Hum. Reprod. Advance Access originally published online on April 20, 2007
Human Reproduction 2007 22(6):1681-1686; doi:10.1093/humrep/dem070
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Low mitochondrial DNA and ATP contents contribute to the absence of birefringent spindle imaged with PolScope in in vitro matured human oocytes
1 Centre for reproductive medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou 510080, P.R. China 2 Department of Obstetrics and Gynecology, University of Hong Kong, Hong Kong, Special Administrative Region, P.R. China 3 IVF Program, Stanford University Medical Center, Palo Alto, CA 94304, USA
4 Correspondence address. Centre for reproductive medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou 510080, P.R. China. E-mail: lxyzy{at}yahoo.com
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
BACKGROUND: Birefrigent meiotic spindle in live human oocytes can be visualized by the PolScope. This study investigated the relationship between birefrigent meiotic spindle and cytoplasmic mitochondrial DNA (mtDNA) and ATP contents in in vitro matured human oocytes.
METHODS: Oocytes at germinal vesicle stage were collected and cultured for 24–48 h with or without the metabolic inhibitor, carbonyl cyanide p-(tri-fluromethoxy) phenyl-hydrazone (FCCP). All in vitro matured oocytes were examined by PolScope for the presence of meiotic spindle, then the oocytes were used for either intracytoplasmic sperm injection or the measurement of mitochondrial quantity and ATP content.
RESULTS: Meiotic spindles were observed in 51.3% (60/117) of the in vitro matured oocytes. Oocytes with detectable meiotic spindle contained significantly higher mtDNA copies (637 250 ± 237 606 versus 491 454 ± 153 406, P = 0.027) and ATP content (1.97 ± 0.38 versus 1.65 ± 0.32 pmol, P = 0.028) when compared with those without detectable meiotic spindle. However, in vitro matured oocytes showed a significantly reduced rate of positive meiotic spindle and a lower ATP content when cultured with FCCP. A lower incidence of normal fertilization and good quality embryos were observed if meiotic spindles were not detected.
CONCLUSIONS: Low mtDNA and ATP content might contribute to the absence of birefringent spindle imaged with the PolScope in human in vitro matured oocytes.
Key words: mitochondria/spindle/oocyte/PolScope/embryo development
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
The bipolar barrel-shaped microtubule spindle plays a key role in accurate chromosome segregation and chromosomal movement during meiosis. The integrity of the meiotic spindle is involved in various functions that are essential for fertilization and early post-fertilization events (Edwards and Beard, 1997
; Payne et al., 1997; Van Blerkom et al., 2004). Conventional methods of imaging the spindle used previously (e.g. fluorescence-labelled techniques) are invasive and not compatible with clinical use. Currently, a de novo orientation- independent polarized light microscope, termed PolScope, reveals the imaging of the oocyte spindle non-invasively according to the molecular order of its microtubules (Oldenbourg and Mei, 1995; Oldenbourg, 1999; Liu et al., 2000). Analysis of the meiotic spindle in live oocytes with the PolScope system produces new information about human oocyte quality and functionality (Wang et al., 2001a,b,c; Cooke et al., 2003; Moon et al., 2003; Rienzi et al., 2003; Cohen et al., 2004; De Santis et al., 2005). Several reports have shown a positive relationship between the presence of a visible spindle and oocyte developmental competence after intracytoplasmic sperm injection (ICSI) (Wang et al., 2001b,c; Cooke et al., 2003; Moon et al., 2003; Rienzi et al., 2003; Cohen et al., 2004).
The intrinsic quality is the key factor determining the developmental competence of an oocyte (Trounson et al., 2001; Rizos et al., 2002). Mitochondria are the major source of energy in eukaryotic cells, producing ATP through oxidative phosphorylation and the citric acid cycle. They play important roles in oocytes maturation, fertilization and subsequent embryo development (Reynier et al., 2001; Cummins, 2002). Energy in the form of ATP is critical for nuclear and cytoplasmic maturation events. Spindle formation and chromosome behaviour depend on the expression and activity of motor proteins, which use ATP as their energy source. Once the oocyte resumes maturation, mitochondria cluster around the spindle and in the peripheral cytoplasm to provide ATP for cytoskeletal and cytoplasmic organization (Eichenlaub-Ritter et al., 2004). The number of mitochondria expands from only 10 at the primordial follicle stage to around 500 000 in mature human oocytes (Cummins, 2002). High incidences of mitochondrial DNA (mtDNA) deletions and low mtDNA content in oocytes are related to subsequent poor developmental ability of their embryos (Cummins, 2002; Chan et al., 2005; Santos et al., 2006).
The difficulty in acquiring human oocytes for research has hindered the development of reproductive technology. A valuable source of oocytes for research purposes is the germinal vesicle (GV) stage oocyte, retrieved from small antral follicles after controlled ovarian stimulation (Rao and Tan, 2005). About 8–10% of the retrieved oocytes are found at the GV stage (Cha and Chian, 1998; Kim et al., 2000; Chian and Tan, 2002). These immature oocytes are able to resume meiosis and complete maturation in vitro and become available for microinjection (Kim et al., 2000; Chian and Tan, 2002). Therefore, the present study was designed to image meiotic spindles with the PolScope in in vitro matured oocytes to investigate its relationship with the mtDNA and ATP content.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
Ovarian stimulation and laboratory procedures
This study was approved by the Ethical Committee of the First Affiliated Hospital, Sun Yat-sen University. Immature oocytes and sperm were donated by couples after signed informed consent. Sperm used in ICSI for those in vitro matured oocytes were from the same sample as that used for their sibling in vivo matured oocytes.
Ovarian superovulation was induced by Diphereline (Ipsen, France) and Gonal-F (Serono, Switzerland) in either a long- or a short-treatment protocol. When two follicles reached 18 mm in diameter, 10 000 IU of Profasi (Serono) was administered. Ultrasound-guided transvaginal oocyte retrieval was performed 36–38 h after hCG injection. The aspirated cumulus–oocyte complexes (COCs) were collected in HTF medium with 5% human serum albumin (HSA) (SAGE, USA) prior to the removal of cumulus cells with 80 IU/ml hyaluronidase in HEPES buffered media (SAGE). Meiotic stages of denuded oocytes were classified as metaphase II (MII), metaphase I (MI) and GV stage according to the presence or absence of the GV and first polar body. The MII oocytes were used for ICSI and GV stage oocytes were cultured for in vitro maturation.
Oocyte maturational status was evaluated after 24 h culture in HTF medium with 5% HSA, and the remaining immature oocytes were cultured for an additional 24 h. Oocytes that reached MII stage during the 48-h culture period was used for meiotic spindle visualization by SpindleView and LC-PolScope (Cambridge Research & Instrumentation Inc., MA, USA). Matured oocytes were either used for ICSI or measurement of mitochondria quantity and ATP content. In the case of ICSI, oocytes were assessed for pronuclear formation 18–20 h after sperm injection. Normal fertilization was confirmed by observing the presence of two pronuclei and two polar bodies. Embryo quality was evaluated 72 h after ICSI according to a cumulative embryo classification scheme as described previously (Rienzi et al., 2002). The resulting embryos and unfertilized oocytes were subject to the measurement of mitochondrial quantity.
A total of 23 unfertilized in vivo matured oocytes, which contained the first polar body and did not exhibit the second polar body and any pronuclear development at 16–20 h after insemination in conventional in vitro fertilization cycles with a fertilization rate under 50%, were collected as a control group in this study. To ensure uniformity of laboratory conditions and to eliminate the possibility of contamination by sperm mtDNA, the zona pellucida of the oocyte was removed using acidified Tynode's solution before the detection of mitochondria quantity.
Treatment with metabolic inhibitor
To determine the effect of mitochondrial metabolism on the formation of meiotic spindle, some oocytes were treated with carbonyl cyanide p-(tri-fluromethoxy)phenyl-hydrazone (FCCP), a potent uncoupler of oxidative phosphorylation in mitochondria (Heytler, 1979). For this purpose, denuded oocytes at the GV stage were cultured in HTF medium with 10 nmol/l FCCP for a total of 48 h. Oocytes were assessed for their meiotic stage at 24 and 48 h of culture. Spindle observation and measurement of ATP content were then performed for those mature oocytes.
Measurement of net cytoplasmic ATP content
Single oocyte was loaded in PCR tubes with 50 µl ultrapure water, and the samples were then stored at –80°C until measurement of ATP content. The measurement was performed using a Berthold Lumat LB 9501 luminometer (Berthold Technologies, Bad Wildbad, Germany) and a commercial assay kit based on the luciferin–luciferase reaction (Bioluminescent Somatic Cell Assay Kit, Sigma) following the method described previously (Van Blerkom et al., 1995) and the manufacturer's recommendations. A standard curve containing 11 ATP concentrations from 10 fmol to 10 pmol was generated for each series of analyses. The ATP content was calculated using the formula derived from the linear regression of the standard curve.
DNA extraction and real-time quantitative PCR
The mtDNA extraction and the real-time quantitative PCR (qPCR) procedure for quantity of mtDNA content have been described elsewhere (Chan et al., 2005). Briefly, the collected single oocyte or embryo was loaded in a PCR tube with 10 µl lysis buffer (50 mM Tris–HCl, pH 8.5, 0.1 mM EDTA, 0.5% Tween-20, 200 µg/ml proteinase K) and the PCR tube was incubated at 55°C for 2 h. Proteinase K was heat inactivated at 95°C for 10 min, and the samples were then stored at – 80°C until later detection of mtDNA quantity.
Real-time qPCR was performed using the iCycler iQ Real Time Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Briefly, 2 µl of DNA sample was added to a final 10 µl reaction mixture containing 1 x PCR buffer, 5 mM magnesium chloride, 0.2 mM of dNTP, 5 pmol of each primer (Mt L3211: CCACCCAAGAACAGGGTTTG; Mt H3319:TGGCCATGGGTATGTTGTTA), 1 pmol of dually labelled (5'' Fam and 3'' Tamra) TaqMan probe (Mt P3234: TTACCGGGCTCTGCCATCT) and 0.5 U Taq polymerase. The following quantification cycling protocol was used: 95°C for 4 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 50°C for 15 s and elongation at 72°C for 15 s. The measurement of mtDNA copy number was performed in duplicates for each sample in separate qPCR runs. Recombinant plasmid containing mtDNA fragment [nucleotide position from 3182 to 4216, spanning from 16S rRNA, tRNA (Leu) and ND1 genes coding region] was used as standard DNA. The interrun coefficient of variations of standard DNA in seven separate runs were less than 5%, which indicated an acceptable degree of precision (Wang et al., 2005).
Statistical analysis
The chi-square test was used to compare oocyte maturation, fertilization and embryonic development rates. The non-parametric Mann–Whitney U-test was used to compare the mtDNA or ATP in oocytes and embryos. A P-value of < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
A total of 155 GV stage oocytes were collected and cultured, and 117 oocytes extruded the first polar body after 48 h culture, giving a maturation rate of 75.5%. Meiotic spindles (Fig. 1) were detected in 51.3% (60/117) of in vitro matured oocytes, among which 44 were matured during the first 24 h of culture and 16 were matured during the second 24 h period. A significantly higher rate of spindle detection was obtained for oocytes matured during the first 24 h culture (65.7%, 44/67) than oocytes matured during the second 24 h period (33.3%, 16/50) (P < 0.01).
|
As shown in Figure 2, in vivo matured oocytes failing to fertilize in conventional IVF contained higher mtDNA copies (715 708 ± 254 492) than in vitro matured oocytes (526 309 ± 209 099) (P < 0.05). Similarly, in vitro matured oocytes possessed significantly higher mtDNA copies and more ATP (1.82 ± 0.39 pmol) than oocytes failing to mature in vitro (398 441 ± 159 610 and 1.33 ± 0.34 pmol, respectively) (Figs 2 and 3).
|
|
In vitro matured oocytes with detectable meiotic spindle contained significantly higher ATP and mtDNA content when compared with those in vitro matured oocytes without detectable meiotic spindle (Table 1). A lower incidence of normal fertilization and good quality embryos occurred if spindles were not detected (Table 1). In addition, the mtDNA content was significantly lower in in vitro matured oocytes that failed to be fertilized after ICSI (426 404 ± 205 454) compared with fair (592 393 ± 190 819) and good quality embryos (693 350 ± 180 457) (Fig. 4). Although a statistical difference could not be demonstrated (P = 0.22) due to the small samples size of embryos included in this study, a higher mtDNA content was observed for good quality embryos than fair quality embryos.
|
|
As shown in Table 2, a significantly reduced rate of maturation was observed for GV oocytes cultured with FCCP when compared with those without FCCP treatment (P < 0.001). When comparing the timing of maturation, lower proportions of oocytes were observed to mature during the first 24 h culture with FCCP treatment (P < 0.05). Meiotic spindles were detected in only 23.1% (6/26) of in vitro matured oocytes cultured with FCCP, which is significantly lower than that (51.3%) of in vitro matured oocytes without FCCP treatment. In addition, the ATP content in the matured oocyte was also significantly lower when FCCP had been used. When cultured with FCCP, those in vitro matured oocytes which did show a detectable meiotic spindle (n = 6) contained significantly more ATP content (1.79 ± 0.28 pmol) than those in vitro matured oocytes without detectable meiotic spindle (n = 20) (1.56 ± 0.32 pmol), but the observed difference did not reach statistical significance due to small number of oocytes (P = 0.15). Oocytes failing to mature had significantly lowest ATP content (1.00 ± 0.36 pmol, P < 0.01).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
In this study, the PolScope was applied to in vitro matured oocytes to assess the presence of the meiotic spindle. A birefrigent meiotic spindle was detected in 51.3% of the in vitro matured oocytes, which is lower than the rates obtained from in vivo matured oocytes (Wang et al., 2001b
,c; Konc et al., 2004). Regulation of spindle formation, as well as progression of meiotic maturation, necessitates the interaction of mitochondria and the activity of microtubule motor protein. Mitochondria translocate to the perinuclear region during formation of the first metaphase spindle and subsequently disperse during extrusion of the first polar body (Van Blerkom and Runner, 1984; Wilding et al., 2001). If the oocyte lacks enough active mitochondria, spindle formation, checkpoint control and chromosome cohesion could be compromised (Eichenlau-Ritter et al., 2004).
Unlike somatic cells, each mitochondrion in the oocyte has only a single copy of mtDNA (Piko and Taylor, 1987). Therefore, the number of mtDNA copy represents the number of mitochondria in the oocyte. Our results showed that the in vitro matured oocytes with detectable meiotic spindles contained significantly higher mtDNA and ATP contents when compared with the oocytes without detectable meiotic spindles. Due to the critical role of energy metabolism in oocyte maturation, it is then hypothesized that the low mitochondria and ATP contents may be associated with the failure of meiotic spindle visualization in in vitro matured oocytes.
In this study, our experimental set-up allowed a close observation of the relationship between the mitochondria and presence of meiotic spindle. To provide direct evidence, oocytes were treated with FCCP, which was proven to influence the mitochondrial membrane potential negatively. Our result demonstrated that it was not only the maturation rate, but more importantly the proportion of oocytes with detectable meiotic spindle and the ATP contents which significantly decreased after treatment with FCCP. Although there are many factors responsible for the detection of meiotic spindles, it is inferred that low mtDNA and ATP content are at least partially responsible for the decreased rates of positive spindle formation in in vitro matured oocytes.
Also in this study, we found that the absence of detectable meiotic spindles was associated with a lower incidence of normal fertilization and a lower proportion of good quality embryos when compared with those with detectable meiotic spindles, which was in consistent with several published reports on in vivo matured oocytes (Wang et al., 2001b,c; Cooke et al., 2003; Moon et al., 2003; Rienzi et al., 2003; Cohen et al., 2004; De Santis et al., 2005). According to some of these studies (Wang et al., 2001a,b,c), the changes in spindle structure might reflect cytoplasmic dysfunction or other damage to the oocytes. Although the presence of a clear first polar body indicated nuclear maturation for those oocytes without detectable meiotic spindle, the maturation might not be complete and the oocytes could be immature in cytoplasm. The fertilization and embryo development of these oocytes will then be compromised.
The quantity and functional status of the mitochondria contributes to the quality of oocytes and probably plays an important role in the process of fertilization and embryo development (Cummins, 2002; Santos et al., 2006). The developmental potential of the embryo and the outcome of IVF have been shown to be related to both ATP content and mitochondrial content of human oocytes (Van Blerkom et al., 1995; Cummins. 2002; Chan et al., 2005; Santos et al., 2006). In fact, chromosome non-disjunction leading to chaotic mosaicism in human embryos is associated with low mitochondrial membrane potential through an effect on spindle formation in oocytes (Wilding et al., 2003). As shown in our results, although a significant difference was not obtained due to the limitation of a small sample of embryos, there is an obvious trend to higher mtDNA content in good quality embryos. Thus, our study suggests that oocytes without detectable meiotic spindle might reflect immature cytoplasm of oocytes and a subsequent compromised developmental potential.
In conclusion, low mtDNA and ATP content might contribute to absence of birefringent spindle in in vitro matured human oocytes imaged with the PolScope. The present study also indicated that analysis of the meiotic spindle in live in vitro matured oocytes with the PolScope system may produce new information about oocyte quality and functionality and help to optimize the culture systems for in vitro maturation of oocytes.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
We are grateful for the help of Dr Tao Li and Ms MF Zhang, Centre for reproductive medicine, The First Affiliated Hospital, Sun Yat-Sen University, for collecting the immature oocytes. We also gratefully acknowledge the technical assistance of Dr O. Wai-sum and Ms M.P.L. Cheung, Department of Anatomy, University of Hong Kong, Hong Kong, and gratefully thank Dr V.W.S. Liu for the generous gift of detailed real-time PCR protocol, mitochondrial primers and probe. This study was supported by the Grants from National Natural Science Foundation of China (NSFC 30271367; 30300372; 30571956) and Science Foundation of Guangzhou Province (021874, 2006B35901001).
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
Cha KY and Chian RC. (1998) Maturation in vitro of immature human oocytes for clinical use. Hum Reprod Update 4:103–120.
Chan CC, Liu VW, Lau EY, et al. (2005) Mitochondrial DNA content and 4977 bp deletion in unfertilized oocytes. Mol Hum Reprod 11:843–846.
Chian RC and Tan SL. (2002) Maturational and developmental competence of cumulus-free immature human oocytes derived from stimulated and intracytoplasmic sperm injection cycles. Reprod Biomed Online 5:125–132.[Medline]
Cohen Y, Malcov M, Schwartz T, et al. (2004) Spindle imaging: a new marker for optimal timing of ICSI? Hum Reprod 19:649–654.
Cooke S, Tyler JP, Driseoll GL. (2003) Meiotic spindle location and identification and its effect on embryonic cleavage plane and early development. Hum Reprod 18:2397–2405.
Cummins JM. (2002) The role of maternal mitochondria during oogenesis, fertilization and embryogenesis. Reprod BioMed Online 4:176–182.[Medline]
De Santis L, Cino I, Rabellotti E, et al. (2005) Polar body morphology and spindle imaging as predictors of oocyte quality. Reprod Biomed Online 11:36–42.[ISI][Medline]
Edwards RG and Beard HK. (1997) Oocyte polarity and cell determination in early mammalian embryos. Mol Hum Reprod 3:863–905.
Eichenlaub-Ritter U, Vogt E, Yin H, et al. (2004) Spindles, mitochondria and redox potential in ageing oocytes. Reprod Biomed Online 8:45–58.[ISI][Medline]
Heytler PG. (1979) Uncouplers of oxidative phosphorylation. Methods Enzymol 55:462–542.[Medline]
Kim BK, Lee SC, Kim KJ, et al. (2000) In vitro maturation, fertilization, and development of human germinal vesicle oocytes collected from stimulated cycles. Fertil Steril 74:1153–1158.[CrossRef][ISI][Medline]
Konc J, Kanyo K, Cseh S. (2004) Visualization and examination of the meiotic spindle in human oocytes with polscope. J Assist Reprod Genet 21:349–353.[CrossRef][ISI][Medline]
Liu L, Trimarchi JR, Oldcnbourg R, et al. (2000) Increased birefringence in the meiotic spindle provides a new marker for the onset of activation in living oocytes. Biol Reprod 63:251–258.
Moon JH, Hyun CS, Lee SW, et al. (2003) Visualization of the metaphase II meiotic spindle in living human oocytes using the PolScope enables the prediction of embryonic developmental competence after ICSI. Hum Reprod 18:817–820.
Oldenbourg R. (1999) Polarized light microscopy of spindles. Methods Cell Biol 61:175–208.[ISI][Medline]
Oldenbourg R and Mei G. (1995) New polarized light microscope with precision universal compensator. J Microsc 180:140–147.[ISI][Medline]
Payne D, Flaherty SP, Barry MF, et al. (1997) Preliminary observations on polar body extrusion and pronuclear formation in human oocytes using time-lapse video cinematography. Hum Reprod 12:532–541.
Piko L and Taylor KD. (1987) Amounts of mitochondrial DNA and abundance of some mitochondrial gene transcripts in early mouse embryos. Dev Biol 123:364–374.[CrossRef][ISI][Medline]
Rao GD and Tan SL. (2005) In vitro maturation of oocytes. Semin Reprod Med 23:242–247.[CrossRef][ISI][Medline]
Reynier P, May-Panloup P, Chretien MF, et al. (2001) Mitochondrial DNA content affects the fertilizability of human oocytes. Mol Hum Reprod 7:425–429.
Rienzi L, Ubaldi F, Iacobelli M, et al. (2002) Day 3 embryo transfer with combined evaluation at the pronuclear and cleavage stages compares favourably with day 5 blastocyst transfer. Hum Reprod 17:1852–1855.
Rienzi L, Ubaldi F, Martinez F, et al. (2003) Relationship between meiotic spindle location with regard to the polar body position and oocyte developmental potential after ICSI. Hum Reprod 18:1289–1293.
Rizos D, Ward F, Duffy P, et al. (2002) Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod 61:234–248.[CrossRef]
Santos TA, El Shourbagy S, St John JC. (2006) Mitochondrial content reflects oocyte variability and fertilization outcome. Fertil Steril 85:584–591.[CrossRef][ISI][Medline]
Trounson A, Anderiesz C, Jones G. (2001) Maturation of human oocytes in vitro and their developmental competence. Reproduction 121:51–75.[Abstract]
Van Blerkom J and Runner MN. (1984) Mitochondrial reorganization during resumption of arrested meiosis in the mouse oocyte. Am J Anat 171:335–355.[CrossRef][ISI][Medline]
Van Blerkom J, Davis P., Alexander S. (2004) Occurrence of maternal and paternal spindles in unfertilized human oocytes: possible relationship to nucleation defects after silent fertilization. Reprod Biomed Online 8:454–459.[ISI][Medline]
Van Blerkom J, Davis P, Lee J. (1995) ATP content of human oocytes and development potential and outcome after in vitro fertilization and embryo transfer. Hum Reprod 10:415–424.
Wang Y, Liu VW, Xue WC, et al. (2005) The increase of mitochondrial DNA content in endometrial adenocarcinoma cells: a quantitative study using laser-captured microdissected tissues. Gynecol Oncol 98:104–110.[CrossRef][ISI][Medline]
Wang WH, Meng L, Hackeit RJ, et al. (2001a) Limited recovery of meiotic spindles in living human oocytes after cooling-rewarming observed using polarized light microscopy. Hum Reprod 16:2374–2378.
Wang WH, Meng L, Hackett RJ, et al. (2001b) Developmental ability of human oocytes with or without birefringent spindles imaged by PolScope before insemination. Hum Reprod 16:1464–1468.
Wang WH, Meng L, Hackett RJ, et al. (2001c) The spindle observation and its relationship with fertilization after intracytoplasmic sperm injection in living human oocytes. Fertil Steril 75:348–353.[CrossRef][ISI][Medline]
Wilding M, Dale B, Marino M, et al. (2001) Mitochondrial aggregation patterns and activity in human oocytes and preimplantation embryos. Hum Reprod 5: pp. 909–917.
Wilding M, De Placido G, De Matteo L, et al. (2003) Chaotic mosaicism in human preimplantation embryos is correlated with a low mitochondrial membrane potential. Fertil Steril 79:340–346.[CrossRef][ISI][Medline]
Submitted on February 8, 2007; resubmitted on February 19, 2007; accepted on February 21, 2007.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Van Blerkom and P. Davis Mitochondrial signaling and fertilization Mol. Hum. Reprod., November 1, 2007; 13(11): 759 - 770. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||