Hum. Reprod. Advance Access originally published online on November 10, 2005
Human Reproduction 2006 21(3):753-754; doi:10.1093/humrep/dei380
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Preliminary analysis of AZFb region duplication by quantitative real-time PCR
1 Division of Medical Genetics and 2 Andrology Centre, Department of Obstetrics and Gynecology, University Medical Centre Ljubljana, Ljubljana, 
lajmerjeva 3, Ljubljana 1000, Slovenia
3 To whom correspondence should be addressed. E-mail: borut.peterlin{at}guest.arnes.si
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
BACKGROUND: Deletions of the AZFb region on the long arm of the human Y chromosome cause male infertility. However, the reciprocal products of these deletion events, AZFb duplications, have not been reported to date. Furthermore, it is not known whether potential AZFb duplications represent a risk factor for spermatogenic failure. METHODS: A total of 150 patients with male idiopathic subfertility (79 non-obstructive azoospermics and 71 oligozoospermics) and 150 fertile men were analysed for deletion/duplication of the sY125 locus and of the JARID1D gene using real-time PCR. RESULTS: Three azoospermic men had deletion of the sY125 locus and of the JARID1D gene. No duplication was detected. CONCLUSIONS: In our limited sample, AZFb duplications do not appear to be associated with male infertility.
Key words: AZFb/deletions/duplications/male infertility/real-time PCR
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The deletions of the AZFa, AZFb and AZFc regions (‘azoospermia factors’ a, b and c) are the most common known molecular genetic cause of spermatogenic failure (Reijo et al., 1995
; Vogt et al., 1996). Recently, the breakpoints and length of AZFa, AZFb and AZFc deletions were defined (Sun et al., 2000; Kuroda-Kawaguchi et al., 2001; Repping et al., 2002). The mechanism responsible for the deletions is usually a non-allelic homologous recombination. The reciprocal products of the deletions are duplications, which are expected to occur at the same frequency. The AZFa and AZFc duplications have already been identified (Bosch and Jobling, 2003; Writzl et al., 2004), but duplications of the AZFb region have not yet been estimated. Furthermore, it is not known whether potential AZFb duplications represent a risk factor for spermatogenic failure. Therefore, we used a quantitative real-time PCR approach to analyse the copy number of the AZFb region in 150 infertile and 150 fertile men. |
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
We investigated 150 male partners of infertile couples: 79 with non-obstructive azoospermia and 71 with oligozoospermia (sperm concentration
6x106/ml). They comprised a subsample of a previously described sample representative for subfertile men (Peterlin et al., 2002). All patients had normal karyotype (46,XY) and three patients had AZFb deletions detected by using a sequence-tagged site (STS) marker set for the detection of AZFa, AZFb and AZFc deletions (Peterlin et al., 2002). One hundred and fifty fertile men (who had fathered one or more children) acted as a control group. Informed consent was obtained from each participant. The study was approved by the national medical ethics committee. For validation of the quantitative real-time PCR assay, all samples were tested blind to the previous diagnosis. In addition, two control samples with 47,XYY karyotype were used.
The kinetics of real-time PCR uses standard PCR in conjunction with a fluorescent TaqMan method and an ABI Prism 7000 Sequence detector, which is capable of measuring the fluorescence in real time. The advantage of the real-time PCR is the calculation of the gene copy number based on a point threshold cycle (Ct), when PCR amplification is still in the exponential phase, rather than using endpoint measurements, where a slight difference in any of the limiting components could have an effect on the amount of PCR product.
We developed a single-tube real-time quantitative PCR assay for rapid determination of gene dosage. This method involves a multiplex reaction using a FAM-labelled DNA minor groove binder (MGB) probe derived from a tested locus (sY125 or the JARID1D gene) and a VIC-labelled MGB probe from RNase P gene as internal reference. Copy number of the tested loci was determined by the comparative threshold cycle method (
Ct) (Livak, 1997). Each sample was run in triplicate. The Ct was determined for all PCR reactions. The Ct is the number of cycles at which the amplification plot, representing the fluorescence emission of the reporter dye, passed a fixed threshold. The threshold was set automatically within the logarithmic phase. The starting copy number of the unknown samples was determined relative to the known copy number of the calibrator sample using the following formula: Ct = [Ct RNase P (calibrator sample) – Ct sY125/JARID1D gene (calibrator sample)] – [Ct RNase P (unknown sample) – Ct sY125/JARID1D gene (unknown sample)]. The relative gene copy number was calculated by the expression 2–(Ct ± s), where s represents the difference of the mean SD of the Ct values of sy125/JARID1D gene and RNase P.
PCR was carried out using an ABI Prism 7000 sequence detection system and 96-well MicroAmp optical plates. The PCR was performed in a total of 25 µl, containing 100 ng of genomic DNA, 12.5 µl of 2xTaqman Universal PCR Master Mix, 1.25 µl PCR master mix for RNase P (TaqMan® RNase P Control Reagents Kit, part number 4316844) and 1.25 µl of PCR Reaction Mix 20x (Assays-by-DesignSM, part number 4332078) for sY125 or 0.416 µl PCR Reaction Mix 60x (Assays-by-DesignSM, part number 4332079) for JARID1D gene. PCR conditions were 2 min 50°C, 10 min 95°C, 40 cycles consisting of 15 s 95°C, and 1 min 60°C. The following oligonucleotides were used for the analysis: sY125 forward primer: GGGTTGATGGAAAGTAGGGATAGG; sY125 reverse primer: CAACATCTGACTTTTGTTTTCTGAGGTT; sY125 Taqman probe: AAGGGTACAAAAACTGTTAGAATT; JARID1D forward primer: GTTTATCTCAGGTGCGGAAGGT; JARID1D reverse primer: TCACTCCGCGGATCGATTTT; JARID1D Taqman probe: TCACAGGTTTGGAAATAG.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In our study group, we retested three azoospermic infertile men with known AZFb region deletion detected by using STS marker set to evaluate newly designed quantitative real-time PCR assay. All three were confirmed to have an AZFb deletion.
sY125 and JARID1D gene duplications were only found in control men with 47,XYY karyotype (Table I). The method was not validated by other methods such as fluorescence in situ hybridization.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Analysis of large deletions of the Y chromosome, including AZFb and part of the AZFc region, has shown that large palindromes on Yq named P5 and proximal P1 serve as substrates for non-allelic homologous recombination in most cases. The resulting deletion is massive, encompassing up to 6.2 Mb (Repping et al., 2002
). It removes 22 genes; 11 of them are testis specific and present in multiple copies, and could therefore be dosage sensitive. The frequency of P5/proximal P1 deletion is 1.7% in men with non-obstructive azoospermia (Repping et al., 2002).
Real-time PCR technology may also detect reciprocal duplications of common microdeletions. Duplications might be under-ascertained either due to incapacity of conventional PCR to detect duplications (as opposed to deletions), or because they could be associated with a mild, or absent, phenotype. The AZFa and AZFc duplications have already been identified as reciprocal deletion/duplication syndrome, and have been shown to be compatible with male fertility (Bosch and Jobling, 2003; Writzl et al., 2004).
In this study, no AZFb duplication was found in the group of 150 infertile and 150 fertile men using real-time PCR method. Results were not validated by other methods. Although preliminary, our data suggest that AZFb duplications do not appear to be associated with male infertility.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Bosch E and Jobling MA (2003) Duplications of the AZFa region of the human Y chromosome are mediated by homologous recombination between HERVs and are compatible with male fertility. Hum Mol Genet 12,341–347.
Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S et al (2001) The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 29,279–286.[CrossRef][Web of Science][Medline]
Livak KJ (1997) Comparative Ct method. ABI Prism 7700 Sequence Detection System. User Bulletin no. 2. PE Applied Biosystems.
Peterlin B, Kunej T, Sinkovec J, Gligorievska N and Zorn B (2002) Screening for Y chromosome microdeletions in 226 Slovenian subfertile men. Hum Reprod 17,17–24.
Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, Rozen S, Jaffe T, Straus D, Hovatta O et al (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 10,383–393.[CrossRef][Web of Science][Medline]
Repping S, Skaletsky H, Lange J, Silber S, Van Der Veen F, Oates RD, Page DC and Rozen S (2002) Recombination between palindromes P5 and P1 on the human Y chromosome causes massive deletions and spermatogenic failure. Am J Hum Genet 71,906–922.[CrossRef][Web of Science][Medline]
Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R and Page DC (2000) Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genet 9,2291–2296.
Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C et al (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 5,933–943.
Writzl K, ehic A, Terzic R and Peterlin B (2004) Copy number of DAZ genes in Slovenian and Bosnian general population. Coll Antropol 28,283–289.
Submitted on January 13, 2005; resubmitted on October 2, 2005; accepted on October 5, 2005.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||