blastocyst was comparable in all cases; however, marked differences in efficiency were noted. On the basis of the number of oocytes fertilized or couplets that were successfully reconstructed, 39, 56 and 54% progressed to the blastocyst stage for SCNT, ICSI and IVF, respectively. The morphology of SCNT-produced embryos was indistinguishable from IVF- or ICSI-generated control embryos (Figure 1). The mean cell number in SCNT blastocysts produced by OSM with the nuclear donor cell line S1 at day 6 was 113 ± 22 (n = 7), statistically identical to IVF-derived blastocysts (139 ± 14, n = 6). The ratio of ICM to total cell number was 0.34 for both SCNT- and IVF-produced blastocysts.
|
Karyotype analysis
Of the seven SCNT embryos produced by OSM with the nuclear donor cell line S1 and evaluated, five blastocysts (71%) showed a normal male karyotype (2n = 42 XY, Figure 3D) based on an analysis of, on average, six readable spreads per embryo, supporting the conclusion that putative SCNT blastocysts could not have originated by parthenogenesis. Two embryos appeared abnormal, with 39 and 41 chromosomes in the few readable spreads available.
|
NuMA expression
SCNT embryos produced by OSM with the nuclear donor cell line S1 were tested for the presence of NuMA, a matrix protein responsible for spindle pole assembly that might inadvertently be removed during micromanipulation (Simerly et al., 2003
). NuMA, detected by Immunocytochemistry (ICC), was localized in 6 of 11 SCNT embryos at the 1-cell stage to the mitotic spindle and pseudo-pronucleus, respectively (Figure 2A and H). A minority of SCNT 1-cell embryos were characterized by the absence of NuMA staining, abnormal chromosomal alignment (Figure 2I) and disordered spindles (Figure 2J). As expected, blastomeres in some arrested or degenerated SCNT embryos at the 4- to 8-cell stage uniformly showed aberrant spindles, NuMA absence and disordered chromosomes (n = 35 blastomeres from six embryos; Figure 2K and L). Fifteen of these 35 blastomeres were detected with abnormal expression of NuMA, and all six embryos had at least one blastomere with aberrant spindles and abnormal expression.
|
NuMA expression was confined to both sides of the mitotic spindle in the MII oocyte (Figure 2B) and parthenogenetic 1-cell embryo (Figure 2C) and in nuclear donor (somatic) cells (Figure 2D).
Spindle morphology, as characterized by tubulin staining, was consistent with the results from NuMA localization in some SCNT 1-cell embryos (Figure 2E), in MII oocytes (Figure 2F) and in parthenogenetic 1-cell embryos (Figure 2G).
OCT-4 expression
The OCT-4 gene and protein expression was detected in SCNT blastocysts produced by OSM with the nuclear donor cell line S1 by RT–PCR and immunocytochemistry, respectively. The presence of OCT-4 transcripts in blastocysts produced by IVF and in monkey ES cells served as controls. Amplification products were obtained from five of the nine individual, SCNT-produced expanded blastocysts, three IVF-produced blastocysts and undifferentiated rhesus monkey ES cells, and all resulted in PCR products corresponding to 697 bp (Figure 3C, lanes 1–4). Control reactions for GAPDH mRNA were positive for all samples, whereas PCR reactions carried out without cDNA were negative (results not shown). For IVF-produced blastocysts, the distribution of OCT-4 protein was confined mainly to the ICM, consistent with previous reports in mouse IVF-produced embryos and rhesus monkey ICSI-produced embryos (results not shown). Four of the six SCNT-produced rhesus monkey blastocysts displayed OCT-4 staining confined to the ICM like that of control IVF-produced embryos (Figure 3A), whereas the other two embryos also showed staining of the Tris EDTA (Figure 3B).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
The technique of nuclear transfer was first successfully employed in amphibians by Briggs and King (1952)
who used embryonic blastomeres as nuclear donors. SCNT in mammals was accomplished when the sheep ‘Dolly’ was born (Wilmut et al., 1997). Since 1997, 11 or more additional mammalian species have been born following SCNT using either a cell fusion method, whereby electrofusion is used to combine the nuclear donor cell with the cytoplast, or a non-fusion method involving the direct injection of the donor cell. Here, we contrasted two approaches to SCNT in rhesus macaques, with the identification, for the first time, of a successful method for the routine production of in vitro, developmentally competent SCNT embryos.
The OSM technique that was shown to be superior in this study possesses several advantages (Zhou et al., 2003). The first is a reduction in the time required to complete micromanipulation because both cytoplast preparation and nuclear donor cell injection are combined in one step. The second is avoidance of exposure to bisbenzimide (Hoechst 33342) staining and UV light during conventional spindle removal and confirmation. Finally, the technique requires the removal of only a small amount of cytoplasm because the visible MII spindle can be removed under direct observation with the DIC system. The OSM technique in the rhesus monkey reduced the micromanipulation to <1 min while minimizing the volume of aspirated cytoplasm. The latter may be important because the factors present in the oocyte are responsible for nuclear reprogramming, that is, immediate inhibition of transcription in the transferred nucleus and the subsequent establishment of temporal and spatial patterns of embryonic gene expression associated with normal development (Wolf et al., 2004). The rates of reconstruction, morula and blastocyst formation following the application of the OSM method were higher than those for the electrofusion method under the same experimental conditions, and they were also comparable to those reported for embryonic cell NT in the monkey (Mitalipov et al., 2002). Another logical explanation for the improved development observed with OSM may be spontaneous activation. Although both OSM and electrofusion methods could lead to spontaneous activation, OSM, because of the decreased elapsed time between spindle removal, reconstruction and activation, may be characterized by reduced chromatin damage. Premature activation may cause a reduction in the activities of maturation-promoting factor (MPF) and mitogen-activated protein kinase (MAPK). MPF and MAPK display peak activities in non-activated MII oocytes and are responsible for remodelling the transferred somatic donor nucleus including nuclear envelope breakdown (NEBD) and premature chromosome condensation (PCC). In a related study, we have suggested that structural changes in somatic donor nuclei such as NEBD and PCC are critical for SCNT success in monkeys and that they may serve as early markers for monitoring reprogramming and cytoplast competence (Mitalipov et al., 2006; Mitalipov SM et al., manuscript in preparation).
In this report, we present, for the first time, a protocol for the routine production of developmentally competent SCNT embryos in primates. Success allowed, also for the first time, characterization of SCNT embryos. Concomitant with high in vitro developmental rates, normal morphology and developmental progression, SCNT blastocysts showed cell numbers and ratios of ICM/total identical to IVF-produced controls. The total number of cells in the blastocyst and the number of cells allocated to the ICM are important criteria in evaluating blastocyst normality because a reduction in these parameters has been associated with developmental arrest or delay in the SCNT-produced blastocysts of several species (Hyun et al., 2003). It is also possible that the improvements in nuclear transfer (OSM) overcame any loss of mitosis-related proteins during spindle removal (Campbell, 1999). SCNT blastocysts generated from male fibroblasts showed normal male karyotypes, confirming a nuclear donor cell contribution and eliminating the possibility that the embryos resulted from parthenogenesis. Additionally, OCT-4 gene and protein were normally expressed in most SCNT blastocysts, reflecting the presence of pluripotent cells derived by reprogramming the donor cell nucleus.
With this protocol, we also found normal NuMA location and spindle formation during the first mitosis in most monkey SCNT-produced embryos. NuMA is a mitotic microtubule organizing centre component with a functional association of minus end-directed motors in spindle assembly and is required for the stabilization of the spindle until anaphase (Zeng, 2000); its absence has been reported in primate SCNT-produced embryos produced by electrofusion during first cleavage (Simerly and Navara, 2003). The NuMA turbulence associated with disordered chromosome organization that was found in some SCNT-produced embryos in this study was consistent with developmental failure.
Donor cell selection is an important factor affecting SCNT (Kato et al., 2000; Kühholzer et al., 2001; Wakayama et al., 2001; Powell et al., 2004). In this study, four fibroblast lines derived from the ear skin of four monkeys were used, of which only two supported reconstructed embryo development beyond the 2-cell stage. Although it is not possible to explain why some lines are better than others, it is recognized that both fibroblasts and ES cells cultured in vitro may differ epigenetically (Santos et al., 2003; Santos and Dean, 2004; Simonsson and Gurdon, 2004). Thus, it may be that different epigenetic characteristics of donor cells from different animal sources, even from the same tissue, affect nuclear reprogramming (Humpherys et al., 2001). As an example, bovine fetal fibroblasts harvested from six Jersey cattle showed variable abilities to support SCNT (Powell et al., 2004). Moreover, as indicated earlier, the nuclear remodelling events induced by the cytoplast are thought to be essential for reprogramming (Mitalipov et al., 2006; Mitalipov SM et al., manuscript in preparation). Thus, variations in MPF and MAPK in the recipient cytoplast may result in the lack of or incomplete NEBD and PCC, thereby accounting for failed SCNT.
In summary, our 2 years of experience with SCNT in monkeys suggests that the donor cell and the nuclear transfer technique are critical components of success. With our modified protocols, monkey SCNT-produced blastocysts were obtained routinely, providing a resource for ES cell isolation and studies on the mechanism of nuclear reprogramming. In extrapolating these results to the use of SCNT to produce autologous ES lines for patients where a major limitation may be the shortage of oocytes, our overall efficiencies, although preliminary, are interesting to consider. Given the 25% blastocyst development rate reported here with the OSM method, corrected for karyotypic normalcy (5/7; 71%) and normal patterns of OCT-4 expression (4/6; 66%), we are left with 
13% yield of ‘normal’ SCNT blastocysts. Furthermore, if we impose an ES cell line derivation rate of 40% (S. M. Mitalipov and D. P. Wolf, unpublished results), it follows from the resultant 5% overall rate that 20 oocytes would be required to produce each line. This is the approximate number of mature oocytes recovered from a single cycle of controlled ovarian stimulation.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
We gratefully acknowledge the technical assistance of Dr Soon-Chye Ng from the National University of Singapore, Drs Frank Goeritz and Katarina Jewgenow from the IZW, Dr Y.Y. Niu from Kunming Primate Research Center and Dr L. Wang from the Institute of Zoology, the Chinese Academy of Sciences. This study was supported by the Chinese Academy of Sciences, KSCX1-05-02 and Western Talent Program; Major State Basic Development Program, 2004CCA01300 and 2006CB701500; and China National Science Foundation 30370166 and 30300176. Funding to pay the Open Access publication charges for this article was provided by the Knowledge Innovation Program of the Chinese Academy of Sciences, KSCXI-05.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Baguisi A, Behboodi E, Melican DT, Pollock JS, Destrempes MM, Cammuso C, Williams JL, Nims SD, Porter CA, Midura P, et al. (1999) Production of goats by somatic cell nuclear transfer. Nat Biotechnol 17:456–461.[CrossRef][Web of Science][Medline]
Bavister BD, Boatman DE, Leibfried L, Loose M, Vernon MW. (1983) Fertilization and cleavage of rhesus monkey oocytes in vitro. Biol Reprod 28:983–999.[CrossRef][Web of Science][Medline]
Briggs R and King TJ. (1952) Transplantation of living nuclei from blastul cells into enucleated frog’s eggs. Proc Natl Acad Sci USA 38:455–461.
Campbell KH. (1999) Nuclear transfer in farm animal species. Semin Cell Dev Biol 10:245–252.[CrossRef][Web of Science][Medline]
Campbell N. (2003) I smell a rat. Nat Rev Genet 4:853.
Chesne P, Adenot PG, Viglietta C, Baratte M, Boulanger L, Renard JP. (2002) Cloned rabbits produced by nuclear transfer from adult somatic cells. Nat Biotechnol 20:366–369.[CrossRef][Web of Science][Medline]
Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, Ponce de Leon FA, Robl JM. (1998) Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science 280:1256–1258.
Colman A and Kind A. (2000) Therapeutic cloning: concepts and practicalities. Trends Biotechnol 18:192–196.[CrossRef][Web of Science][Medline]
Galli C, Lagutina I, Crotti G, Colleoni S, Turini P, Ponderato N, Duchi R, Lazzari G. (2003) Pregnancy: a cloned horse born to its dam twin. Nature 424:635.[Medline]
Gao S, McGarry M, Priddle H, Ferrier T, Gasparrini B, Fletcher J, Harkness L, De Sousa P, McWhir J, Wilmut I. (2003) Effects of donor oocytes and culture conditions on development of cloned mice embryos. Mol Reprod Dev 66:126–133.[CrossRef][Web of Science][Medline]
Hochedlinger K and Jaenisch R. (2002) Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature 415:1035–1038.[CrossRef][Medline]
Hogan B, Beddington R, Costantini F, Lacy E. (1994) Manipulating the Mouse Embryo: A Laboratory Manual(Cold Spring Harbor Laboratory Press, New York) pp. 253–290 2nd edn. pp.
Humpherys D, Eggan K, Akutsu H, Hochedlinger K, Rideout WM 3rd, Biniszkiewicz D, Yanagimachi R, Jaenisch R. (2001) Epigenetic instability in ES cells and cloned mice. Science 293:95–97.
Hyun S, Lee G, Kim D, Kim H, Lee S, Nam D, Jeong Y, Kim S, Yeom S, Kang S, et al. (2003) Production of nuclear transfer-derived piglets using porcine fetal fibroblasts transfected with the enhanced green fluorescent protein. Biol Reprod 69:1060–1068.
Kato Y, Tani T, Tsunoda Y. (2000) Cloning calves from various somatic cell types of male and female adults, new born and fetal cows. J Reprod Fertil 120:231–237.[Abstract]
Kawase E, Yamazaki Y, Yagi T, Yanagimachi R, Pedersen RA. (2000) Mouse embryonic stem (ES) cell lines established from neuronal cell-derived cloned blastocysts. Genesis 28:156–163.[CrossRef][Web of Science][Medline]
Kühholzer B, Hawley RJ, Lai L, Kolber-Simonds D, Prather RS. (2001) Clonal lines of transgenic fibroblast cells derived from the same fetus results in different development when used for nuclear transfer in pigs. Biol Reprod 64:1695–1698.
McKiernan SH and Bavister BD. (2000) Culture of one-cell hamster embryos with water soluble vitamins: pantothenate stimulates blastocyst production. Hum Reprod 15:157–164.
Meng L, Ely JJ, Stouffer RL, Wolf DP. (1997) Rhesus monkeys produced by nuclear transfer. Biol Reprod 57:454–459.[Abstract]
Mitalipov SM, Yeoman RR, Nusser KD, Wolf DP. (2002) Rhesus monkey embryos produced by nuclear transfer from embryonic blastomeres or somatic cells. Biol Reprod 66:1367–1373.
Mitalipov SM, Kuo HC, Hennebold JD, Wolf DP. ( Oct 4, 2003) expression in pluripotent cells of the rhesus monkey. Biol Reprod 69:1785–1792.
Mitalipov SM, Zhou Q, Byrne J, Ji W-Z, Wolf D. (2006) Reprogramming events and developmental competence of rhesus monkey embryos produced by somatic cell nuclear transfer. Reprod Fertil Dev 18:139.
Munsie M, Michalska A, O’Brien C, Trounson A, Pera M, Mountford P. (2000) Isolation of pluripotent embryonic stem cells from reprogrammed adult mouse somatic cell nuclei. Curr Biol 10:989–992.[CrossRef][Web of Science][Medline]
Ng SC, Martelli P, Liow SL, Herbert S, Oh SH. (2002) Intracytoplasmic injection of frozen–thawed epididymal spermatozoa in a nonhuman primate model, the cynomolgus monkey (Macaca fascicularis). Theriogenology 58:1385–1397.[CrossRef][Web of Science][Medline]
Ng SC, Chen N, Yip WY, Liow SL, Tong GQ, Martelli B, Tan LG, Martelli P. (2004) The first cell cycle after transfer of somatic cell nuclei in a non-human primate. Development 131:2475–2484.
Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T, Hanada H, Perry AC. (2000) Pig cloning by microinjection of fetal fibroblast nuclei. Science 289:1188–1190.
Papaioannou VE and Ebert KM. (1988) The preimplantation pig embryo: cell number and allocation to trophectoderm and inner cell mass of the blastocyst in vivo and in vitro. Development 102:793–803.
Powell AM, Talbot NC, Wells KD, Kerr DE, Pursel VG, Wall RJ. (2004) Cell donor influences success of producing cattle by somatic cell nuclear transfer. Biol Reprod 71:210–216.
Rideout W, Hochedlinger K, Kyba M, Daley G, Jaenisch R. (2002) Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell 109:17–27.[CrossRef][Web of Science][Medline]
Santos F and Dean W. (2004) Epigenetic reprogramming during early development in mammals. Reproduction 127:643–651.
Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W, Dean W. (2003) Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 13:1116–1121.[CrossRef][Medline]
Shin T, Kraemer D, Pryor J, Liu L, Rugila J, Howe L, Buck S, Murphy K, Lyons L, Westhusin M. (2002) A cat cloned by nuclear transplantation. Nature 415:859.[CrossRef][Medline]
Simerly CR and Navara CS. (2003) Nuclear transfer in the rhesus monkey: opportunities and challenges. Cloning Stem Cells 5:319–331.[CrossRef][Web of Science][Medline]
Simerly C, Dominko T, Navara C, Paye C, Capuano S, Gosman G, Chong KY, Takahashi D, Chace C, Compton D, et al. (2003) Molecular correlates of primate nuclear transfer failures. Science 300:297.
Simerly C, Navara C, Hwan Hyun S, Chun Lee B, Keun Kang S, Capuano S, Gosman G, Dominko T, Chong KY, Compton D, et al. (2004) Embryogenesis and blastocyst development after somatic cell nuclear transfer in nonhuman primates: overcoming defects caused by meiotic spindle extraction. Dev Biol 276:237–252.[CrossRef][Web of Science][Medline]
Simonsson S and Gurdon J. (2004) DNA demethylation is necessary for the epigenetic reprogramming of somatic cell nuclei. Nat Cell Biol 6:984–990.[CrossRef][Web of Science][Medline]
Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282:1145–1147.
Wakayama T and Yanagimachi R. (2001) Mouse cloning with nucleus donor cells of different age and type. Mol Reprod Dev 58:376–383.[CrossRef][Web of Science][Medline]
Wakayama T, Perry AC, Zuccotti M, Johnson KR, Yanagimachi R. (1998) Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394:369–374.[CrossRef][Medline]
Wakayama T, Tabar V, Rodriguez I, Perry AC, Studer L, Mombaerts P. (2001) Differentiation of embryonic stem cell lines generated from adult somatic cells by nuclear transfer. Science 292:740–743.
Wilmut AE, Schnieke J, McWhir AJ, Kind AJ, Campbell KH. (1997) Viable offspring derived from fetal and adult mammalian cells. Nature 385:810–813.[CrossRef][Medline]
Wolf DP. (2004) Assisted reproductive technologies in rhesus macaques. Reprod Biol Endocrinol 2:37.[CrossRef][Medline]
Wolf DP, Thormahlen S, Ramsey C, Yeoman RR, Fanton J, Mitalipov S. (2004) Use of assisted reproductive technologies in the propagation of rhesus macaque offspring. Biol Reprod 71:486–493.
Woods GL, White KL, Vanderwall DK, Li GP, Aston KI, Bunch TD, Meerdo LN, Pate BJ. (2003) A mule cloned from fetal cells by nuclear transfer. Science 301:1063.
Zeng C. (2000) NuMA: a nuclear protein involved in mitotic centrosome function. Microsc Res Tech 49:467–477.[CrossRef][Web of Science][Medline]
Zheng P, Bavister BD, Ji WZ. (2002) Amino acid requirements for maturation of rhesus monkey (Macacca mulatta) oocytes in culture. Reproduction 124:515–522.[Abstract]
Zhou Q, Renard JP, LeFriec G, Brochard V, Beaujean N, Cherifi Y, Fraichard A, Cozzi J. (2003) Generation of fertile cloned rats by regulating oocyte activation. Science 302:1179.
Submitted on April 1, 2006; resubmitted on May 3, 2006; accepted on May 12, 2006.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Yu, Q. Mai, X. Chen, L. Wang, L. Gao, C. Zhou, and Q. Zhou Assessment of the developmental competence of human somatic cell nuclear transfer embryos by oocyte morphology classification Hum. Reprod., March 1, 2009; 24(3): 649 - 657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, S. Yang, N. Beaujean, Y. Niu, X. He, Y. Xie, X. Tang, L. Wang, Q. Zhou, and W. Ji Epigenetic Marks in Cloned Rhesus Monkey Embryos: Comparison with Counterparts Produced In Vitro Biol Reprod, January 1, 2007; 76(1): 36 - 42. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||