Skip Navigation


Hum. Reprod. Advance Access originally published online on August 18, 2006
Human Reproduction 2007 22(1):159-166; doi:10.1093/humrep/del322
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
22/1/159    most recent
del322v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lessard, C.
Right arrow Articles by Handel, M.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lessard, C.
Right arrow Articles by Handel, M.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Mutagenesis-generated mouse models of human infertility with abnormal sperm

C. Lessard1,3, H. Lothrop1, J.C. Schimenti2 and M.A. Handel1,4

1 The Jackson Laboratory, Bar Harbor, ME and 2 Department of Biomedical Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA

3 Present address: Canadian Animal Genetic Resources Program, Agriculture and Agri-Food Canada, Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5B4

4 To whom correspondence should be addressed at: The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, USA. E-mail: maryann.handel{at}jax.org


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
BACKGROUND: The aetiology of human male fertility, with impairment of sperm number, motility and morphology (oligoasthenoteratozoospermia), has been difficult to understand, partly for lack of animal models. METHODS: An ethylnitrosourea (ENU) mutagenesis strategy has been successful in producing heritable gene mutations with phenotypes similar to human male infertility, and here, we describe three independent ENU-induced mutations that cause a phenotype of oligoasthenoteratozoospermia in mice. RESULTS: The loci identified by these three mutations are designated swm2, repro2 and repro3. All mutant males were characterized by low sperm concentration, poor sperm morphology and negligible motility, but the infertile males were apparently normal in other respects. Sperm from mutant males failed to fertilize oocytes in vitro. Ultrastructural analyses revealed varied abnormalities apparent in both testicular spermatids and epididymal sperm. Genetic mapping placed the swm2 gene on chromosome 7, the repro2 gene on chromosome 5 and the repro3 gene on chromosome 10. CONCLUSION: The single-gene mutations caused complex and non-specific sperm pathologies, a point with important implications for managing cases of human male infertility. The ultimate identification of the loci for the mutations causing these phenotypes will clarify aetiology of complex syndromes of infertility with sperm abnormalities consistent with oligoasthenoteratozoospermia.

Key words: infertility/mutagenesis/oligoasthenoteratozoospermia/sperm/spermiogenesis


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Frequently, human male infertility is accompanied by complex and poorly understood sperm parameters. These include low sperm concentration (oligozoospermia), poor sperm morphology (teratozoospermia), poor sperm motility (asthenozoospermia) or a combination of the syndromes (oligoasthenoteratozoospermia). In general, the latter pathology is defined by parameters of concentration (<20 million spermatozoa/ml), motility (<50% spermatozoa motile) and morphology (<30% spermatozoa exhibiting normal morphology). Although some cases of oligoasthenoteratozoospermia can be clinically associated with varicocoele or other pathologies, many cases cannot be so readily explained. Genes on the Y chromosome are known to impact male fertility, but autosomal factors also have been proposed to play a role in the aetiology of complex sperm pathologies (Chemes et al., 1998Go; Chemes, 2000Go; Baccetti et al., 2001Go, 2002Go, 2004Go). In most cases, however, there has been insufficient evidence to confirm direct cause and effect between a human gene mutation and the phenotype of oligoasthenoteratozoospermia. A relative paucity of animal models has further frustrated experimental analysis of these complex and poorly defined sperm abnormalities. We sought appropriate animal models through a programme designed to deliberately induce gene mutations leading to a recessive phenotype of infertility.

Sperm abnormalities are frequently observed in mice with fertility defects (Escalier, 2001Go; Matzuk and Lamb, 2002Go). Most informative about spermiogenic mechanisms are cases where ablation of a single gene leads to a well-defined sperm defect; however, mutant phenotypes exhibiting complex and multiple sperm defects provide models for human oligoasthenoteratozoospermia. For example, HRB (H1V Rev binding protein) is a protein of the proacrosomal vesicles that ultimately fuse to form the acrosome, and Hrb-null mice have sperm that lack both acrosome and mitochondrial sheath and exhibit head shape defects, disarranged cytoplasmic organelles and poor sperm motility (Kang-Decker et al., 2001Go). In a second example, the phenotype of an engineered recessive null mutation in Cnot7, encoding a transcription complex subunit, is male infertility, with sperm exhibiting low motility and abnormal morphology (Nakamura et al., 2004Go). Interestingly, the Cnot7 gene appears to act in the testicular soma, rather than the germ cells, as fertility of Cnot7-null germ cells was restored by transplanting them to testes where the somatic cells expressed Cnot7 (Nakamura et al., 2004Go). Thus both genes, one of which functions autonomously in the germ cells and the other of which functions autonomously in the soma, are important for regulated development of normal sperm profiles .

In all probability, sperm parameters are affected by many genes whose identity and function are not yet known (Hackstein et al., 2000Go). Approximately 4% of the mouse genome (>2300 genes) is expressed specifically in male germ cells (Schultz et al., 2003Go), but the function of the majority has not yet been identified. An ethylnitrosourea (ENU)-mutagenesis programme at The Jackson Laboratory was designed as an unbiased approach to identify genes required for fertility (Lessard et al., 2004Go; Handel et al., 2006Go). A wide range of infertility phenotypes in both male and female mice has been identified in this programme, but, importantly, none of the mice exhibit any abnormal parameters other than infertility. The programme has identified male phenotypes of complex and poor sperm profiles, models for human oligoasthenoteratozoospermia. Here, we analyse the spermatogenic abnormalities produced by three independent ENU-induced mutations causing oligoasthenoteratozoospermia, designated swm2 (sperm without motility 2), repro2 and repro3 (reproduction 2 and 3). Genetic fine mapping of the three mutated genes will ultimately lead to identification of novel genes contributing to the acquisition of sperm morphology and function.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Generation of families transmitting ENU-induced infertility mutations
The strategy used to generate and transmit ENU mutations affecting fertility was described previously (Lessard et al., 2004Go; Handel et al., 2006Go). Briefly, male C57BL/6J (herein designated B6) mice were injected with ENU to generate random genome-wide point mutations in germ cells. After a period of recovery, the ENU-treated males were mated with C3HeB/FeJ (herein designated C3H) female mice to produce G1 progeny; each male G1 mouse carries a unique spectrum of induced mutations and founds a distinct family lineage. The G1 male mice were mated with C3H female mice to produce G2 progeny. G2 females were backcrossed with the G1 male to generate G3 progeny; ~25% of these are homozygous recessive for any induced mutation carried by the G1 founder male. To identify mutations affecting only fertility, we mated all normal-appearing G3 mice with wild-type mice. Those mice that failed to produce pregnancies or offspring were subjected to a secondary phenotype screen of reproductive organ morphology and histology and sperm function, including IVF to define their phenotypes more precisely.

Andrological analyses
Body, testis and seminal vesicle weights were recorded, gross examination of reproductive organ morphology was conducted, and testes and epididymides were prepared for histology. Sperm morphology was assessed after Coomassie Blue staining as previously described (Larson and Miller, 1999Go). At least 200 sperm were scored for abnormal shape of both head and the tail, tailless sperm or headless sperm. Presence or absence of motility was assessed by light microscopy observation; sperm were considered motile when progression or regular movement of the tail was observed.

Histology, immunolocalization and microscopy
For routine histological assessment, testes were fixed in Bouins solution (LabChem Inc, Pittsburgh, PA, USA) for 24 h, dehydrated and embedded in paraffin. Sections (5 µm) were stained with Periodic Acid Schiff-Hematoxylin (Fisher, Suwanee, GA, USA). Stages of the seminiferous epithelium and steps in spermatid development were scored according the 12-stage classification scheme (Oakberg, 1956Go; Russell et al., 1990Go).

Before immunolocalization of spermatid tail proteins, sections were treated in methanol with 3% peroxide hydrogen to neutralize endogenous peroxidases. Sections were blocked in 10% goat serum diluted in phosphate-buffered saline (PBS). The primary antibody against ODF2 or {alpha} tubulin (Sigma, St. Louis, MO, USA), diluted in PBS, was added, and slides were incubated overnight in humid conditions at 4°C. After washing in PBS, sections were incubated for 30 min with a biotinylated goat anti-rabbit serum (Vector Laboratories, Burlingame, CA, USA) diluted in PBS. Sections were stained with Vectastain ABC (Vector Laboratories), dehydrated in ethanol and xylene, and cover slips adhered with Permount (Fisher).

For transmission electron microscopy, testes were fixed overnight at 4°C in 2% glutaraldehyde (Electron Microscopy Sciences, Washington, PA, USA) and 2% paraformaldehyde (Electron Microscopy Sciences) in 0.1 M cacodylate buffer (pH 7.2), washed in cacodylate buffer, post-fixed overnight at 4°C in 1% osmium tetroxide (Electron Microscopy Sciences) in cacodylate buffer, then dehydrated and embedded. Sections were stained with 2% uranyl acetate and Reynolds lead citrate and viewed using a JEOL 1230 transmission electron microscope.

For scanning electron microscopy, sperm were fixed as described above. Fixed sperm were mounted on poly-L-lysine-coated cover slips (Fisher) and fixed with 1% osmium tetroxide, dehydrated and air dried. Samples were visualized with Hitachi 3000N VP scanning electron microscope with EDAX X-ray microanalysis unit and PCI quartz image management software.

IVF
IVF was performed as previously described (Eppig and O’Brien, 1996Go). After fertilization, the oocytes were washed twice in minimum essential medium (MEM), transferred to fresh MEM and incubated for 20 h at 37°C under 5% CO2, 5% O2, 90% H2 after which time the number of two-cell embryos was determined.

Genetic mapping
Because ENU-treated B6 males were bred to C3H females, the G3 progeny were comprised of a mix of the two genomic backgrounds; the ENU mutations are in B6, not C3H genomic regions. For each mutant family, DNA from affected and non-affected animals was used as template for a genome scan with two to three polymorphic microsatellite markers per autosomal chromosome tested. The single B6 region identified as homozygous in all affected animals but not in unaffected animals was considered as the candidate region for the ENU mutation and confirmed by further analysis with markers flanking this genomic interval. The flanking markers were used for genotyping subsequent progeny and colony maintenance (e.g. identification of heterozygous individuals). Fine mapping of the mutated genes was achieved in intercrosses of heterozygous males and females as well as from developing congenic lines from crosses of heterozygous males and C3H females. Inter-subspecific crosses to CAST/EiJ were also generated for fine mapping, but no useful recombinants for establishing the critical regions emerged from these crosses.

For PCR genotyping of DNA marker sequences, 1–3 mm pieces of tail were digested in 25 mM NaOH overnight at 55°C, followed by 20 min incubation at 95°C. The digestion was neutralized with three volumes of 40 mM Tris–HCl pH 5.0. Non-digested tissues were pelleted by centrifugation, and the supernatant was transferred to a clean tube. Approximately 2 µl of the lysate was used as a template in a 25 µl PCR and amplified with AmpliTaq (Applied Biosystem, Foster City, CA, USA) under standard conditions. PCR products were analysed on a 3% low EEO agarose (Fisher) gels. D7JCS2, D7JCS3, D7JCS6 and D7JCS8 were private polymorphic markers used to fine map swm2 region. The sequence of D7JCS2 left and right primers were AGTTGTCTGGGATGACCAGG and GTTTGTATAGGGGCTTGCCA, respectively. The sequence of D7JCS3 left and right primers were GGTGTTTGAGCACTTCATGC and TGGTGCCAAGAGGATCTTTC, respectively. The sequence of D7JCS6 left and right primers were GTACAGCTTCACCTGCACCA and GCCTGTGGGTAGATGGAATG, respectively. The sequence of D7JCS8 left and right primers were TAGAAACAGGCCGCTGAGAT and TTCACGCCTTCTCCT CAGTT, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Mutant swm2, repro2 and repro3 males exhibit abnormal andrological parameters
Infertility is the only apparent phenotype of mutations produced and archived by the ReproGenomics mutagenesis programme. Many male infertility mutations generated cause phenotypes of post-meiotic spermiogenic defects (Lessard et al., 2004Go) (for continued updates on new mutations, see http://reprogenomics.jax.org). Mutant males from three families, swm2, repro2 and repro3 exhibited abnormalities similar to cases of unexplained human infertility with abnormal sperm parameters—oligoasthenoteratozoospermia (Table I). Among the mutant males, body, testis and seminal vesicle weights were not statistically different from those of the unaffected males. (Although hormonal profiles were not determined, the normal seminal vesicle weights suggest normal androgen levels in the mutant males.) Notably, mutant males from all three families exhibited oligozoospermia (sperm concentrations that were roughly 3–15% that of unaffected males), asthenozoospermia (no visibly motile sperm) and teratozoospermia (no sperm with normal morphology; Table I). Assays of morphology of sperm from affected males revealed a significant proportion of tailless sperm heads for swm2/swm2 males, headless sperm for swm2/swm2 and repro3/repro3, and sperm with abnormal head and tail shape for all three mutant phenotypes (Figure 1). Together, these sperm phenotypes suggested defects in the assembly of spermatids.


View this table:
[in this window]
[in a new window]

 
Table I. Phenotypic traits of swm2, repro2 and repro3 mutant males

 

Figure 1
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Classification of morphology of epididymal sperm from swm2, repro2 and repro3 mutant males. Morphological abnormalities were classified into three categories: abnormal head and tail shape, headless sperm and tailless sperm. Frequencies were determined for sperm from three males for each mutation.

 
When tested by IVF, sperm from swm2, repro2 and repro3 mutant males failed to fertilize oocytes (Table I), confirming the infertility detected in natural mating. Taken together, these data reflect typical parameters of human oligoasthenoteratozoospermia and suggest that these mutant males provide a model for such human syndromes and that the swm2, repro2 and repro3 gene products contribute to normal spermiogenesis and acquisition of sperm function.

Development of spermatid morphology abnormalities in swm2, repro2 and repro3 males
Histological evaluation of testes from mutant males revealed a largely normal seminiferous epithelium with typical cell associations (Figure 2). The number and morphology of spermatogonia, spermatocytes and round spermatids were apparently normal. Nonetheless, some abnormal sperm morphology was manifest in testicular spermatids, and thus the sperm abnormalities cannot be due solely to post-testicular defects (Figures 2 and 4). Aberrant ‘hammerhead’ nuclear shapes were observed among spermatids (arrows in Figure 2B–D), but an acrosome was always observed on mutant spermatids throughout their differentiation. Tail elongation was deficient and those tails infrequently observed among elongating spermatids were short. There was no evidence from a caspase assay for apoptotic elimination of the aberrant spermatids (data not shown).


Figure 2
View larger version (193K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Examples of spermatid abnormalities observed in testes of affected males from swm2, repro2 and repro3 families. In A, normal cell stage and spermatid morphology in a stage X tubule from a testis of a B6 mouse. In BD, aberrant hammerhead nuclear shapes of spermatids (arrows) typify observations of stage X tubules from swm2 (B), repro2 (C) and repro3 (D) mutants. Bar = 10 µm.

 
To further assess spermatid tail development, we labelled testis sections with a polyclonal antibody against sperm tail proteins ODF2 and {alpha} tubulin (Schalles et al., 1998Go; Donkor et al., 2004Go) (Figure 3). In wild-type seminiferous tubule cross sections, antibody clearly and distinctly labelled spermatid tails, although a faint signal could be detected in the cytoplasm (Figure 3A and E); there was no signal in negative control sections labelled with secondary but not the primary antibody (Figure 3A and E insets). In testes from each of the three mutants (Figure 3B–D), the ODF2 signal revealed aberrant and incomplete spermatid tail formation; immunolabelling was localized in bundles of residual cytoplasm at the testis lumen, although occasionally a short tail profile was observed. Immunolocalization of {alpha} tubulin (Figure 3F–H) revealed a similar pattern of disorganized and incomplete spermatid tails.


Figure 3
View larger version (102K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Immunohistochemical localization of ODF2 (panels AD) and {alpha} tubulin (panels EH) proteins in seminiferous tubule cross-sections from testes of wild-type (A and E) and mutant swm2 (B and F), repro2 (C and G) and repro3 (D and H) males. All three mutants exhibit an intense labelling with each antibody at the apical surface of the seminiferous epithelium. Cytoplasmic bundles and tail-like structures can be observed. The negative control sections (insets) were labelled with the secondary antibody only. Sections were counterstained with hematoxylin. Images were captured at x40 magnification, bar =10 µm.

 
Testicular spermatid morphological abnormalities were assessed in more detail by transmission electron microscopy (Figure 4). These ultrastructural analyses confirmed the histological evidence that chromatin condensation and acrosome differentiation occurred in swm2, repro2 and repro3 mutant spermatids (Figure 4B–D). In thin sections for electron microscopy, spermatid tail profiles were not frequently observed, and those seen exhibited various impairments of the tail structure (Figure 4). Very few condensed spermatids in testes of swm2/swm2 mutants exhibited a correctly aligned mitochondrial sheath; more frequently, the mitochondria were dispersed in a cytoplasmic droplet or irregularly clustered around the axoneme (Figure 4B). In swm2/swm2 testes, completely differentiated tail principal pieces were not detected, although tail structures could be observed within residual bodies (data not shown). Among elongated spermatids in mutant repro2/repro2 testes, dysplasia of the fibrous sheath was frequently observed (arrow, Figure 4C). Axonemal profiles of elongated spermatids in mutant repro3/repro3 testes did not exhibit an associated mitochondrial sheath (Figure 4D). Together, these observations reveal aberrant and chaotic morphogenesis of spermatids in testes of males affected by these three independent mutations, with considerable morphological variation among individual spermatids within one testis. Moreover, abnormalities among all three mutants appear to be primarily in assembly of complex structures rather than in production of specific components.


Figure 4
View larger version (176K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Transmission electron microscopy of spermatid tail structures in elongated spermatids. (A) Typical axonemal and mitochondrial organization of the tails of elongating wild-type spermatids (bar = 2 µm). (B) This image of a maturing spermatid in the testis of a mutant swm2 male shows alignment of mitochondria but a large cytoplasmic droplet with poorly organized structure (bar = 2 µm). (C) This image of an elongating spermatid within a repro2 mutant testis reveals the axonemal complex, some aligned mitochondria and a disorganized array of outer dense fibres within the cytoplasm (arrow) (bar = 0.5 µm). (D) This image of the axonemal complex of a repro3 mutant spermatid reveals failure of alignment of mitochondrial in the midpiece (bar = 2 µm).

 
These complex phenotypes were reflected in aberrant morphology of epididymal sperm in affected males from swm2, repro2 or repro3 families revealed by scanning electron microscopy (Figure 5). Sperm from swm2/swm2 mutant males (Figure 5A–D) were characterized by a short and discontinuous midpiece (Figure 5A and B, arrows), or taillessness (Figure 5C), or, more rarely, a partial separation of the neck and head (Figure 5D). Sperm from repro2/repro2 mutant males frequently exhibited a short tail (Figure 5E–F), and for a small sperm population, sperm tails were terminating in a coil (Figure 5G). Among the epididymal sperm population of mutant repro3/repro3 males, variations in both tail and head shapes were observed (Figure 5H–J). Moreover, short tail-like fragments were observed in the epididymal sperm preparations from each of the three mutants. Thus, from observations of both testicular spermatids and epididymal sperm, there is high morphological variability among sperm and aberrant assembly of sperm-specific structures, a phenotype similar to human teratozoospermia.


Figure 5
View larger version (75K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Scanning electron microscopy of epididymal sperm abnormalities in swm2, repro2 and repro3 mutant males. In panels AD are seen the abnormalities typical of sperm from mutant swm2/swm2 males, including abnormal blebbing of the midpiece and neck region (arrows) in A and B (bar = 10 µm), an example of a tailless sperm in C (bar = 5 µm), and in D, apparent separation of the spermatozoon head and neck regions (arrow) (bar = 5 µm). In panels EG are seen examples of the morphology phenotypes of sperm from mutant repro2/repro2 males, including in E and F, spermatozoa with short tails (bar = 5 µm in E and 10 µm in F), and G, a spermatozoon with a short coiled tail (bar = 5 µm). In panels HJ are seen epididymal spermatozoa from repro3/repro3 mutant males, illustrating in H and I (bars = 10 µm), short and stubby tails and in J (bar = 10 µm), an example of a spermatozoon with poorly formed anterior structures.

 
The swm2, repro2 and repro3 mutations are in distinct and separate genomic regions
The promise of animal models for oligoasthenoteratozoospermia is that aetiologies of the phenotype will emerge from the identification of the genes (and their function) affected by these three mutations. The first step in gene identification (‘positional cloning’) is determination of critical regions within the genome by genetic mapping. By maintaining and propagating these mutant families, by mating heterozygous males with heterozygous or homozygous mutant females (which are fertile), we identified both affected and fertile mice exhibiting recombination events between B6 and C3H genomic regions detected by PCR genotyping for microsatellite markers flanking the chromosomal region for each of the mutations (Table II). This demonstrated that, despite some similarities in phenotypes, the swm2, repro2 and repro3 mutations are in distinct and separate genomic regions. Progressively narrowing the regions with new markers and fine mapping of new recombinations localized the critical genomic regions for each mutation (Table II and Figure 6). The swm2 mutation is on chromosome 7 in a region of 2.0 Mb, from 14.9 Mb to 16.9 Mb (NCBI m35 mouse assembly); this region includes 44 genes (Table II and Figure 6, Supplemental Table I). The repro2 mutation is on chromosome 5 in a region of 3.7 Mb, from 119.0 Mb to 122.7 Mb (NCBI m35 mouse assembly), including 78 genes (Table II and Figure 6, Supplemental Table I). The repro3 mutation is on chromosome 10 in a 2.7 Mb region flanked by 44.0–46.7 Mb (NCBI m35 mouse assembly) and including 15 genes (Table II and Figure 6, Supplemental Table I). These regions were confirmed by the congenic lines being developed for these three families, wherein infertility is observed in all cases of B6 homozygosity for the critical regions. This fine mapping is the first step towards ultimate identification of the three genes altered by the swm2, repro2 and repro3 mutations.


View this table:
[in this window]
[in a new window]

 
Table II. Chromosome location of the mutations

 

Figure 6
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. Fine mapping recombinations localizing swm2 (A), repro2 (B) and repro3 (C) mutations. In A, nine private and Mit polymorphic markers were used to genotype recombinant mice in the swm2 family. In B, four Mit markers were used to genotype recombinant mice in the repro2 family. In C, three Mit markers were used to genotype recombinant mice in the repro3 family. The sidebars show the order of polymorphic makers in the relevant genomic regions. The black boxes denote individuals with two B6 alleles for the marker, and black and white boxes represent heterozygous individuals, with one B6 allele and one C3H allele for the marker. The phenotype of each mouse, fertile (F) or infertile (I) is denoted in the bottom line of each panel. The mice were considered infertile if they did not impregnate females or did not produce mature spermatozoa.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Identification of mouse models for human oligoasthenoteratozoospermia
This study describes the infertility phenotype of three different ENU-induced mutations designated swm2, repro2 and repro3. The infertility induced by each of these three recessive mutations was characterized by features of oligoasthenoteratozoospermia: low sperm concentration, low sperm motility and a high frequency of abnormal sperm (Table I). These phenotypes, frequently detected among the ejaculated sperm of infertile humans, have been observed here in epididymal sperm. It is not possible to humanely obtain ejaculated sperm from mice, but sperm from the mouse cauda epididymis are widely used as representative of ejaculated sperm, as they acquire motility and function in fertilization in vitro. These mutations thus can provide insight into the varied phenotypes of human oligoasthenoteratozoospermia (Chemes, 2000Go; Chemes and Rawe, 2003Go), especially considering the fact that the mutant mice exhibit no abnormal phenotypes other than infertility and sperm abnormalities. Each of the three mutations maps to a unique genomic region; therefore, the phenotypes are due to mutations in three different genes. Although it is formally possible that any one of the three phenotypes could be because of mutations in two closely linked, co-segregating genes, this is unlikely (Concepcion et al., 2004Go). The genes responsible for these three phenotypes have not yet been identified. [Among all of the genes in the three genomic regions, only one, Six5 (sine oculis-related homeobox 5 homolog), in the swm2 region and encoding a transcription factor, has been implicated in spermiogenesis. The phenotypes of the null mutation in Six5 include lenticular cataracts (Sarkar et al., 2000Go) as well as an absence of mature spermatozoa, tubular atrophy and concomitant reduction of the testis weight (Sarkar et al., 2004Go). Although these phenotypes are markedly different than the swm2 phenotype, it is possible that the ENU point mutation swm2 could be within the Six5 locus, as frequently null and hypomorphic phenotypes can differ. Therefore, this gene is being further investigated.] However, given the relative absence of genes known to be required for spermatogenesis, identification of the genes responsible for the swm2, repro2 and repro3 phenotypes will undoubtedly provide new knowledge about the regulation of sperm morphology and quality in mammals.

These results validate the use of ENU mutagenesis to acquire specific models, and, indeed, we have previously shown that ENU mutagenesis generates a wide range of infertility phenotypes (Ward et al., 2003Go; Lessard et al., 2004Go; Handel et al., 2006Go). Although we have analysed in depth only three oligoasthenoteratozoospermia phenotypes from ENU mutagenesis, in total, we have found that many mutations located on different chromosomes cause this phenotype suggests that a variety of genes, when mutated, can induce the complex sperm phenotypes of oligoasthenoteratozoospermia.

Aetiology of oligoasthenozoospermia phenotypes and consequences for assisted reproduction decisions
In humans, oligoasthenoteratozoospermia is found to be of two types (Chemes and Rawe, 2003Go). In some cases, there is a heterogeneous combination of different sperm abnormalities in any individual and among diverse patients. These defects, including non-specific flagellar abnormalities and non-specific sperm head morphology aberrations, are seen in lower frequency among the sperm of normally fertile men (Kubo-Irie et al., 2005Go) and are considered to be non-specific and frequently secondary to aberrant andrological conditions or environmental factors (Chemes and Rawe, 2003Go). The second type of oligoasthenoteratozoospermia is characterized by a characteristic sperm phenotype exhibited by of all or nearly all of the sperm of a given individual; these systemic anomalies are suspected to be genetic in origin, as they can be clustered in families (Chemes and Rawe, 2003Go). These can include specific axonemal abnormalities (such as Kartagener’s syndrome), dysplasia of the fibrous sheath (Chemes et al., 1998Go; Baccetti et al., 2004Go) and acephalic (headless) sperm (Chemes et al., 1999Go). Because such defects are relatively rare, because family sizes are not large and because genetic analysis is frequently impeded by the infertility phenotype, the genetic basis of many of these conditions has been hard to verify. Defects similar to these human abnormalities are found among the phenotypes described here, and our observations of these mutants document a variety of aberrant sperm phenotypes for each single gene mutation; some of these are shared in common among all three mutant families, whereas others are specific to one or two mutations. Thus, these findings demonstrate that single gene mutations can cause complex sperm phenotypes of the sort generally considered to be secondary to more general andrological conditions or adverse environmental factors (Chemes and Rawe, 2003Go). It is possible that the single gene mutated in each of these families could be pleiotropic in its action within the male reproductive system, causing an adverse environment for sperm differentiation and epididymal maturation. Alternatively, a mutation could be in a gene encoding a regulatory protein or morphogen, leading to general disruption of sperm differentiation or maturation. The importance of this study to clinical andrology is the finding that a single gene mutation can lead to a variety of non-specific and complex sperm phenotypes, thus presenting risk of transmission after microfertilization procedures.

Identification of loci of the swm2, repro2 and repro3 mutations
Genetic fine mapping revealed that the swm2, repro2 and repro3 mutations were distinct and localized on chromosome 7, chromosome 5 and chromosome 10, respectively (Table II). Several important observations emerge from the mapping effort. Within the regions defined by the swm2, repro2 and repro3 mutations, there are no genes now known to affect sperm morphology and quality; however, the candidate region of swm2 does include a gene whose mutation causes male infertility for reasons other than oligoasthenoteratozoospermia. Mutation of the Six5 gene within the swm2 region causes azoospermia and testicular atrophy (Sarkar et al., 2004Go). Together, these considerations suggest that ENU mutations affecting sperm morphology are present throughout the genome and not necessarily clustered as found in a study of ENU-induced mutations affecting sperm tail development (Clark et al., 2004Go).

Finally, although the chromosomal locations are known for swm2, repro2 and repro3, the identity of the mutated genes is not yet known. Both the swm2 and repro2 mutations are localized in gene-dense regions, making the task of positional cloning particularly challenging. Gene expression profiling of mutant and normal testes could possibly highlight potential candidate genes. For example, among the genes within the swm2 region are two genes highly expressed in the testis; 13 genes within the repro2 region and one gene within the repro3 are also highly expressed in testes (GNF SymAtlas public microarray database; http://wombat.gnf.org/SymAtlas/). Further genetic fine mapping coupled with sequencing and expression analyses of potential candidate genes will help to narrow the gene list for each mutation and ultimately identify the causative mutation in each family. Because there is no evidence that any of the genes within the three different candidate regions for these ENU mutations is implicated in oligoasthenoteratozoospermia, the outcome of this gene cloning effort will be new knowledge about the control of sperm quality.


    Supplementary material
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Supplementary data are available at http://humrep.oxfordjournals.org/.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
The Biological Imaging Service of the Jackson Laboratory, supported by a National Cancer Institute Cancer Center grant, CA-34196, provided expert histology and other support. We are grateful to Dr F.Van der Hoorn for the antibody against ODF2. We acknowledge the help of Dr J.Pendola, S.Sweeney and S.A.Hartford in the production of mutant mice. We thank John Eppig, Joel Graber and Alicia Valenzuela for their thoughtful comments on the manuscript. This work was supported by programme project support from the NIH, HD42137.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Acknowledgements
 References
 
Baccetti B, Capitani S, Collodel G, Di Cairano G, Gambera L, Moretti E, Piomboni P. (2001) Genetic sperm defects and consanguinity. Hum Reprod 16:1365–1371.[Abstract/Free Full Text]

Baccetti B, Capitani S, Collodel G, Strehler E, Piomboni P. (2002) Recent advances in human sperm pathology. Contraception 65:283–287.[CrossRef][Web of Science][Medline]

Baccetti B, Bruni E, Gambera L, Moretti E, Piomboni P. (2004) An ultrastructural and immunocytochemical study of a rare genetic sperm tail defect that causes infertility in humans. Fertil Steril 82:463–468.[CrossRef][Web of Science][Medline]

Chemes HE. (2000) Phenotypes of sperm pathology: genetic and acquired forms in infertile men. J Androl 21:799–808.[Web of Science][Medline]

Chemes EH and Rawe YV. (2003) Sperm pathology: a step beyond descriptive morphology. Origin, characterization and fertility potential of abnormal sperm phenotypes in infertile men. Hum Reprod Update 9:405–428.[Abstract/Free Full Text]

Chemes HE, Olmedo SB, Carrere C, Oses R, Carizza C, Leisner M, Blaquier J. (1998) Ultrastructural pathology of the sperm flagellum: association between flagellar pathology and fertility prognosis in severely asthenozoospermic men. Hum Reprod 13:2521–2526.[Abstract/Free Full Text]

Chemes HE, Puigdomenech ET, Carizza C, Olmedo SB, Zanchetti F, Hermes R. (1999) Acephalic spermatozoa and abnormal development of the head-neck attachment: a human syndrome of genetic origin. Hum Reprod 14:1811–1818.[Abstract/Free Full Text]

Clark AT, Firozi K, Justice MJ. (2004) Mutations in a novel locus on mouse chromosome 11 resulting in male infertility associated with defects in microtubule assembly and sperm tail function. Biol Reprod 70:1317–1324.[Abstract/Free Full Text]

Concepcion D, Seburn KL, Wen G, Frankel WN, Hamilton BA. (2004) Mutation rate and predicted phenotypic target sizes in ethylnitrosourea-treated mice. Genetics 168:953–959.[Abstract/Free Full Text]

Donkor FF, Monnich M, Czirr E, Hollemann T, Hoyer-Fender S. (2004) Outer dense fibre protein 2 (ODF2) is a self-interacting centrosomal protein with affinity for microtubules. J Cell Sci 117:4643–4651.[Abstract/Free Full Text]

Eppig JJ and O’Brien MJ. (1996) Development in vitro of mouse oocytes from primordial follicles. Biol Reprod 54:197–207.[Abstract]

Escalier D. (2001) Impact of genetic engineering on the understanding of spermatogenesis. Hum Reprod Update 7:191–210.[Abstract/Free Full Text]

Hackstein JH, Hochstenbach R, Pearson PL. (2000) Towards an understanding of the genetics of human male infertility: lessons from flies. Trends Genet 16:565–572.[CrossRef][Web of Science][Medline]

Handel MA, Lessard C, Reinholdt L, Schimenti J, Eppig JJ. (2006) Mutagenesis as an unbiased approach to identify novel contraceptive targets. Mol Cell Endocrinol 250:201–205.[CrossRef][Web of Science][Medline]

Kang-Decker N, Mantchev GT, Juneja SC, McNiven MA, van Deursen JM. (2001) Lack of acrosome formation in Hrb-deficient mice. Science 294:1531–1533.[Abstract/Free Full Text]

Kubo-Irie M, Matsumiya K, Iwamoto T, Kaneko S, Ishijima S. (2005) Morphological abnormalities in the spermatozoa of fertile and infertile men. Mol Reprod Dev 70:70–81.[CrossRef][Web of Science][Medline]

Larson JL and Miller DJ. (1999) Simple histochemical stain for acrosomes on sperm from several species. Mol Reprod Dev 52:445–449.[CrossRef][Web of Science][Medline]

Lessard C, Pendola JK, Hartford SA, Schimenti JC, Handel MA, Eppig JJ. (2004) New mouse genetic models for human contraceptive development. Cytogenet Genome Res 105:222–227.[CrossRef][Web of Science][Medline]

Matzuk MM and Lamb DJ. (2002) Genetic dissection of mammalian fertility pathways. Nat Cell Biol 4:Suppl, s41–s49.

Nakamura T, Yao R, Ogawa T, Suzuki T, Ito C, Tsunekawa N, Inoue K, Ajima R, Miyasaka T, Yoshida Y, et al. (2004) Oligo-astheno-teratozoospermia in mice lacking Cnot7, a regulator of retinoid X receptor beta. Nat Genet 36:528–533.[CrossRef][Web of Science][Medline]

Oakberg EF. (1956) Duration of spermatogenesis in the mouse and timing of stages of the cycle of the seminiferous epithelium. Am J Anat 99:507–516.[CrossRef][Web of Science][Medline]

Russell LD, Ettlin RA, Sinha Hikim AP, Clegg ED. (1990) Histological and Histopathological Evaluation of the Testis. (Cache River Press, Clearwater, FL).

Sarkar PS, Appukuttan B, Han J, Ito Y, Ai C, Tsai W, Chai Y, Stout JT, Reddy S. (2000) Heterozygous loss of Six5 in mice is sufficient to cause ocular cataracts. Nat Genet 25:110–114.[CrossRef][Web of Science][Medline]

Sarkar PS, Paul S, Han J, Reddy S. (2004) Six5 is required for spermatogenic cell survival and spermiogenesis. Hum Mol Genet 13:1421–1431.[Abstract/Free Full Text]

Schalles U, Shao X, van der Hoorn FA, Oko R. (1998) Developmental expression of the 84-kDa ODF sperm protein: localization to both the cortex and medulla of outer dense fibers and to the connecting piece. Dev Biol 199:250–260.[CrossRef][Web of Science][Medline]

Schultz N, Hamra FK, Garbers DL. (2003) A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc Natl Acad Sci U S A 100:12201–12206.[Abstract/Free Full Text]

Ward JO, Reinholdt LG, Hartford SA, Wilson LA, Munroe RJ, Schimenti KJ, Libby BJ, O’Brien M, Pendola JK, Eppig J, et al. (2003) Toward the genetics of mammalian reproduction: induction and mapping of gametogenesis mutants in mice. Biol Reprod 69:1615–1625.[Abstract/Free Full Text]

Submitted on March 20, 2006; resubmitted on June 13, 2006; resubmitted on July 4, 2006; accepted on July 11, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
ReproductionHome page
P Sipila, J Jalkanen, I T Huhtaniemi, and M Poutanen
Novel epididymal proteins as targets for the development of post-testicular male contraception
Reproduction, March 1, 2009; 137(3): 379 - 389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
22/1/159    most recent
del322v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lessard, C.
Right arrow Articles by Handel, M.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lessard, C.
Right arrow Articles by Handel, M.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?