Hum. Reprod. Advance Access originally published online on November 17, 2006
Human Reproduction 2007 22(3):807-814; doi:10.1093/humrep/del429
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stimulation of embryo hatching and implantation by prostacyclin and peroxisome proliferator-activated receptor 
activation: implication in IVF
1 Department of Obstetrics, Gynecology and Reproductive Services 2 Obstetrical and Gynecological Associates and 3 Vascular Biology Research Center and Division of Hematology, The University of Texas Health Science Center at Houston, Houston, TX, USA
4 Present address: National Health Research Institutes, No. 35, Keyan Road 350 Zhunan Town, Miaoli County Taiwan, R.O.C.
5 To whom correspondence should be addressed at: Department of Obstetrics, Gynecology and Reproductive Services, The University of Texas Health Science Center at Houston, 6431 Fannin, Houston, TX 77030, USA. E-mail: jaou-chen.huang{at}uth.tmc.edu or National Health Research Institutes, No. 35, Keyan Road 350 Zhunan Town, Miaoli County Taiwan, R.O.C. E-mail: kkgo{at}nhri.org.tw
 |
Abstract |
|---|
 Top Abstract IntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
BACKGROUND: Successful IVF depends in part on quality embryos. Recent work suggests that prostaglandin I2 (PGI2 or prostacyclin) promotes the development of embryos in vitro and enhances their implantation potential. The mechanism underlying the effects of PGI2 is unclear. It has been reported that peroxisome proliferator-activated receptor
(PPAR) mediates the effects of PGI2 at the implantation sites. METHODS: The expression of PPAR in the preimplantation embryos was examined by RT–PCR, western blot analysis and immunohistochemistry. Synthetic PPAR ligand (L-165041) and PPAR targeted (PPAR–/–) embryos were used to reveal the roles of PPAR in PGI2-stimulated and spontaneous embryo development. RESULTS: Preimplantation embryos express PPAR, which is essential for the enhancing effect of PGI2 and the spontaneous progression of preimplantation embryos. Enhanced blastocyst hatching by PGI2 (P < 0.05) was abrogated by PPAR deletion. Blastocyst formation and embryo hatching were impaired in PPAR–/– embryos. PPAR deletion significantly reduced embryo cell proliferation (P < 0.01); PPAR activation increased embryo cell proliferation (P < 0.05). PPAR activation enhanced the implantation of wild-type (WT) embryos (P < 0.05); PPAR deletion reduced embryo implantation (P < 0.05). CONCLUSIONS: PPAR is essential for spontaneous and PGI2-stimulated embryo development and blastocyst hatching. The implantation of cultured embryos is enhanced by PPAR activation. PPAR represents a novel therapeutic target to improve IVF outcome.
Key words:
peroxisome proliferator activated receptor /prostacyclin/implantation/IVF/embryo culture
|
Introduction |
|---|
|
TopAbstractIntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
The development of preimplantation embryos in vivo is promoted by a coordinated program involving soluble factors from the oviducts and the uterus (Yeung et al., 1992
). Prostaglandin I2 (PGI2 or prostacyclin), one of the factors produced by the oviducts and the uterus via the cyclooxygenase-2 (COX-2) pathway, plays a crucial role in embryo development and implantation (Lim et al., 1999; Huang et al., 2003; Huang et al., 2004a; Huang et al., 2004b). Compared with the development of in vivo embryos, the development of cultured embryos, such as IVF embryos, is retarded because cultured embryos were deprived of the protective environment of the oviduct (Hardy, 1997). Our recent work showed that supplementing culture media with iloprost, a stable analog of PGI2, enhances mouse blastocyst hatching in vitro (Huang et al., 2003). Furthermore, embryos preconditioned by iloprost show an enhanced potential of implantation and live births when transferred to gestational carriers (Huang et al., 2004b). A source of PGI2, other than the oviducts and uterus, is preimplantation embryos. Blocking the production of endogenous PGI2 by selective COX-2 inhibitors retards embryo hatching (Huang et al., 2004c). Thus, PGI2 is crucial for embryo development in vitro, and its stable analog effectively improves the hatching and implantation of cultured embryos. It remains unclear how PGI2 and its analogs achieve these enhancements.
PGI2 exerts its effects by binding to a G-protein-coupled PGI2 receptor (IP) and/or peroxisome proliferator-activated receptor (PPAR) (Namba et al., 1994; Forman et al., 1997). The inhibition of platelet aggregation and the relaxation of smooth muscle cells by PGI2 are mediated by IP receptors via the 3¢-5¢-cyclic adenosine monophosphate (cAMP)-dependent kinase pathway (Namba et al., 1994). PPAR has been implicated in cell protection by PGI2 (Adderley and Fitzgerald, 1999; Tan et al., 2001; Hao et al., 2002). IP-null mice have increased propensity for thrombosis (Cheng et al., 2002); PPAR-null mice exhibit reproductive defects (Barak et al., 2002; Cheng et al., 2002). In this study, we tested the hypothesis that PGI2 analogues enhance the development and hatching of preimplantation embryos via the PPAR pathway. We obtained PPAR–/– and wild-type (WT) embryos at the 2-cell stage and compared blastocyst formation, embryo hatching and implantation.
|
Material and methods |
|---|
|
TopAbstractIntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
Harvest and culture of mouse embryos
The research protocol was approved by the Animal Welfare Committee of the University of Texas Health Science Center-Houston. Unless specified otherwise, all chemicals were purchased from Sigma (St. Louis, MO, USA). C3H, 129S1/SvImJ and C57BL6/J mice were obtained from the Jackson laboratory (Bar Harbor, ME, USA); ICR mice from Harlan (Indianapolis, IN, USA); PPAR
–/– mice from Dr R. Evans (the Salk Institute, La Jolla, CA, USA). WT PPAR mice were bred by mating 129S1/SvImJ and the offspring of C57BL6/J x 129S1/SvImJ. Mice were kept in a temperature- and humidity-controlled environment (0700 h light on, 1900 h light off) with free access to food and water. Mouse embryos were harvested and cultured as described previously (Huang et al., 2003). Briefly, 3-week-old female mice were induced to super-ovulate with i.p. injection of pregnant mare’s serum gonadotrophin (5 IU) followed by HCG (5 IU) 42–46 h later. After HCG injection, each female mouse was caged with one male mouse of proven fertility. Two-cell embryos were harvested 44–48 h later and cultured (17–20 per group) at 37°C under 5% CO2 in four-well plates (Nalge Nunc International, Naperville, IL, USA) containing 600 µl media. Human tubal fluid (HTF) media (Sage Biopharma, Bedminster, NJ, USA) were used during the first 48 h; 
minimum essential medium (MEM) (Irvine Scientific, Santa Ana, CA, USA), with Earle’s Salts and 2 mM glutamine, was used during the second 48 h. After culture for 96 h, embryos were examined for the presence of zona pellucida. Those completely free of the zona pellucida were considered completely hatched. The rate of complete hatching was calculated by dividing the number of completely hatched embryos by the number of total embryos. Complete embryo hatching was used as an end-point because it is the last developmental stage before implantation and correlates with implantation and viable pregnancy (Huang et al., 2003; Huang et al., 2004b). Where indicated, control embryos received the same concentration of vehicle [dimethylsulphoxide (DMSO), 1:10 000].
RNA extraction, RT–PCR and restriction enzyme digestion analysis
Total RNA was extracted from 20 blastocysts using a commercial kit (RNeasy; Qiagen, Chatsworth, CA, USA) and used for RT–PCR. The primers were selected based on mouse PPAR sequence from the gene bank (NM_011145
[GenBank]
). A BLAST analysis showed there was no published mouse sequence that shared homology with the sequence of the 334-bp amplicon. RT was carried out at 42°C for 30 min using a primer (5' TTCTAGAGCCCGCAGAATGG 3') based on the nucleotide sequence from exon 6. The upstream (5' GCCAAGAACATCCCCAACTTC 3') and downstream (5' CCTGGATGGCTTCTAC CTGG 3') primers were based on sequences from exons 5 and 6, respectively. The PCR consisted of 45 cycles of 94°C for 15 sec, 60°C for 1 min and 72°C for 1 min, and concluded with a 7-min extension at 72°C. PCRs were electrophoresed on an agarose gel. The amplicon was excised, eluted with QIAEX II Gel Extraction Kit (Qiagen) and digested by the restriction enzyme SST1 (Invitrogen, Carlsbad, CA, USA). The PCR products and the digested DNA (expected to yield two fragments, 95 and 239 bp) were separated by a 3% agarose gel and visualized with UV light.
Western blot analysis
Western blot analysis was performed as described previously (Huang et al., 2004c), using an affinity purified, polyclonal antibody (Abcam Inc, Cambridge, MA, USA) against a mouse PPAR peptide (MEQPQEETPEAREE). The cell lysate of blastocysts was prepared as follows. Twenty-five mouse blastocysts in 2 µl of media were transferred to 1.5-ml Eppendorf tubes containing 30 µl of lysis buffer (150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM sodium orthovanadate, 1mM EGTA and 1 mM sodium fluoride) and protease inhibitors [1 mM 4-(2-aminoethyl) benzene sulfonyl fluoride hydrochloride, 0.8 µM aprotinin, 50 µM betastatin, 15 µM E-64, 20 µM leupeptin hemisulfate and 10 µM pepstatin A; Calbiochem-Novabiochem Corp, San Diego, CA, USA]. The mixture was vortexed for 5 s, centrifuged for 10 s and stirred on ice for another 30 min, followed by two 1-s bursts of sonication (Branson Co, Danbury, CT, USA). After mixing with 4x protein loading dye, the supernatant was used for western blot analysis. The lysate was electrophoresed on a 12% gradient acrylamide gel and transferred to a nitrocellulose membrane (Schleicher & Schuell, Inc, Keene, NH, USA). The PPAR protein bound by the antibody was visualized using enhanced chemi-fluorescence (GE Healthcare Bio-Sciences Corp, Piscataway, NJ, USA), whose signals were detected by a STORM 860 laser scanner (GE Healthcare Bio-Sciences Corp). Total cell lysate from mouse testes was used as a positive control.
Immunohistochemistry
The immunohistochemistry was performed as described previously (Huang et al., 2004c). In brief, embryos were fixed in ice-cold phosphate-buffered saline (PBS) containing 4% buffered paraformaldehyde for 30 min. After permeabilization with 1% triton X-100 in PBS for 20 min, the embryos were incubated at 37°C with anti-PPAR antibody (32 µg/ml) in PBS containing 5% milk for 30 min. The embryos were then incubated at 37°C in goat anti-rabbit immunoglobulin (Ig) G antibody conjugated with fluorescein isothiocyanate (FITC) (2.5 µg/ml, Invitrogen) for 30 min. Between incubations, embryos underwent four 5-min washes in PBS. After a final 5-min incubation in Hoechst 33258 (30 µg/ml) at room temperature, the embryos were mounted and examined under FITC and UV filters. Unfertilized eggs and embryos from various developmental stages (from one-cell embryos to blastocyst-stage embryos) were examined.
5 -Bromo-2'-deoxy-uridine uptake
The proliferation of embryonic cells was determined based on their abilities to incorporate 5-Bromo-2'-deoxy-uridine (BrdU). The assay was performed using BrdU Labeling and Detection Kit I (Roche Applied Science, Indianapolis, IN, USA) according to manufacturer’s protocols with modifications. In brief, embryos were incubated in 100 µl pre-equilibrated HTF media containing 10 µM BrdU for 6 min at 37°C under 5% CO2, fixed in ice-cold glycine (50 mM) in 70% ethanol (pH 2.0) at –20°C for 30 min and incubated at 37°C for 30 min with diluted anti-BrdU mouse monoclonal antibody (1:2) buffer containing 1% bovine serum albumin (BSA). Embryos were washed in 200 µl PBS containing 1% BSA and incubated at 37°C for 30 min with diluted FITC-conjugated anti-rabbit IgG antibody (1:4) in PBS containing 1% BSA. After washing, embryos were treated with Hoechst 33258 (30 µg/ml) for 5 min at 25°C and mounted in 0.1 M Tris–HCl (pH 8.5) containing 16.6% elvanol 50–42 (DuPont, Wilmington, DE, USA) and 2.5% 1,4-diazabicyclo-(2.2.2)-octane. Cells that incorporated BrdU were identified under a FITC filter (AxioPlan 2, Zeiss, Oberkochen, Germany). Total cell number was determined based on Hoechst 33258 nuclear staining under a UV filter.
Embryo transfer and determination of implantation rate
Embryo transfer was performed as described previously (Huang et al., 2004b). Briefly, embryos were transferred to gestational carriers (ICR female mice) on day 2.5 of pseudopregnancy under a dissecting microscope (Olympus SZ-PT, Shinjuku-ku, Tokyo, Japan). After anaesthesia, each uterine horn was accessed via a 1.5-cm flank incision. With the proximal oviduct held by a pair of forceps, an opening was created at the distal end of the uterine horn on the anti-mesenteric side with a 30-gauge needle. The opening permitted the entry of the transfer pipette which had an inner diameter of 135 µm (MidAtlantic Diagnostics, Inc, Mount Laurel, NJ, USA). Up to seven embryos in 1.5-µl transfer medium (MEM with 25 mM HEPES and 1% BSA) were transferred to each horn. After each transfer, the contents of the pipette were examined under a stereomicroscope to identify retained embryos. To avoid the mixing of embryos as a result of embryo crossover (Dr Andreas Zimmer, University of Bonn, Germany, MGI-List, the Jackson Laboratory), each gestational carrier received only one kind of embryo. To maintain consistent transfer techniques, the embryo transfer was performed following the same protocol and by one individual (J.-C.H.). Seventy-two hours after embryo transfer, the rates of implantation were determined based on a previously described method with modifications (Paria et al., 1993). Briefly, 3 min before euthanasia, 0.1 ml of Chicago blue (1%) was injected via the tail vein of the gestational carrier. After the carrier was sacrificed, the uterine horns were opened and the gestation sacs counted. The implantation rate was expressed as percentages of gestation sacs over total embryos transferred. Ninety-seven WT and fifty-four PPAR–/– embryos were transferred to seven and four gestational carriers, respectively.
Statistical analysis
Prism® Version 3.0 (GraphPad Software Inc, San Diego, CA, USA), with the Hill slope set at 1.0, was used to estimate the ED50 of L-165041. Chi-square and Student’s t-tests were used where appropriate (InStat® Version 3.05, GraphPad Software Inc). A P < 0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
Essential role of PPAR
in preimplantation embryo development in vitroBlastocyst-stage embryos expressed PPAR
mRNA and protein as determined by RT–PCR and western blots, respectively (Figure 1a and b). PPAR was detected in 
8-cell-stage WT embryos but was not detected in PPAR–/– embryos (Figure 1c upper versus lower panels). To evaluate the role of PPAR in embryo development, we compared blastocyst hatching between PPAR+/+ and PPAR–/– embryos. Two-cell-stage embryos prepared from PPAR WT and null mice were cultured in vitro for 96 h. Completely hatched embryos were counted. Thirty percent (20/67) of the PPAR+/+ embryos had hatched completely at 96 h compared with 3% (4/144) of PPAR–/– embryos (Figure 2). Iloprost (0.1 µM) increased the number of completely hatched embryos to 50% (37/74) in WT but had no effect on PPAR–/– embryos (3/144). L-165041, a specific PPAR ligand (Berger et al., 1999), increased the proportion of completely hatched WT embryos to 58%, as compared with 30% in untreated WT embryos. Neither iloprost nor L-165041 affected the hatching of PPAR–/– embryos. Combined iloprost and L-165041 treatment increased hatched WT embryos to 62%, an enhancement which is not significantly greater than that of either ligand alone. These results suggest that iloprost and L-165041 act via PPAR. Experiments were then performed to determine the role of PPAR in embryo development. Two-cell embryos from WT and PPAR–/– mice were cultured in media without PPAR ligands for 96 h. At 48, 72 and 96 h, blastocyst-, morula- and earlier-stage embryos (designated as < morula) were counted. PPAR–/– embryos developed significantly more slowly than WT embryos at each time point (Table I). At 96 h, 29% of the PPAR–/– embryos remained at < morula stages and 28% were hatching or hatched, whereas all WT embryos had reached the blastocyst stage and 85% underwent hatching or had completely hatched. It is worth mentioning that preliminary experiments showed that extending the culture to 120 h did not change the percentages of completely hatched embryos in either group (not shown). Taken together, these data indicate that PPAR is fundamental to embryo development and hatching in vitro. To test the hypothesis that the impaired hatching of PPAR–/– embryos is a result of decreased cell proliferation, we compared the BrdU uptake by WT and PPAR–/– embryos. The number of BrdU-positive cells was greatly reduced in PPAR–/– embryos (Figure 3a). Cell numbers per embryo were also markedly reduced in PPAR–/– embryos (Figure 3b).
|
|
|
|
Stimulation of embryo hatching by PPAR
ligandsIloprost and L-165041 increased WT embryo hatching to a similar extent (Figure 2). Their stimulatory effects were abrogated by PPAR
deletion (Figure 2). L-165041 increased the percentage of hatched embryos in a concentration-dependent manner with an ED50 value of 21 nM (Figure 4a). Neither Wy14,643, a PPAR ligand, nor ciglitazone, a PPAR
agonist, stimulated embryo hatching (Figure 4b). L-165041 was effective in stimulating embryo hatching when it was added to embryos at 2-cell, 8-cell or morula stage (Figure 4c). Once a majority of embryos reached the blastocyst stage, the addition of L-165041 to the cultured medium was no longer effective in stimulating hatching (Figure 4c). L-165041 (10 µM) increased the percentages of BrdU-positive cells over the untreated control (Figure 4d). Taken together, these results indicate that exogenous PPAR ligands such as L-165041 and iloprost accelerate hatching by stimulating the cell proliferation in embryos.
|
Regulation of embryo implantation by PPAR
To determine the extent to which PPAR
is involved in implantation, 2-cell embryos obtained from WT and PPAR–/– mice were cultured for 48 h, enumerated and transferred to receptive uteri of gestational carriers. Gestation sacs were counted 72 h later. Numbers of early and late blastocysts developed from 2-cell-stage PPAR–/– embryos were significantly lower than those developed from WT embryos (Figure 5a). The implantation rate for PPAR–/– embryos was also significantly lower than that for WT embryos (28 versus 44%, P < 0.05) (Figure 5b). We next determined the extent to which pretreatment of 2-cell embryos with L-165041 influences implantation rate. Two-cell embryos from WT mice were treated with L-165041 for 48 h. Embryos were enumerated and transferred to gestational carriers. Implantation rate was evaluated 72 h later. Although L-165041 did not significantly enhance blastocyst formation (Figure 5c), it significantly increased the implantation rate (64 versus 41%, P < 0.05) (Figure 5d). These results indicate that embryo PPAR plays an important role in implantation. Exogenous PPAR ligands promote implantation without altering blastocyst formation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
Our study suggests that embryo development and hatching requires PPAR
. Two-cell embryos from PPAR–/– mice are capable of developing into blastocysts, but the rate of blastocyst formation lags behind that of WT embryos. PPAR is especially fundamental to blastocyst hatching. Compared with WT embryos, a significant number of two-cell PPAR–/– embryos failed to hatch after 96 h in culture. It is worth mentioning that extending the culture duration to 120 h did not change the outcome as the majority of the blastocysts collapsed during this period. It has been proposed that embryo hatching is mediated by two major factors: (i) a crucial cell number increase in embryos (Montag et al., 2000), which results in thinning of zona pellucida, and (ii) the digestion of zona by proteolytic enzymes (Sawada et al., 1990). Our results reveal that PPAR mediates the proliferation of embryonic cells and thereby increases embryonic cell mass. Compared with WT embryos, PPAR–/– embryos exhibit very low BrdU incorporation. The cell numbers of PPAR–/– embryos were only about 30% of those of WT embryos after 72 h in culture.
PPAR is a nuclear receptor which binds a number of endogenous and synthetic ligands (Forman et al., 1997). Our previous study suggests that COX-2-derived PGI2 in embryos may be an endogenous PPAR ligand (Huang et al., 2004c). Ligand-activated PPAR forms a heterodimer with retinoid X receptor which binds PPAR response elements and activates gene transcription (Kliewer et al., 1994). A number of PPAR-mediated genes have been reported, and two of these genes, 14-3-3
and phosphoinositide-dependent kinase-1 (PDK-1), are involved in protecting cells from apoptosis (Di-Poi et al., 2002; Liou et al., 2006). However, the mechanism by which PPAR promotes embryo cell proliferation is unknown. It was reported that over-expression of PPAR in the vascular smooth muscle cells increases post-confluent cell proliferation by increasing cyclin A and cyclin-dependent kinase 2 as well as decreasing p57kip2 (Zhang et al., 2002). It is possible that PPAR-mediated 14-3-3 up-regulation is involved in cell proliferation, because 14-3-3 proteins are considered to be scaffolds for a large number of proteins, including signalling molecules and receptors (Fu et al., 2000; Tzivion and Avruch, 2002). Work is in progress to address this possibility. PPAR may also play an important role in protecting embryo cells from apoptosis via 14-3-3 (Liou et al., 2006) and PDK-1 (Di-Poi et al., 2002). It was reported that the inner cell mass (ICM) of blastocytes in culture is vulnerable to oxidative apoptosis (Brison and Schultz, 1997; Schratt et al., 2004). PGI2-activated PPAR may protect ICM from apoptosis by up-regulating 14-3-3, which sequesters Bad phosphorylated via the PDK-1 and Akt pathway (Zha et al., 1996; Datta et al., 1997). The anti-apoptotic function of PPAR may contribute to increased cell numbers in blastocysts and enhanced hatching.
It has been reported that COX-2-derived PGI2 in the uterus is involved in embryo implantation, and PPAR has been implicated for the action of PGI2 (Lim et al., 1999). The role of the embryo PPAR in implantation has not been reported. Results from the present study provide direct evidence for a crucial role of embryo PPAR in implantation. To mimic IVF procedures, we cultured WT and PPAR–/– 2-cell embryos in vitro for 48 h. Embryos at various stages of development were counted and transferred to receptive gestational carriers. Gestation sacs in the uterus were counted 72 h later. The number of gestation sacs from PPAR–/– embryos was significantly less than that from WT embryos. Reduced implantation of PPAR–/– embryos is correlated with the retarded embryo development and blastocyst formation of PPAR–/– embryos. These results underscore the importance of PPAR-mediated, enhanced cell proliferation in promoting the growth, maturation (hatching) and implantation of preimplantation embryos.
A major goal of our studies is to improve IVF. We have previously reported that iloprost, a stable PGI2 analogue, enhances embryo implantation and the potential of live birth (Huang et al., 2004b). In the present study, we confirmed the previous data and shed light on the mechanism by which exogenous iloprost enhances embryo hatching and implantation. Our results show that PPAR is the target of PGI2 in the preimplantation embryos. Enhanced blastocyst hatching by iloprost was completely abrogated in PPAR–/– embryos. A synthetic PPAR ligand, L-165041, exerted an effect similar to that of iloprost, but a combination of iloprost with L-165041 did not have additional effects. These results further suggest that endogenous PGI2 production in cultured embryos is limited and that exogenous PGI2 analogue or synthetic PPAR ligand can further activate PPAR. PPAR activation by synthetic ligand or PGI2 analogue (iloprost) promotes further cell proliferation resulting in a higher hatching rate. It is worth noting that the effect of L-165041 is not limited to 2-cell-stage embryos. L-165041 was quite effective in enhancing embryo hatching even in morula-stage embryos. However, L-165041 did not appear to be effective in blastocyst-stage embryos. The afore-mentioned result is probably because some blastocysts had advanced development and were ready to hatch. This observation is of practical importance with respect to the timing of supplementing media with iloprost or PPAR ligands. Naturally, the application of PPAR ligands in human IVF requires a thorough investigation of its safety profiles.
L-165041 appears to enhance embryo implantation by a mechanism independent of its effect on blastocyst formation, because the developmental stages of control and experimental embryos at the time of embryos transfer were similar, yet transferred experimental embryos resulted in more gestation sacs. The molecular basis for the delayed action is unclear. We speculate that L-165041 induces a sustained signalling activation via PPAR to enhance implantation. These sustained effects may include (i) continued enhancement of embryo development after embryos were transferred and/or (ii) enhanced ability of embryos to communicate with the maternal interface (i.e. cross-talk between the transcriptional signallings of uterine and embryo PPAR, as the embryos float in the uterine cavity and interact with the endometrium before implantation). The coordination between embryo development and endometrial decidualization ensures a successful implantation. Elucidation of the molecular mechanism(s) will have major impacts on our understanding of embryo implantation and the potential to improve IVF success.
In summary, preimplantation embryos express PPAR, which plays an essential role in embryo development, blastocyst formation, embryo hatching and implantation. Activation of embryo PPAR is a novel therapeutic strategy to improve the outcome of IVF.
|
References |
|---|
|
TopAbstractIntroductionMaterial and methodsRESULTSDiscussionReferences |
|---|
Adderley SR and Fitzgerald DJ. (1999) Oxidative damage of cardiomyocytes is limited by extracellular regulated kinases 1/2-mediated induction of cyclooxygenase-2. J Biol Chem 274:5038–5046.
Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM, Boland R, Evans RM. (2002) Effects of peroxisome proliferator-activated receptor delta on placentation, adiposity, and colorectal cancer. Proc Natl Acad Sci USA 99:303–308.
Brison DR and Schultz RM. (1997) Apoptosis during mouse blastocyst formation: evidence for a role for survival factors including transforming growth factor alpha. Biol Reprod 56:1088–1096.[Abstract]
Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, et al. (1999) Novel peroxisome proliferator-activated receptor (PPAR) gamma and PPARdelta ligands produce distinct biological effects. J Biol Chem 274:6718–6725.
Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA, FitzGerald GA. (2002) Role of prostacyclin in the cardiovascular response to thromboxane A2. Science 296:539–541.
Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231–241.[CrossRef][Web of Science][Medline]
Di-Poi N, Tan NS, Michalik L, Wahli W, Desvergne B. (2002) Antiapoptotic role of PPARbeta in keratinocytes via transcriptional control of the Akt1 signaling pathway. Mol Cell 10:721–733.[CrossRef][Web of Science][Medline]
Forman BM, Chen J, Evans RM. (1997) Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci USA 94:4312–4317.
Fu H, Subramanian RR, Masters SC. (2000) 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol 40:617–647.
Hao CM, Redha R, Morrow J, Breyer MD. (2002) Peroxisome proliferator-activated receptor delta activation promotes cell survival following hypertonic stress. J Biol Chem 277:21341–21345.
Hardy K. (1997) Cell death in the mammalian blastocyst. Mol Hum Reprod 3:919–925.
Huang JC, Wun W-SA, Goldsby JS, Wun IC, Falconi SM, Wu KK. (2003) Prostacyclin enhances embryo hatching but not sperm motility. Hum Reprod 18:2582–2589.
Huang JC, Goldsby JS, Arbab F, Melhem Z, Aleksic N, Wu KK. (2004a) Oviduct prostacyclin functions as a paracrine factor to augment the development of embryos. Hum Reprod 19:2907–2912.
Huang JC, Goldsby JS, Wun W-SA. (2004b) Prostacyclin enhances the implantation and live birth potentials of mouse embryos. Hum Reprod 19:1856–1860.
Huang JC, Wun WS, Goldsby JS, Matijevic-Aleksic N, Wu KK. (2004c) Cyclooxygenase-2-derived endogenous prostacyclin enhances mouse embryo hatching. Hum Reprod 19:2900–2906.
Kliewer S, Forman B, Blumberg B, Ong E, Borgmeyer U, Mangelsdorf D, Umesono K, Evans R. (1994) Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 91:7355–7359.
Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, DuBois RN, Trzaskos JM, Dey SK. (1999) Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta. Genes Dev 13:1561–1574.
Liou JY, Lee S, Ghelani D, Matijevic-Aleksic N, Wu KK. (2006) Protection of endothelial survival by peroxisome proliferator-activated receptor-delta mediated 14-3-3 upregulation. Arterioscler Thromb Vasc Biol 26:1481–1487 [Epub 27 April 2006].
Montag M, Koll B, Holmes P, van der Ven H. (2000) Significance of the number of embryonic cells and the state of the zona pellucida for hatching of mouse blastocysts in vitro versus in vivo. Biol Reprod 62:1738–1744.
Namba T, Oida H, Sugimoto Y, Kakizuka A, Negishi M, Ichikawa A, Narumiya S. (1994) cDNA cloning of a mouse prostacyclin receptor. Multiple signaling pathways and expression in thymic medulla. J Biol Chem 269:9986–9992.
Paria BC, Huet-Hudson YM, Dey SK. (1993) Blastocyst’s state of activity determines the "window" of implantation in the receptive mouse uterus. Proc Natl Acad Sci USA 90:10159–10162.
Sawada H, Yamazaki K, Hoshi M. (1990) Trypsin-like hatching protease from mouse embryos: evidence for the presence in culture medium and its enzymatic properties. J Exp Zool 254:83–87.[CrossRef][Web of Science][Medline]
Schratt G, Philippar U, Hockemeyer D, Schwarz H, Alberti S, Nordheim A. (2004) SRF regulates Bcl-2 expression and promotes cell survival during murine embryonic development. EMBO J 23:1834–1844 [Epub 1 April 2004].[CrossRef][Web of Science][Medline]
Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, Fluhmann B, Desvergne B, Wahli W. (2001) Critical roles of PPAR beta/delta in keratinocyte response to inflammation. Genes Dev 15:3263–3277.
Tzivion G and Avruch J. (2002) 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J Biol Chem 277 14:3061–3064 [Epub 14 November 2001].
Yeung WS, Ho PC, Lau EY, Chan ST. (1992) Improved development of human embryos in vitro by a human oviductal cell co-culture system. Hum Reprod 7:1144–1149.
Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. (1996) Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell 87:619–628.[CrossRef][Web of Science][Medline]
Zhang J, Fu M, Zhu X, Xiao Y, Mou Y, Zheng H, Akinbami MA, Wang Q, Chen YE. (2002) Peroxisome proliferator-activated receptor delta is up-regulated during vascular lesion formation and promotes post-confluent cell proliferation in vascular smooth muscle cells. J Biol Chem 277:11505–11512.
Submitted on July 24, 2006; resubmitted on September 26, 2006; accepted on October 5, 2006.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J.-C. Huang, W.-S. A. Wun, J. S. Goldsby, K. Egan, G. A. FitzGerald, and K. K. Wu Prostacyclin receptor signaling and early embryo development in the mouse Hum. Reprod., November 1, 2007; 22(11): 2851 - 2856. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||