Hum. Reprod. Advance Access originally published online on June 8, 2006
Human Reproduction 2006 21(9):2281-2289; doi:10.1093/humrep/del176
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of estrogen receptor
-positive intraepithelial lymphocytes and their possible roles in normal and tubal pregnancy oviducts
1 Division of Histology and Cell Biology, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate School of Biomedical Sciences 2 Department of Obstetrics and Gynecology, Nagasaki University School of Medicine and 3 Division of Oral Pathology and Bone Metabolism, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan
4 To whom correspondence should be addressed at: Division of Histology and Cell Biology, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate School of Biomedical Sciences, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. E-mail: tkoji{at}net.nagasaki-u.ac.jp
5 Present address: Sasebo Chuo Hospital, Sasebo, Nagasaki, Japan
| Abstract |
|---|
|
|
|---|
BACKGROUND: Although intraepithelial lymphocytes (IELs) in human oviductal epithelium have been implicated in the regulation of local immunity, the precise kinetics and mechanism of steroid regulation of IEL are largely unknown. METHODS: We examined the localization of estrogen receptors (ERs) and progesterone receptors (PRs) in 41 human oviducts by immunohistochemistry. These tissues were obtained from various menstrual cycles, also from both post-menopausal women and tubal pregnancies. The expressions of ER
mRNA and membrane (m)PR mRNA were examined by in situ hybridization and RTPCR, respectively. RESULTS: Most of the IEL expressed ER
at both mRNA and protein levels. The number of ER
-positive IEL, which were identified as CD8-positive T lymphocytes and also were mPR positive, was increased in the late proliferative, the mid-secretory and late secretory phases in normally cycling women (P < 0.05). Interestingly, in tubal pregnancy, ER
-positive IELs were consistently abundant. In addition, we found a high Ki-67-labelling index for IEL, although ER
was entirely absent in the tubal pregnancy oviducts. CONCLUSIONS: These results suggest that the number of IEL fluctuated because of estrogen and progesterone levels probably through ER
and mPR, respectively. ER
-positive IEL may be involved in regulating immune tolerance in tubal pregnancy oviducts.
Key words: estrogen receptors/human oviduct/intraepithelial lymphocytes/membrane progesterone receptor/tubal pregnancy
| Introduction |
|---|
|
|
|---|
Intraepithelial lymphocytes (IELs) in human oviductal mucous membranes are involved in the regulation of local immune tolerance, such that sperm and blastocysts are transported through the oviduct without the activation of a local immune reaction (Kutteh et al., 1990
Ectopic pregnancies are responsible for
10% of all maternal mortality (Dorfman, 1983
), among which 99% are tubal pregnancies occurring in the ampullaris part of the oviduct (Seifer et al., 1995
). The major cause of tubal pregnancy is postulated to be the dysfunction of the ciliated cells due to various infectious diseases (Walters et al., 1988
; McGee et al., 1999
). However, the involvement of local immunity mediated by the IEL in this process is poorly understood. Moreover, serum levels of estrogen and progesterone are generally lower in patients with ectopic pregnancy, and the expression of estrogen receptor (ER)
and progesterone receptor (PR) is also decreased, compared with normal pregnancy (Radwanska et al., 1978
; Sadan et al., 2002
).
Estrogen is crucial for maintaining the structure and function of various female reproductive organs via binding to specific classical nuclear ER
and the newly identified ER
(Kuiper et al., 1996
). However, ER
may act via a molecular mechanism different from that of ER
in various tissues including reproductive organs such as uterus, ovary, mammary gland, prostate and intestine (Critchley et al., 2001
; Lecce et al., 2001
; Hishikawa et al., 2003
, 2004
; Tsurusaki et al., 2003
; Kawano et al., 2004
; Tamaru et al., 2004
). In the normal epithelium and stroma of the human oviduct, ER
increases in the follicular phase, reaching a peak at mid-cycle and then decreasing in the late luteal phase (Amso et al., 1994
). In contrast, expression studies of ER
in mammalian oviducts have yielded significant discrepancies (Saunders et al., 1997
; Wang et al., 2000
). Wang et al. (2000)
reported no expression of ER
protein in the luminal epithelium of rat oviduct, whereas Taylor and Al-Azzawi (2000)
reported ER
expression in the cytoplasm of ciliated epithelial and stromal cells in normal human oviduct, although they did not examine the menstrual cycle dependency of this expression pattern. Therefore, the precise role of ER
in normal and tubal pregnancy oviducts is not fully understood.
Progesterone is also a key component in the regulation of growth, development and function in female reproductive tissues via binding to PR (Brenner et al., 1991
; Slayden et al., 1993
; Noe et al., 1999
; Gava et al., 2004
). Classical PRs (PR A and PR B) are localized in the nuclei of epithelial and stromal cells but not IEL in mammalian and human oviducts (Amso et al., 1994
; Christow et al., 2002
; Sun et al., 2003
; Ulbrich et al., 2003
). Recently, the presence of membrane PR (mPR) was reported in the rat granulosa cells, in bovine corpus luteum cells of the female reproductive system and in human testis (Peluso et al., 2001
; Bramley et al., 2002
; Shah et al., 2005
). However, the expression of mPR in human oviduct remains to be clarified.
This study aimed to clarify the population kinetics of IEL in human normal and tubal pregnancy oviducts and to clarify the menstrual cycle-dependent expression and localization of ER
, ER
and PR in human oviduct using in situ hybridization (ISH) and immunohistochemistry. We also examined the expression of mPR mRNA in the oviducts to understand the responsiveness to progesterone, by RTPCR and ISH. On the basis of the findings, we discuss the possible role of ER
-positive IEL in the mucosal immune system in normal and tubal pregnancy oviducts.
| Materials and methods |
|---|
|
|
|---|
Patients
Ampullaris parts of human oviduct were obtained from 41 patients with informed consent: 25 premenopausal patients (aged 3549 years) with regular menstrual cycles (28-33 day intervals), eight post-menopausal patients (aged 5278 years) who had undergone hysterectomy and bilateral salpingo-oophorectomy due to uterine fibroids and eight patients (aged 2133 years) who underwent salpingoectomy for tubal pregnancy. None of the patients had been treated with any hormonal medications for a minimum of 3 months before tissue sampling. In all patients, accurate menstrual dating could be carried out according to the last and next menstrual periods and the basal body temperature. This was corroborated with appropriate histologic dating of endometrium as described previously (Gompel and Silverberg, 1994
The surgical specimens were classified according to menstrual cycle and histological examination into the following groups: early proliferative phase (n = 4), late proliferative phase (n = 8), early secretory phase (n = 4), mid-secretory phase (n = 5) and late secretory phase (n = 4). All specimens were collected in accordance with the guidelines of the Declaration of Helsinki and with the approval of the Nagasaki University Institutional Review Board.
Immunohistochemistry
Tissue samples were fixed in 4% paraformaldehyde (PFA; Merck, Darmstadt, Germany) in 10 mM phosphate-buffered saline (PBS) and embedded in paraffin using standard procedures. The tissues were cut into 4-µm-thick sections and were dewaxed with toluene and rehydrated through a graded ethanol series. The sections were autoclaved at 120°C for 15 min (except CD3) in 10 mM sodium citrate (pH 6.0). After the inhibition of endogenous peroxidase activity with 0.3% H2O2 in methanol for 15 min, the sections were pre-incubated with 500 µg ml1 of normal goat IgG (Sigma Chemical, St Louis, MO, USA) and 1% bovine serum albumin in PBS for 1 h. Then, the sections were reacted with the primary antibodies (Table I) overnight. After washing with 0.075% Brij 35 in PBS, the sections were incubated with horse-radish peroxidase (HRP)-labelled goat anti-mouse IgG (1:100; Chemicon International, Temecula, CA, USA) or HRP-labelled goat anti-rabbit IgG (1:200; MBL, Nagoya, Japan) for 1 h. The sites of HRP were visualized with 3,3'-diaminobenzidine (DAB; Dojin Chemical Co., Kumamoto, Japan), Ni2+, Co2+ and H2O2. As a negative control, some sections were reacted with normal mouse or rabbit IgG (Sigma Chemical) at the same concentrations instead of the specific antibodies.
|
RNA isolation and RTPCR of mPR mRNA
The oviduct tissue was frozen immediately with liquid nitrogen and crushed using a Multi-Beads Shocker (Yasui Kikai, Nagoya, Japan). Total RNA was extracted from the sample powder using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the instructions provided by the manufacturer. Aliquots of 2 µg of total RNA were reverse-transcribed with True Script II reverse transcriptase (Sawady Technology, Tokyo, Japan) in the presence of an oligo(dT) primer. Using a Light Cycler instrument (Roche Molecular Biochemicals, Mannheim, Germany), the cDNAs were amplified with specific primers and DNA Master SYBR Green I kit according to the instructions provided by the manufacturer. The primer sequences used for amplification were selected with the aid of Primer 3 software (Whitehead Institute for Biomedical Research, Cambridge, UK) and were as follows: forward, 5'-GTGCACCAAGAGCAAAGGAT-3'; reverse, 5'-GGAGAGCAAACACCTGTTCC-3'. The region of PCR amplification was 9801487, GenBank accession no. NM_006667 [GenBank] ; Gerdes et al., 1998
Laser microdissection
Frozen sections (520 µm) of the oviducts were cut and mounted on glass slides covered with PEN foil (2.5 µm thick; Leica Microsystems, Wetzlar, Germany) for the microdissection system. The sections were stained with haematoxylin, followed by eosin and then air-dried. A part of the epithelium, stroma or the IEL was dissected from the frozen sections of the oviduct with the Laser microdissection (LMD) system, as described previously (Kolble, 2000
). The samples were immediately placed into 30 µl of Trizol solution, and total RNA was extracted from the epithelium, stroma and IEL, as described above.
Preparation of oligo-DNA probes
A 45-base sequence corresponding to ER
mRNA, nucleotide no. 861-905 (Tsurusaki et al., 2003
), and a 39-base sequence corresponding to human mPR cDNA, nucleotide no. 102-140, were selected (Gerdes et al., 1998
). These antisense and sense sequences were synthesized together with two and three TTA repeats, at the 5' and 3' ends, and used as probes after haptenization with thyminethymine (TT) dimer, as described previously in detail (Koji and Nakane, 1996
). The sequence of antisense probe for ER
was 5'-TTATTA-C ACTAGCTGCTCGGGGCTCAGGGCGTCCAGCAGCAGCTCCC GCAC-ATTATTATT-3' (Tsurusaki et al., 2003
). The sequence of antisense probe for mPR was 5'-TTATTA-GGGTCGGCGCCAGT CGCCACCACATCCTCGGCAGCCAT-ATTATTATT-3'.
A computer-assisted search of GenBank for the above antisense and sense sequences revealed no significant homology with any known sequences. The TT dimer was introduced into the oligo-DNAs by UV irradiation (254 nm) at a dose of 12 000 J m2. The generation of TT dimer was verified immunochemically using a mouse monoclonal HRP-labelled anti-TT IgG (1:80; Kyowa Medex, Tokyo, Japan).
ISH for ER
and mPR mRNA
Before ISH, we performed dot-blot hybridization analysis to determine the specificity and sensitivity of the DNA probe (Yoshii et al., 1995
; Koji and Nakane, 1996
; Koji, 2000
). Non-radioactive ISH was performed as described previously (Koji and Brenner, 1993
; Yoshii et al., 1995
; Koji and Nakane, 1996
; Fujishita et al., 1997
; Koji, 2000
; Shirota et al., 2005
). The sections were treated with 0.3% H2O2 in methanol for 15 min to inhibit endogenous peroxidase activity, followed by 0.2 N HCl for 20 min and 50 µg ml1 of proteinase K (Wako Pure Chemicals, Osaka, Japan) at 37°C for 15 min. After post-fixation with 4% PFA in PBS, the sections were immersed in 2 mg ml1 of glycine in PBS for 30 min and kept in 40% deionized formamide (Nacalai Tesque, Kyoto, Japan) in 4 x standard saline citrate (SSC) until used for hybridization. Hybridization was carried out for 15 h at 37°C with 2 µg ml1 of TT dimerized antisense oligo-DNA for ER
and mPR dissolved in the hybridization medium. Then, the slides were washed three times with 2 x SSC/50% formamide/0.075% Brij 35, twice with 0.5x SSC/50% formamide/0.075% Brij 35 and finally followed by 2 x SSC. The signals were detected immunohistochemically, as described previously (Koji and Brenner, 1993
; Yoshii et al., 1995
; Koji and Nakane, 1996
; Fujishita et al., 1997
; Koji, 2000
; Shirota et al., 2005
). In every run, consecutive tissue sections were hybridized with TT dimerized ER
and mPR sense oligo-DNA as a negative control. To evaluate the level of hybridizable RNAs in the tissue sections, a 28S rRNA probe was used as a positive control (Yoshii et al., 1995
). Furthermore, some sections were hybridized with antisense probe in the presence of an excess amount of unlabelled antisense or unlabelled sense probe to provide definitive evidence for the sequence specificity of the signal.
Statistical analysis
For quantitative analysis, more than 2000 cells were counted in random fields at x400 magnification, and the number of IEL, ER
-positive and Ki-67-positive cells was expressed as a percentage of positive cells per total number of counted cells. The number of IEL positive for Ki-67 and CD8 was counted in more than 200 IELs and expressed as a percentage of positive cells per total number of counted cells. Cell counts were performed in a blind fashion by three individuals. The data are expressed as mean ± SEM. Differences between groups were examined for statistical significance using the Students t-test. P < 0.05 denoted a statistically significant difference. All analyses were performed with a statistical software package (StatView, version 5.0; Abacus Concepts, Berkeley, CA, USA).
| Results |
|---|
|
|
|---|
Immunohistochemical identification of lymphocyte markers in the IEL
To confirm the IEL cell type, we performed immunohistochemistry for T- and B-lymphocyte markers. The T-lymphocyte cell marker (T-supressor), CD8, was detected in all IEL (Figure 1A). Most of the IELs showed co-staining for CD3 (pan-T cell) (data not shown). However, no staining was detected for either CD4 (T helper) or CD20 (B-lymphocyte marker) (data not shown).
|
Kinetics of IEL density
Next, we performed quantitative analysis of the IEL. The percentage of IEL per total number of epithelial cells was increased in the late proliferative (9.2 ± 0.6%) and late secretory (8.9 ± 0.5%) menstrual phase and in tubal pregnancies (9.1 ± 0.5%), whereas there was a significant decrease in the proportion of IEL in the early secretory phase (5.3 ± 1.1%) and post-menopausal (6.7 ± 0.6%) specimens (Figure 1C).
Immunohistochemical localization of Ki-67 and CD8 in human oviduct
The IEL were then immunostained for Ki-67, a marker of proliferating cells. Ki-67 was localized in the nuclei of the IEL and secretory cells of the epithelium (Figure 2A and C) and all of the Ki-67-positive IEL co-expressed CD8 (Figure 2B and D). The labelling index revealed a marked increase in Ki-67-positive IEL in tubal pregnancy (6.1 ± 0.5%), early proliferative phase (4.5 ± 0.5%) and late secretory phase cases (3.5 ± 0.9%) than in the post-menopausal women (1.0 ± 0.2%) (Figure 2E). In contrast, the index of secretory cells was increased in the late proliferative-phase (5.0 ± 0.9%), early secretory-phase (5.5 ± 1.5%) and tubal pregnancy (4.4 ± 1.4%) cases but significantly decreased in the early proliferative (0.7 ± 0.5%) and late secretory phases (0.8 ± 0.5%) (Figure 2F).
|
Immunohistochemical localization of ER
, ER
and PR in human oviductImmunohistochemistry of ER
, ER
and PR in the premenopausal, post-menopausal and tubal pregnancy oviducts revealed staining for ER
and PR in the nuclei of secretory epithelial cells but not in the ciliated cells, IEL or endothelial cells during the normal menstrual cycle (Figure 3). The staining intensity for ER
and PR was very high in the late proliferative phase but was significantly decreased in the mid-secretory phase (Figure 3A, C, D and F). However, the expression of these proteins in the oviduct epithelial cells was almost completely lost in post-menopausal women, whereas the stroma retained the same levels as during menstrual cycling (Figure 3G and I). In tubal pregnancies, ER
was not found in any cell of the oviduct, whereas PR was expressed in the secretory cells and stromal cells but not in IEL (Figure 3J and L).
|
In contrast, ER
expression was predominantly seen in the nuclei of IEL and secretory cells, weakly detected in the cytoplasm of secretory cells and not detected in the ciliated cells (Figure 3B, E, H and K). Virtually all of the IEL were ER
-positive, and the intensity of ER
staining was much stronger in these cells than in the secretory cells. ER
was also localized in the stromal cells and vascular endothelial cells. Interestingly, ER
-positive IEL and stromal cells were abundant in tubal pregnancy oviducts (Figure 3K); however, there was no substantial difference in the intensity of ER
staining between premenopausal and post-menopausal oviducts; ER
was still detected in the epithelial and stromal cells of post-menopausal oviduct (Figure 3H). Quantitative analysis of the ER
-positive IEL staining revealed similar data to that shown in Figure 1C because all IELs were positive for ER
(data not shown).
ISH of ER
mRNA in human oviduct
Next, we performed ISH for ER
mRNA to examine its synthesis. As shown in Figure 4A, ER
mRNA was localized in the IEL, epithelial cells, stromal cells and vascular endothelial cells of the oviduct tissue. Mirror sections indicated that the cellular distribution of ER
mRNA was essentially similar to that of ER
protein (Figure 4B). No significant staining was detected when adjacent sections were reacted with the sense probe (Figure 4C). In addition, when adjacent sections were hybridized with ER
antisense probe in the presence of a 100-fold excess amount of unlabelled corresponding antisense oligo-DNA, the signal for ER
mRNA was markedly decreased (Figure 4D).
|
Kinetics of CD8-positive IEL and its correlation with ER
-positive IELApproximately 90.5 ± 3.0% of the IEL showed immunostaining for CD8 during the normal menstrual cycle, in post-menopausal and in tubal pregnancy oviducts (Figure 5A). Moreover, to clarify the association between the expression of CD8 and ER
, we immunostained serial sections of IEL during menstrual cycles. As shown in Figure 5B, all CD8-positive IELs were also ER
positive (Figure 5C).
|
Expression of mPR mRNA in human oviduct detected by RTPCR using LMD and ISH
To address the possible mechanism by which progesterone regulates IEL proliferation, we examined the expression of mPR mRNA, because PR A and PR B were not detected in the IEL (Figure 6). RTPCR to assess whether mPR mRNA is expressed in human oviduct tissue revealed a single band of 507 bp (Figure 6A). A control sample without reverse transcriptase revealed that the extract was free of genomic mPR DNA contamination. The specificity of the PCR product was confirmed by digestion with Hind III, revealing two fragments of 325 and 182 bp (Figure 6A). Next, we localized mPR mRNA in the epithelial and stromal parts of the oviduct tissue, which were separated by LMD. The staining intensity of the 507-bp band was much higher in the epithelial cells than in the stroma (Figure 6B). To clarify whether IEL express mPR mRNA, the IELs (about 100 cells) were dissected by LMD and the extract was analysed by RTPCR, revealing a significant band of 507 bp, as expected (Figure 6C).
|
Finally, we identified mPR mRNA-positive cells in the sections of human oviduct by ISH. Before the experiment, we confirmed the sensitivity and specificity of the probes by dot-blot hybridization and determined that the TT dimerized mPR antisense oligo-DNA could detect down to 10-pg mPR sense DNA specifically (data not shown). ISH of the oviductal sections of the secretory phase localized mPR mRNA in IEL, secretory cells and some stromal cells but not in ciliated cells (Figure 7B). The transcript staining intensity was markedly higher in the IEL than in the secretory cells. Moreover, the intensity of signal in the IEL did not change during the menstrual phases (data not shown). No significant staining was detected when adjacent sections were hybridized with the sense probe (Figure 7C). In addition, when adjacent sections were hybridized with mPR antisense probes in the presence of a 100-fold excess amount of unlabelled corresponding antisense oligo-DNA, the signal was markedly decreased (Figure 7D).
|
| Discussion |
|---|
|
|
|---|
This study provides new information regarding the expression and localization of ER
mRNA and protein in normal human oviduct during the menstrual cycling. We found that ER
was specifically co-expressed in CD8-positive IEL and secretory cells of the epithelium. Interestingly, the number of ER
-positive IEL in the oviducts fluctuated depending on the menstrual cycles and seemed to increase in a progesterone-dependent manner. This increase was probably mediated via mPR, the expression of which was reported for the first time in oviductal epithelial cells including IEL. Moreover, in oviduct from cases of tubal pregnancy, the number of ER
-positive IEL was increased significantly, possibly indicating damage to the local immune system in the oviduct.
A better understanding of the function and hormonal regulation of the oviduct epithelium is important for reproductive biology because the normal transport of sperm and blastocysts through the oviduct relies on the inhibition of local immunity (Kutteh et al., 1990
). IELs in human oviduct are positive for CD8 and CD3 (Kutteh et al., 1990
). Moreover, CD8-positive IELs are also expressed in normal intestine (Brimnes et al., 2005
) where they play a possible role in mediating immune tolerance to luminal antigens by suppressing the immune response. In this study, we show for the first time that the CD8-positive IELs in human oviduct were also positive for ER
. ER
expression has also been reported in the infiltrating leucocytes of the rat vagina (Wang et al., 2000
) and human cervix (Stygar et al., 2001
); therefore, we postulated that the IEL in oviduct epithelia might play a key role in the inflammatory response causing tubal pregnancy (Witkin, 2002
). In our study, the number of ER
-positive IEL was increased significantly in the tubal pregnancy samples, whereas ER
was not found in the epithelium or stroma of any tubal pregnancy oviducts (eight cases). Sadan et al. (2002)
also reported that ER
was expressed in only one case of the 12 tubal pregnancy oviducts. This finding implicates ER
, but not ER
, as a dominant hormonal player in the oviduct of tubal pregnancies. It may therefore be proposed that differential expression of ER
and ER
in tubal pregnancy oviduct is involved in the abnormal transport of the fertilized oocyte into the uterus.
It is well known that plasma levels of estrogen increase during the proliferative phase of the menstrual cycle, whereas progesterone levels increase during the secretory phase (Palter and Olive, 2002
). This study revealed that the population density of ER
-positive IEL altered biphasically in premenopausal women; one peak was in the proliferative phase, and the other was in the mid-secretory and late secretory phases. These results may indicate that the proliferative-phase peak of IEL is mediated by estrogen via ER
, whereas the peak in the mid-secretory and late secretory phases indicates possible regulation of IEL by progesterone via PR. As classical PR A and PR B were not detected in the IEL during the menstrual cycle, we examined the involvement of a new type of PR, mPR, which is localized in the cell membrane (Peluso et al., 2001
; Bramley et al., 2002
; Shah et al., 2005
). Indeed, mPR mRNA was detected in the oviduct IEL. We also found that the number of Ki-67-positive IEL correlated exactly with ER
and mPR expression and was significantly increased in the early proliferative phase and the late secretory phase. Interestingly, in tubal pregnancy oviducts, the number of Ki-67- and ER
-positive IEL increased significantly, probably reflecting an increased proliferation of IEL possibly mediated via ER
. Taken together with these results, our findings indicate that the fluctuation and the proliferative activity of IEL in the premenopausal oviduct may be associated with the plasma levels of estrogen via ER
and progesterone via mPR, respectively.
In conclusion, we found that the IEL of human oviduct expressed ER
and mPR and that the number of IEL fluctuated, probably because of estrogen levels in the proliferative phase and progesterone levels during the secretory phase. Furthermore, our study strongly implicated the possible involvement of ER
-positive IEL in regulating immune function in normal and tubal pregnancy oviducts.
| Acknowledgements |
|---|
|
|
|---|
We thank Dr Keiko Shukuwa for excellent technical assistance (Division of Histology and Cell Biology, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate School of Biomedical Sciences) and Dr Koichi Hiraki for sample collection (Department of Obstetrics and Gynecology, Nagasaki University School of Medicine). This study was supported in part by a Grant-in-Aid for Scientific Research from the Japanese Ministry of Education, Science, Sports and Culture (nos 1247003, 15390058 and 16659047).
| References |
|---|
|
|
|---|
Amso NN, Crow J, Shaw RW. (1994) Comparative immunohistochemical study of oestrogen and progesterone receptors in the fallopian tube and uterus at different stages of the menstrual cycle and the menopause. Hum Reprod 9:10271037.
Bramley TA, Menzies GS, Rae MT, Scobie G. (2002) Non-genomic steroid receptors in the bovine ovary. Domest Anim Endocrinol 23:312.[CrossRef][ISI][Medline]
Brenner RM, McClellan MC, West NB, Novy MJ, Haluska GJ, Sternfeld MD. (1991) Estrogen and progestin receptors in the macaque endometrium. Ann N Y Acad Sci 622:149166.[Medline]
Brimnes J, Allez M, Dotan I, Shao L, Nakazawa A, Mayer L. (2005) Defects in CD8+ regulatory T cells in the lamina propria of patients with inflammatory bowel disease. J Immunol 174:58145822.
Christow A, Sun X, Gemzell-Danielsson K. (2002) Effect of mifepristone and levonorgestrel on expression of steroid receptors in the human Fallopian tube. Mol Hum Reprod 8:333340.
Critchley HO, Brenner RM, Henderson TA, Williams K, Nayak NR, Slayden OD, Millar MR, Saunders PT. (2001) Estrogen receptor beta, but not estrogen receptor alpha, is present in the vascular endothelium of the human and nonhuman primate endometrium. J Clin Endocrinol Metab 86:13701378.
Crow J, Amso NN, Lewin J, Shaw RW. (1994) Morphology and ultrastructure of fallopian tube epithelium at different stages of the menstrual cycle and menopause. Hum Reprod 9:22242233.
Dorfman SF. (1983) Deaths from ectopic pregnancy, United States, 1979 to 1980. Obstet Gynecol 62:334338.[Abstract]
Fujishita A, Nakane PK, Koji T, Masuzaki H, Chavez RO, Yamabe T, Ishimaru T. (1997) Expression of estrogen and progesterone receptors in endometrium and peritoneal endometriosis: immunohistochemical and in situ hybridization study. Fertil Steril 67:856864.[CrossRef][ISI][Medline]
Gava N, Clarke CL, Byth K, Arnett-Mansfield RL, deFazio A. (2004) Expression of progesterone receptors A and B in the mouse ovary during the estrous cycle. Endocrinology 145:34873494.
Gerdes D, Wehling M, Leube B, Falkenstein E. (1998) Cloning and tissue expression of two putative steroid membrane receptors. Biol Chem 379:907911.[ISI][Medline]
Gompel C and Silverberg SG. (1994) Cyclical variation of endometrium. In Gompel C and Silverberg SG (Eds.). Pathology of Gynecology and Obstetrics(Lippincott, Philadelphia, PA) pp. 171205.
Hishikawa Y, Damavandi E, Izumi S, Koji T. (2003) Molecular and histochemical analysis of estrogen receptors
and
expressions in the mouse ovary: in situ hybridization and southwestern histochemistry. Med Electron Microsc 36:6773.[Medline]
Hishikawa Y, Tamaru N, Ejima K, Hayashi T, Koji T. (2004) Expression of keratinocyte growth factor and its receptor in human breast cancer: its inhibitory role in the induction of apoptosis possibly through the overexpression of Bcl-2. Arch Histol Cytol 67:455464.[CrossRef][ISI][Medline]
Ishimaru T, Khan KN, Fujishita A, Kitajima M, Masuzaki H. (2004) Hepatocyte growth factor may be involved in cellular changes to the peritoneal mesothelium adjacent to pelvic endometriosis. Fertil Steril 81:810818.[Medline]
Kawano N, Koji T, Hishikawa Y, Murase K, Murata I, Kohno S. (2004) Identification and localization of estrogen receptor
- and
-positive cells in adult male and female mouse intestine at various estrogen levels. Histochem Cell Biol 121:399405.[CrossRef][ISI][Medline]
Khan KN, Masuzaki H, Fujishita A, Kitajima M, Sekine I, Matsuyama T, Ishimaru T. (2005) Estrogen and progesterone receptor expression in macrophages and regulation of hepatocyte growth factor by ovarian steroids in women with endometriosis. Hum Reprod 20:20042013.
Koji T. (2000) Springer Laboratory Manual: Molecular Histochemical Techniques(Springer-Verlag, Tokyo).
Koji T and Brenner RM. (1993) Localization of estrogen receptor messenger ribonucleic acid in rhesus monkey uterus by nonradioactive in situ hybridization with digoxigenin-labeled oligonucleotides. Endocrinology 132:382392.[Abstract]
Koji T and Nakane PK. (1996) Recent advances in molecular histochemical techniques: in situ hybridization and southwestern histochemistry. J Electron Microsc 45:119127.
Kolble K. (2000) The LEICA microdissection system: design and applications. J Mol Med 78:2425.
Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. (1996) Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:59255930.
Kutteh WH, Blackwell RE, Gore H, Kutteh CC, Carr BR, Mestecky J. (1990) Secretory immune system of the female reproductive tract II. Local immune system in normal and infected fallopian tube. Fertil Steril 54:5155.[ISI][Medline]
Lecce G, Meduri G, Ancelin M, Bergeron C, Perrot-Applanat M. (2001) Presence of estrogen receptor
in the human endometrium through the cycle: expression in glandular, stromal and vascular cells. J Clin Endocrinol Metab 86:13791386.
McGee ZA, Jensen RL, Clemens CM, Taylor-Robinson D, Johnson AP, Gregg CR. (1999) Gonococcal infection of human fallopian tube mucosa in organ culture: relationship of mucosal tissue TNF-alpha concentration to sloughing of ciliated cells. Sex Transm Dis 26:160165.[ISI][Medline]
Noe M, Kunz G, Herbertz M, Mall G, Leyendecker G. (1999) The cyclic pattern of the immunocytochemical expression of oestrogen and progesterone receptors in human myometrial and endometrial layers: characterization of the endometrial-subendometrial unit. Hum Reprod 14:190197.
Odor DL. (1974) The question of "basal" cells in oviductal and endocervical epithelium. Fertil Steril 25:10471062.[ISI][Medline]
Palter SF and Olive DL. (2002) Reproductive physiology. In Berek JS (Ed.). Novaks Gynecology 13th edn (Lippincott Williams & Wilkins, Philadelphia, PA) pp. 160161.
Peluso JJ, Fernandez G, Pappalardo A, White BA. (2001) Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94101.
Radwanska E, Frankenberg J, Allen EI. (1978) Plasma progesterone levels in normal and abnormal early human pregnancy. Fertil Steril 30:398402.[ISI][Medline]
Sadan O, Ginath S, Rotmensch S, Boaz M, Golan A, Glezerman M. (2002) Role of steroid receptors in the pathogenesis of tubal pregnancy. J Reprod Med 47:10311034.[ISI][Medline]
Saunders PTK, Maguire SM, Gaughan J, Millar MR. (1997) Expression of estrogen receptor beta (ER
) in multiple rat tissues visualized by immunohistochemistry. J Endocrinol 154:1316.
Seifer DB, DeCherney AH, Bartimus J, Frickleton J. (1995) Complications of early pregnancy. In OGrady JP, Gimovsky ML, McIlhargie CJ (Eds.). Operative Obstetrics(Williams & Wilkins, Baltimore, MD) pp. 45.
Shah C, Modi D, Sachdeva G, Gadkar S, Puri C. (2005) Coexistence of intracellular and membrane-bound progesterone receptors in human testis. J Clin Endocrinol Metab 90:474483.
Shirota K, Tateishi K, Koji T, Hishikawa Y, Hachisuga T, Kuroki M, Kawarabayashi T. (2005) Early human preantral follicles have relaxin and relaxin receptor (LGR7), and relaxin promotes their development. J Clin Endocrinol Metab 90:516521.
Slayden OD, Hirst JJ, Brenner RM. (1993) Estrogen action in the reproductive tract of rhesus monkeys during antiprogestin treatment. Endocrinology 132:18451856.[Abstract]
Stygar D, Wang H, Vladic YS, Ekman G, Eriksson H, Sahlin L. (2001) Co-localization of estrogen receptor
and leucocyte markers in the human cervix. Mol Hum Reprod 7:881886.
Sun X, Christow A, Marions L, Gemzell-Danielsson K. (2003) Progesterone receptor isoform B in the human fallopian tube and endometrium following mifepristone. Contraception 67:319326.[CrossRef][ISI][Medline]
Tamaru N, Hishikawa Y, Ejima K, Nagasue N, Inoue S, Muramatsu M, Hayashi T, Koji T. (2004) Estrogen receptor-associated expression of keratinocyte growth factor and its possible role in the inhibition of apoptosis in human breast cancer. Lab Invest 84:14601471.[CrossRef][ISI][Medline]
Taylor AH and Al-Azzawi F. (2000) Immunolocalization of estrogen receptor beta in human tissues. J Mol Endocrinol 24:145155.[Abstract]
Tsurusaki T, Aoki D, Kanetake H, Inoue S, Muramatsu M, Hishikawa Y, Koji T. (2003) Zone-dependent expression of estrogen receptors alpha and beta in human benign prostatic hyperplasia. J Clin Endocrinol Metab 88:13331340.
Ulbrich SE, Kettler A, Einspanier R. (2003) Expression and localization of estrogen receptor
, estrogen receptor
and progesterone receptor in the bovine oviduct in vivo and in vitro. J Steroid Biochem Mol Biol 84:279289.[CrossRef][ISI][Medline]
Verhage HG, Bareither ML, Jaffe RC, Akbar M. (1979) Cyclic changes in ciliation, secretion and cell height of oviductal epithelium in women. Am J Anat 156:505521.[CrossRef][ISI][Medline]
Walters MD, Eddy CA, Gibbs RS, Schachter J, Holden AE, Pauerstein CJ. (1988) Antibodies to Chlamydia trachomatis and risk for tubal pregnancy. Am J Obstet Gynecol 159:942946.[ISI][Medline]
Wang H, Eriksson H, Sahlin L. (2000) Estrogen receptors
and
in the female reproductive tract of the rat during the estrous cycle. Biol Reprod 63:13311340.
Witkin SS. (2002) Immunological aspects of genital chlamydia infections. Best Pract Res Clin Obstet Gynaecol 16:865874.[CrossRef][Medline]
Yoshii A, Koji T, Ohsawa N, Nakane PK. (1995) In situ localization of ribosomal RNAs is a reliable reference for hybridizable RNA in tissue sections. J Histochem Cytochem 43:321327.[Abstract]
Submitted on March 10, 2006; resubmitted on April 18, 2006; accepted on April 25, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Cvoro, D. Tatomer, M.-K. Tee, T. Zogovic, H. A. Harris, and D. C. Leitman Selective Estrogen Receptor- Agonists Repress Transcription of Proinflammatory Genes J. Immunol., January 1, 2008; 180(1): 630 - 636. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







