Skip Navigation


Hum. Reprod. Advance Access originally published online on June 11, 2007
Human Reproduction 2007 22(8):2232-2242; doi:10.1093/humrep/dem136
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
22/8/2232    most recent
dem136v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitalipov, S.M.
Right arrow Articles by Wolf, D.P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitalipov, S.M.
Right arrow Articles by Wolf, D.P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Reprogramming following somatic cell nuclear transfer in primates is dependent upon nuclear remodeling

S.M. Mitalipov1,5, Q. Zhou2, J.A. Byrne1, W.Z. Ji3, R.B. Norgren4 and D.P. Wolf1

1 Division of Reproductive Sciences, Oregon National Primate Research Center, Oregon Health and Science University, 505 NW 185th Avenue, Beaverton, OR 97006, USA 2 Institute of Zoology, Chinese Academy of Sciences, Beijing, China 3 Kunming Institute of Zoology, Kunming Primate Research Center, Chinese Academy of Sciences, Kunming, Yunnan, China 4 Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, NE, USA

5 Correspondence address. Tel: +1-503-614-3709; Fax: +1-503-533-2494; E-mail: mitalipo{at}ohsu.edu


    Abstract
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
BACKGROUND: Somatic cell nuclear transfer (SCNT) requires cytoplast-mediated reprogramming of the donor nucleus. Cytoplast factors such as maturation promoting factor are implicated based on their involvement in nuclear envelope breakdown (NEBD) and premature chromosome condensation (PCC). Given prior difficulties in SCNT in primates using conventional protocols, we hypothesized that the ability of cytoplasts to induce nuclear remodeling was instrumental in efficient reprogramming.

METHODS: NEBD and PCC in monkey (Macaca mulatta) SCNT embryos were monitored by lamin A/C immunolabeling.

RESULTS: Initially, a persistent lamin A/C signal from donor cell nuclei after fusion with cytoplasts was observed indicative of incomplete NEBD following SCNT and predictive of developmental arrest. We then identified fluorochrome-assisted enucleation and donor cell electrofusion as likely candidates for inducing premature cytoplast activation and a consequent lack of nuclear remodeling. Modified protocols designed to prevent premature cytoplast activation during SCNT showed robust NEBD and PCC. Coincidently, over 20% of SCNT embryos reconstructed with fetal fibroblasts progressed to blastocysts. Similar results were obtained with other somatic cells. Reconstructed blastocysts displayed patterns of Oct-4 expression similar to fertilized embryos reflecting successful reprogramming.

CONCLUSIONS: Our results represent a significant breakthrough in elucidating the role of nuclear remodeling events in reprogramming following SCNT.

Key words: somatic cell nuclear transfer/nuclear remodeling/premature cytoplast activation/lamin A/C/primate


    Introduction
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Somatic cell nuclear transfer (SCNT) is a complex, poorly understood process requiring cytoplast-mediated reprogramming of the donor nucleus from a differentiated state to a totipotent condition. Successful reprogramming after SCNT is associated with mainly unidentified factors that present exclusively in the cytoplasm of matured but unfertilized (non-activated) metaphase II (MII) arrested oocytes. Early experimentations on mouse SCNT described structural changes in the donor nucleus occurring soon after introduction into the MII cytoplast due to high activity of maturation promoting factor (MPF) that is a complex of two subunits: a catalytic subunit, CDC2, a homologue of the yeast cdc2 protein kinase; and a regulatory subunit, cyclin B (Szollosi et al., 1988Go). The incidence and degree of these structural changes, including nuclear envelope breakdown (NEBD) and premature chromosome condensation (PCC), varies with the species, nuclear transfer protocols, oocyte age and somatic donor cell type. Nuclear remodeling following SCNT could be particularly beneficial for efficient nuclear reprogramming by allowing access of ooplasmic factors to the donor cell's chromatin. However, a direct link between NEBD, PCC and successful reprogramming has not yet been demonstrated. What is known is that MPF levels and the ability to support NEBD and PCC decline after fertilization or artificial activation (Szollosi et al., 1988Go) triggered by Ca2+ oscillations and subsequent cyclin B1 destruction by the proteasome machinery (Marangos and Carroll, 2004Go).

Despite the remarkable progress achieved in the past decade in SCNT in mammals, success in primates has been long in coming. We have produced rhesus monkeys by nuclear transfer using embryonic blastomeres as the source of donor nuclei (Meng et al., 1997Go; Mitalipov et al., 2002Go). We demonstrated a high, similar to sperm-fertilized controls, in vitro blastocyst formation potential of NT embryos when employing 8–16-cell stage blastomeres as nuclear donor cells. In contrast, the developmental potential of SCNT monkey embryos has been limited (Mitalipov et al., 2002Go), seldom progressing beyond the 8-cell stage in vitro when fetal fibroblasts were employed as nuclear donor cells. Successful pregnancy initiation was reported following transfer of SCNT embryos in the cynomolgus monkey, however, spontaneous loss occurred within 60 days of gestation (Ng et al., 2004Go). We have concluded that the failure of somatic but not embryonic cell nuclear transfer in the monkey was due to the incomplete reprogramming of the somatic cell nucleus (SN) (Mitalipov et al., 2002Go). Studies demonstrating aberrant POU5F1 (Oct-4) expression in reconstructed embryos were consistent with this conclusion (Mitalipov et al., 2003Go). More recently, we reported a prospective study comparing SCNT outcome in the monkey using a conventional protocol versus a one step method (OSM) used successfully in the rat (Zhou et al., 2003Go, 2006Go). The OSM was clearly superior, however, the mechanisms responsible for the outcome were not investigated. Here, we hypothesized that the ability of cytoplasts to induce donor nucleus remodeling was instrumental in efficient reprogramming and, hence, SCNT outcome (Zhou et al., 2006Go). We undertook an analysis of each step in SCNT applying assessments of the individual cytoplast ability to induce nuclear remodeling measured by immunolabeling of lamin A/C. Further modifications in nuclear transfer protocols that limited MPF degradation and premature cytoplast activation resulted in enhanced nuclear remodeling and improved SCNT development. The routine recovery of blastocysts from several somatic nuclear donor cells was accomplished providing the foundation for the production of SCNT monkeys and the derivation of embryonic stem cells (ESCs).


    Material and Methods
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Animals
Mature rhesus macaque males and females housed in individual cages were used in this study. All animal procedures were approved by the Institutional Animal Care and Use Committee at the Oregon National Primate Research Center/Oregon Health and Science University.

Ovarian stimulation, recovery of rhesus macaque oocytes, fertilization by ICSI and embryo culture
Controlled ovarian stimulation and oocyte recovery has been described previously (Zelinski-Wooten et al., 1995Go). Cumulus-oocyte complexes were collected from anesthetized animals by laparoscopic follicular aspiration (28–29 h post-hCG) and placed in HEPES-buffered TALP (modified Tyrode solution with albumin, lactate and pyruvate) medium (Bavister and Yanagimachi, 1977Go) containing 0.3% bovine serum albumin (BSA) (TH3) at 37°C. Oocytes, stripped of cumulus cells by mechanical pipetting after brief exposure (<1 min) to hyaluronidase (0.5 mg/ml), were placed in chemically defined, protein-free HECM-9 (Hamster Embryo Culture Medium) (McKiernan and Bavister, 2000Go) at 37°C in 6% CO2, 5% O2 and 89% N2 until further use.

Fertilization by ICSI and embryo culture was performed as described previously (Wolf et al., 2004Go). After ICSI, injected oocytes were placed in 4-well dishes (Nalge Nunc International Co., Naperville, IL, USA) containing protein-free HECM-9 and cultured at 37°C in 6% CO2, 5% O2 and 89% N2. Cultures were maintained under paraffin oil. Embryos at the 8-cell stage were transferred to fresh plates of HECM-9 supplemented with 5% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and cultured to the blastocyst stage with the medium changed every other day.

Conventional nuclear transfer procedures
Cell cultures of nuclear donor cells were established as described previously (Mitalipov et al., 2002Go). Briefly, tissue biopsy samples were washed in 0.5 mM EDTA in Ca2+- and Mg2+-free Dulbecco PBS (Invitrogen, Carlsbad, CA, USA) and minced into pieces before incubation in Dulbecco Modified Eagle's Medium (DMEM, Invitrogen) containing 1 mg/ml collagenase IV (Invitrogen) at 37°C in 5% CO2 for 20 min. Tissue pieces were then vortexed, washed and seeded into 75 cm3 cell culture flasks (Corning, Acton, MA, USA) containing DMEM supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin (Invitrogen), 10% FBS and cultured at 37°C in 5% CO2. Cells were synchronized in the G0/G1 phase of the cell cycle by culturing in medium with 0.5% FBS for 5 days after reaching confluency. Hypoxanthine-guanine phosphoribosyltransferase null mutant cells (HPRT1) were generated by immortalizing rhesus monkey adult male ear fibroblasts by transduction with the human telomerase reverse-transcriptase (TERT) construct as described elsewhere (Kirchoff et al., 2002Go) followed by targeting of HPRT1 locus (R. Norgren, unpublished).

Standard nuclear transfer and activation was performed as described before (Mitalipov et al., 2002Go, 2003Go). Briefly, recipient MII oocytes were incubated for 5 min with 5 µg/ml bisBenzimide (Hoechst 33342), transferred to 30 µl of TH3 containing 3.5 µg/ml cytochalasin B, and incubated for 10–15 min before enucleation. The first polar body (PB) and ~10% of the underlying cytoplast were extracted by aspiration into an enucleation pipette. Metaphase spindle removal was confirmed under epifluorescence microscopy by its presence in the enucleation pipette. A disaggregated donor cell was aspirated into a micropipette and transferred into the perivitelline space of the cytoplast. Cell fusion was induced by two 50 µs DC pulses of 2.7 kV/cm (Electro Square Porator T-820, BTX, Inc., San Diego, CA, USA) in 0.25 M D-sorbitol buffer containing 0.1 mM calcium acetate, 0.5 mM magnesium acetate, 0.5 mM HEPES and 1 mg/ml fatty acid-free BSA. Successful fusion was confirmed visually 30–45 min after electroporation by the disappearance of the donor cell in the perivitelline space. Reconstructed embryos were activated 2 h after fusion by exposure to 5 µM ionomycin (CalBiochem, La Jolla, CA) for 4 min followed by 5 h incubation in 2 mM 6-dimethylaminopurine. Fused, activated SCNT embryos were placed in HECM-9 and cultured as described above.

Modified nuclear transfer procedures
Initially, removal of the spindle and injection of the donor nucleus was accomplished with the ‘one step micromanipulation’ technique (Zhou et al., 2006Go). Recipient MII oocytes were transferred to the micromanipulation chamber with 30 µl of TH3 containing 5 µg/ml cytochalasin B, and incubated for 10–15 min before enucleation. The chamber was then mounted on an inverted microscope equipped with DIC or Hoffman optics and micromanipulators. An individual oocyte was positioned using the holding pipette with the 1st PB at ~2 o'clock. The metaphase spindle was visualized as a small string of bead shaped structures (chromosomal complexes) usually adjacent to the polar body. A beveled (22–25 µm outer diameter) or blunt Piezo-driven (10–15 µm outer diameter) enucleation pipette was inserted through the zona pellucida without piercing the oolemma and the spindle was slowly aspirated into the pipette and removed. Note that the PB was not removed. Karyoplasts were subsequently stained with Hoechst 33342 and enucleation was confirmed by the presence of metaphase chromosomes. Cultured donor cells were prepared as described above and freshly dispersed cumulus cells were used within 2–3 h of retrieval. A blunt transfer pipette (5–7 µm outer diameter) was used to disrupt the membrane of a single donor cell by aspiration from a TH3 drop and the lysed cell with intact nucleus was subsequently injected into a cytoplast. Alternatively, we employed a two-step approach, first enucleating using OosightTM Imaging System (CRI, Inc., Woburn, MA, USA) that allowed non-invasive, polarized light imaging and detection of the spindle based on birefringence. An earlier version of this imaging system (SpindleView) was successfully used for enucleation of monkey oocytes (Ng et al., 2004Go). Using this innovative approach, we were able to locate and quickly enucleate the spindle in real-time with 100% efficiency. All micromanipulations were performed in a modified Ca2+- and Mg2+-free TH3 medium. In the second step, donor cell nuclear transfer was accomplished by direct injection as described above or by electrofusion. Electrofusion procedures were similar to the conventional protocols described above with the exception that calcium and magnesium acetates were removed from the fusion buffer. Reconstructed embryos were activated 2 h later as described above.

To titrate the minimal effective concentration of proteasome inhibitor, MG-132, selected metaphase I (MI) oocytes were cultured in HECM with different concentrations of MG-132 (0.5, 2 and 5 µM) for 4 h, washed, and then cultured for an additional 2 h to complete maturation. Mature, MII oocytes were immediately fertilized by ICSI. To examine the effect of nuclear transfer manipulations on premature activation and nuclear remodeling, oocytes in selected experiments were incubated with 5 µM MG-132 immediately after retrieval and maintained in this inhibitor throughout SCNT procedures. Alternatively, SCNT embryos produced by modified fusion protocols were exposed to 2.5 mM caffeine (protein phosphatase inhibitor) immediately after electrofusion for 2 h, then extensively washed and activated.

Immunocytochemical procedures
Monkey oocytes and embryos were fixed in 4% paraformaldehyde for 20 min. After permeabilization with 0.2% Triton X-100 and 0.1% Tween-20, non-specific reactions were blocked with 10% normal goat serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Embryos were then incubated for 40 min in mouse monoclonal antibody against Oct-4 (POU5F1) or lamin A/C (1:200; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). After extensive washing, embryos were exposed to affinity-purified goat anti-mouse, secondary antibody conjugated with indocarbocyanine (Cy3, 1:200; Jackson ImmunoResearch). Embryos were then co-stained with 2 µg/ml of 4',6-diamidino-2-phenylindole (DAPI) for 10 min, whole-mounted onto slides and examined under epifluorescence microscopy.

Genomic DNA extraction and amplification by PCR
Genomic DNA was isolated from individual blastocysts using QIAamp DNA Micro Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer's protocol. Somatic donor cell and ESC gDNA was isolated using PUREGENE Cell and Tissue Kit (Gentra, Minneapolis, MN, USA). A PCR-based method for the sexing of gDNA using size differences in the amplicons of the X- and Y-linked zinc finger protein genes (ZFX and ZFY) was applied (Wilson and Erlandsson, 1998Go). The primers used were:

For - 5' ATTCCAGGCAGTACCAAACAG 3';

Rev - 5'CCATCAGGGCCAATAATTATT 3'.

The primer set produced a 1149 bp fragment in both male and female samples, with an additional 771 bp fragment found only in male samples. The following primers were used to determine the presence of the neo cassette:
For - 5' CTGAATGAACTGCAGGACGA 3';

Rev - 5' AGCCAACGCTATGTCCTGAT 3'.

PCRs were carried out in a 50 µl volume containing 250 ng of template gDNA, 0.2 µM of each primer, and 45 µl of Platinum PCR SuperMix High Fidelity (Invitrogen) containing a final concentration of 2.16 mM MgSO4, 0.198mM dNTPs. PCR conditions were as follows for both primer sets (denaturation/annealing/extension): 35 cycles 94/55/72°C for 20/20/60 s. Amplicons were electrophoresed through 1.6% 0.5 x TAE agarose gels stained with ethidium bromide and visualized on a UV transilluminator.

Statistical analysis
Results were analyzed by chi-square using Statview Software (SAS Institute, Inc., Cary, NC, USA) with statistical significance set at 0.05.


    Results
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Lamin A/C expression and nuclear remodeling in monkey oocytes and preimplantation stage embryos
Lamin A/C, a nuclear lamina protein, has been considered as a marker of differentiated cells, however, its expression during mouse, pig and bovine preimplantation development is inconsistent (Schatten et al., 1985Go; Prather et al., 1989Go; Moreira et al., 2003Go; Sullivan et al., 2004Go; Hall et al., 2005Go). Therefore, we initially examined the dynamics of lamin A/C appearance in monkey oocytes and in in vitro produced preimplantation stage embryos as detected by immunocytochemistry with a monoclonal antibody. A minimum of six oocytes/embryos produced from two independent experiments was examined per each developmental stage. Control experiments with primary or secondary antibody alone were negative (data not shown). In germinal vesicle stage oocytes (GV), a high level of staining for lamin A/C was detected on the inner layer of the nuclear envelope (Fig 1A-A1). MI or MII arrested oocytes were negative for lamin A/C staining consistent with the absence of a nuclear membrane (Fig 1B-B1). Intense signal was associated with both pronuclei in zygotes produced by ICSI (Fig 1C-C1). However, lamin A/C reactivity was diminished and or dispersed in cleavage stage embryos up to the 8-cell stage (Fig. 1D-D1 and E-E1). Strong nuclear staining reappeared at the 8-cell stage with intense lamin A/C signal observed in morulae before and after compaction (Fig. 1F-F1 and G-G1). At the expanded or hatched blastocyst stages, strong lamin A/C signal was present in trophectodermal cells but was relatively faint in the inner cell mass (ICM; Fig. 1H-H1).


Figure 1
View larger version (59K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1: Lamin A/C dynamics in monkey oocytes and embryos produced by ICSI. DAPI was used throughout to localize cellular chromatin (A-A1) Germinal vesicle oocyte showing a high level of staining for lamin A/C antibody on the inner layer of the nuclear envelope. (B-B1) MII oocytes were negative for lamin A/C staining consistent with the absence of a nuclear membrane. The arrows designate a DAPI signal from the meiotic spindle and the polar body. (C-C1) Zygotes showed intense signal on both pronuclei. Lamin A/C expression was diminished in 4- and 6-cell stage embryos (D-D1 and E-E1). Strong nuclear staining became obvious at the 8-cell stage with intense lamin A/C signal observed in morula and compact morula stages (F-F1 and G-G1). Strong lamin A/C staining was present in trophectodermal cells of expanded blastocysts, however, signal was diminished in the ICM (H-H1)

 
Nuclear remodeling in monkey embryos produced by conventional SCNT protocols
Conventional protocols for SCNT involving mechanical spindle extraction in the presence of the DNA stain, bisBenzimide and UV exposure to confirm spindle removal (standard procedure in sheep, cattle and pigs Fulka et al., 2004Go) with subsequent donor cell introduction by electrofusion have been largely unsuccessful in the monkey (Mitalipov et al., 2002Go; Simerly et al., 2003Go; Zhou et al., 2006Go). Here, we associated failed SCNT embryo development with premature cytoplast activation as evidenced by incomplete nuclear remodeling detected with lamin A/C staining. As expected, donor fetal fibroblasts showed intense lamin A/C staining (Fig. 2, A-A1-A2). When introduced into non-activated cytoplasts by fusion, donor nuclei disappeared upon direct morphological evaluation. However, immunostaining for lamin A/C indicated the retention of intact nuclear lamina during 4 h of observation (Fig. 2B-B1 and C-C1) despite the fact that transferred nuclei underwent significant swelling (up to three times larger than the original). Moreover, co-staining with DAPI showed only minimal changes in donor cell chromatin after fusion, consistent with the absence of PCC. Following activation of fusion pairs induced by ionomycin/DMAP exposure, lamin A/C signal was also present in pronuclear stage embryos produced by SCNT. However, in contrast to control, ICSI-produced, embryos, intense lamin A/C signal was also maintained in early cleavage stage SCNT embryos albeit confined to the donor cell nucleus. When cultured in vitro, a high rate of developmental arrest at or beyond the 8-cell stage occurred in SCNT embryos, while over 60% of cleaved, fertilized control embryos progressed to the blastocyst stage (Table 1).


Figure 2
View larger version (53K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2: Lamin A/C dynamics and nuclear remodeling in reconstructed monkey embryos produced following bisbenzimide and UV light exposure during spindle removal and nuclear donor cell introduction by electrofusion. DAPI staining was used throughout to localize cellular chromatin. A-A1-A2; Phase contrast image of donor fetal fibroblasts and strong lamin A/C staining of the nucleus. B-B1; A reconstructed embryo 1 hour after fusion showing minimal or no change in the donor nucleus. C-C1; A reconstructed embryo 4 h after fusion exibiting strong lamin A/C staining confined to the nuclear donor cell and indicative of the presence of an intact nuclear membrane. DAPI labeling shows incomplete chromatin condensation. D-D1; strong lamin A/C immunostaining persisted in cleaving, reconstructed embryos up to the 8-cell stage after which time embryos typically arrested. E-E1; a reconstructed embryo 4 h after fusion of a donor fibroblast with an intact (non-enucleated) MII oocyte. Note patchy nuclear membrane staining and significant chromatin condensation in the transferred nucleus consistent with efficient remodeling. The arrows localize the donor somatic cell nucleus (SN), spindle and the 1st polar body (PB)

 

View this table:
[in this window]
[in a new window]

 
Table 1: Development of rhesus monkey SCNT embryos produced by conventional protocols

 
Failure to induce nuclear remodeling could reflect either inherently low MPF levels in MII oocytes recovered from ovarian stimulation protocols or loss of MPF resulting from premature oocyte activation during manipulation. To evaluate the first possibility, we fused nuclear donor cells with intact (non-enucleated) MII oocytes (n = 13). Nine of thirteen reconstructed embryos produced displayed patchy patterns of lamin A/C staining and chromatin condensation in the transferred nucleus consistent with timely remodeling (Fig. 2E-E1) and suggesting that at least not all MII oocytes were deficient in MPF. To test the hypothesis that failed nuclear remodeling reflects premature activation caused by the SCNT procedures and decline in MPF activity mediated by the proteasome system, we inhibited proteasome catalytic activity with MG-132 (Josefsberg et al., 2000Go; Zhou et al., 2003Go). In a pilot study, we first determined that MG-132 at 5 µM was efficient in inhibiting first PB extrusion during the MI-MII transition of monkey oocytes (Table 2). However, in vitro development of treated oocytes subsequently fertilized by ICSI was significantly impaired with only one of four zygotes cleaved (Table 2). Lowering the concentration of MG-132 to avoid its detrimental effect on embryonic development did not result in the maintenance of MPF activity since the MI-MII transition was documented during the treatment (Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2: Effect of various concentrations of MG-132 on inhibition of 1st PB extrusion in monkey oocytes during the MI-MII transition and on subsequent in vitro development following fertilization by ICSI

 
Nevertheless, MG-132 exposure at the higher concentration preserved MPF activity in monkey cytoplasts and allowed an examination of the effect of nuclear transfer manipulations on premature activation and nuclear remodeling. Mature MII oocytes were exposed to 5 µM MG-132 immediately after retrieval and maintained in this inhibitor throughout enucleation and somatic donor cell fusion procedures. When sampled 1 h after fusion, reconstructed embryos treated with MG-132 showed slight chromatin condensation and moderate lamin A/C staining (Fig. 3A-A1), however, by 4 h clear evidence of nuclear remodeling was obvious; weak or partial lamin A/C signal, robust chromosome condensation and spindle formation (Fig. 3B-B1). These results support our assumption that conventional nuclear transfer steps induce a premature decline in MPF levels.


Figure 3
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3: Lamin A/C detection in reconstructed monkey embryos exposed to a proteasome inhibitor or produced following spindle removal without bisBenzimide/UV exposure and with injection of the nuclear donor cell. DAPI staining is used throughout to visualize cellular chromatin. The embryos exposed to proteasome inhibitor in A and B were produced by the conventional SCNT protocol and should be compared with those presented in Fig. 2. (A-A1) A reconstructed embryo exposed to 5 µM MG-132 1 h after fusion showing slight chromatin condensation and moderate lamin A/C staining. (B-B1) A reconstructed embryo treated with MG-132 for 4 h after fusion exhibiting robust chromosome condensation, spindle formation and weak or partial lamin A/C signal. (C-C1) An embryo reconstructed by the modified SCNT protocol, 2 h after injection. Note strong PCC and patchy lamin A/C staining similar to that seen in MG-132 treated SCNT embryos in B-B1. (D-D1) weak lamin A/C immunostaining in a 4-cell stage reconstructed embryo. (E-E1) Re-expression of lamin A/C in the 8-cell stage reconstructed embryo. (F-F1) Strong signal was detected in trophectodermal cells of the reconstructed blastocyst, but reactivity of the ICM was significantly diminished, consistent with the pattern seen in sperm fertilized blastocysts. Arrows designate the donor SN and the 1st PB

 
Premature activation could be induced by the electrofusion step (Mitalipov et al., 2001Go). To evaluate this possibility, we applied fusion pulses to intact, control MII oocytes in fusion medium. Resumption of meiosis and second PB extrusion was observed in all oocytes (5/5) within 1 h indicating that the fusion procedure in monkeys can cause premature oocyte activation. This data, as a whole, demonstrate that premature cytoplast activation, secondary to conventional SCNT manipulations is responsible for failed nuclear remodeling and could account for the lack of developmental competence of monkey SCNT embryos.

Nuclear remodeling and development in monkey SCNT embryos produced by modified protocols
In our comparative study of SCNT in monkeys, modified manipulation protocols involving spindle removal without bisBenzimide/UV exposure and donor cell injection in OSM was superior to the conventional procedure described above (Zhou et al., 2006Go). A reduction in manipulation time was deemed important, perhaps minimizing any decline in MPF activity if and when premature activation occurred. Here, we challenged this assumption using two different methods for spindle extraction, namely the OSM under DIC optics as we described previously (Zhou et al., 2006Go) and a two-step protocol. The two steps involved first use of spindle imaging system, OosightTM to directly visualize and extract the spindle (Fig. 4A-a) followed by donor nucleus introduction by direct injection employing a Piezo drill. To further protect the cytoplast from premature activation, intact oocyte incubations and manipulations were conducted in Ca2+ and Mg2+-free medium. Karyoplast staining with bisBenzimide confirmed successful enucleation in ~80% of manipulated oocytes under DIC optics and 100% with OosightTM. Oocytes in which enucleation was not documented were discarded. Although OSM required relatively long manipulation times secondary to achieving the optimal oocyte orientation for spindle identification, the use of OosightTM largely eliminated this limitation and spindle removal could routinely be accomplished in 1 min.


Figure 4
View larger version (59K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4: Modified SCNT and analysis of resultant embryos. (A) Spindle visualization in monkey oocytes and morphology and Oct-4 protein profiles of SCNT blastocysts. (a) Spindle (indicated by arrow) detection in monkey MII oocytes prior to removal using the OosightTM imaging system. (b) Morphology of Day 8, hatching reconstructed blastocysts produced from donor fetal fibroblasts. (c-c1) An expanded, reconstructed blastocyst displaying strong Oct-4 protein signal in the ICM but not in the trophectoderm. Oct-4 expression indicates that the donor nucleus was reprogrammed to a totipotent state. (d-d1) Aberrant nuclear reprogramming in a hatching, reconstructed blastocyst with only a few ICM cells appearing Oct-4 positive. (B) PCR-based sexing of gDNA isolated from SCNT blastocysts based on size differences in the amplicons of the X- and Y-linked zinc finger protein genes (ZFX and ZFY). The use of male donor cells resulted in the production of male, reconstructed blastocysts eliminating the possibility of a parthenogenetic origin. Lanes 1–2 (ICSI-1 and ICSI-2) are individual male and female control blastocysts, respectively, produced by ICSI; Lane 3 (HPRT1) represents HPRT1, adult male fibroblasts; Lanes 4–5 (SCNT-1 and SCNT-2) are individual blastocysts reconstructed from HPRT1, adult male fibroblasts; Lanes 6–7 (OR-6 and OR-3) are female and male rhesus monkey ESC lines, respectively, produced from ICSI-produced blastocysts (ORMES series). (C) PCR-based analysis demonstrating the presence of the neo gene in SCNT blastocysts reconstructed from neo containing immortalized HPRT1, male adult fibroblasts. Lane identification is the same as that itemized in Fig. 4B

 
When both these protocols were applied, SCNT embryos reconstructed with fetal fibroblasts showed loss of an organized lamin A/C signal and chromatin condensation within 2 h of injection comparable to that observed in MG-132-treated cytoplasts (Fig. 3C-C1). Concomitant with improved nuclear remodeling, 15% (10/67) of SCNT embryos created with OosightTM enucleation and direct injection reached the blastocyst stage in vitro compared with only 1% (3/235) (P < 0.05) in the control SCNT group reconstructed using conventional enucleation with bisBenzimide/UV exposure and fusion. Moreover, similar to fertilized controls, lamin A/C signal in reconstructed embryos produced by the modified protocol was weak at the early cleavage stages with strong staining reappearing at the 8-cell stage (Fig. 3D-D1 and E-E1). Note that this lamin A/C re-expression coincides with the timing of embryonic genome activation in the monkey (Schramm and Bavister, 1999Go). At the blastocyst stage, reconstructed embryos revealed strong signal in the trophectoderm but reactivity to the lamin A/C antibody was diminished in the ICM. This was also analogous to ICSI-produced controls and consistent with appropriate reprogramming (Fig. 3F-F1). MII oocytes collected during follicular aspiration or matured shortly (2–4 h) during in vitro culture were equally efficient as donor cytoplasts for SCNT. Similar blastocyst development rates seen here with the two-step protocol using OosightTM compared with the OSM described by us previously (Zhou et al., 2006Go) suggested that time differences in oocyte/cytoplast manipulation were not critical.

In our comparative study, only one fibroblast-like cell line and its sub-clone out of four lines tested was able to support SCNT embryo development (Zhou et al., 2006Go). To eliminate the possibility that this donor cell was unique, we examined the ability of other cell types to support SCNT and the in vitro development of reconstructed embryos to the blastocyst stage. Fetal fibroblasts, adult male fibroblasts, female cumulus and oviductal epithelial cells and TERT immortalized fibroblasts (Kirchoff et al., 2002Go) supported timely blastocyst formation within 8 days of culture (Table 3 and Fig. 4A-b). Oct-4 (POU5F1) protein expression was examined by immunocytochemistry in individual SCNT blastocysts as a measure of successful nuclear reprogramming. A normal or control distribution pattern of Oct-4 expression was detected in five of six expanded SCNT blastocysts (Fig. 4A-c/c1, d/d1). The signal was localized to the ICM and down-regulated in trophectodermal cells similar to that seen in ICSI-produced controls. We demonstrated by PCR that male donor cell lines produced male embryos (Fig. 4B) eliminating the possibility that the reconstructed embryos were parthenotes and consistent with the results from karyotyping of individual SCNT blastocysts (Zhou et al., 2006Go). When a gene targeted HPRT1 fibroblast cell line was employed as the nuclear donor cell source, the neo-containing insertion cassette was detected by PCR in both expanded SCNT blastocysts tested (Fig. 4C) indicating an origin from the donor nucleus genome.


View this table:
[in this window]
[in a new window]

 
Table 3: The ability of different somatic nuclear donor cells to support the production of developmentally competent embryos in the rhesus monkey following modified SCNT protocols

 
Some donor cell types, particularly fibroblasts from aged adult monkeys, displayed a larger cell size incompatible with direct injection into cytoplasts. Attempts to use larger diameter micropipettes for breaking the cell membrane and injecting such cells inevitably resulted in increased rates of cytoplast lysis. To address this issue, we revisited the donor cell electrofusion approach and modified this step by excluding Ca2+ and Mg2+ from the fusion buffer. Over 90% of adult male skin fibroblasts were successfully fused and blastocyst development was comparable to ICSI-fertilized controls (Table 4). However, the timing of blastocyst formation was significantly delayed in the fusion group with blastocysts cavitation observed at Days 10–12 compared with the ICSI control or SCNT embryos produced by injection that typically formed blastocysts by Day 8 (Table 4). We reasoned that premature cytoplast activation during electrofusion could still occur and explain this outcome. To test another approach to avoid MPF degradation, SCNT embryos were incubated in 2.5 mM caffeine (protein phosphatase inhibitor) for 2 h immediately after electrofusion. Caffeine treatment did not adversely affect cleavage and development as seen with MG-132. Moreover, SCNT embryos reached the blastocyst stage by Day 8 (Table 4), further supporting the concept that high MPF levels and complete nuclear remodeling are essential for reprogramming and development following SCNT in primates.


View this table:
[in this window]
[in a new window]

 
Table 4: Blastocyst development of monkey SCNT embryos produced by electrofusion

 

    Discussion
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Nuclear transfer using embryonic blastomeres has been demonstrated by us in the monkey (Mitalipov et al., 2002Go). However, unlike somatic cells, embryonic blastomeres require little or no reprogramming during nuclear transfer, which is the main limitation with SCNT in primates. Synchronization of cell cycles between donor nuclei and recipient cytoplasts is extremely important for maintaining normal ploidy and developmental potential of NT embryos. Conventional approaches employed for SCNT involving synchronization of cultured somatic cells at G0/G1 of the cell cycle by serum starvation are not applicable with embryonic cell cloning. This is mainly due to fundamental differences in the control of the cell cycle between somatic and embryonic cells, as we and others have shown (Fluckiger et al., 2006Go). The main feature of embryonic cell cycles is a short G1 phase, which represents ~15% of the total cell cycle duration and means that the remaining cells will be in S and G2/M phases. Moreover, unlike cultured somatic cells, embryonic blastomeres of the preimplantation embryo fail to undergo cell cycle arrest in the G0/G1 phase in response to serum starvation. This mandated the use of an alternative cell cycle synchronization approach (Meng et al., 1997Go; Mitalipov et al., 2002Go) where cytoplasts were enucleated and activated prior to nuclear transfer to create ‘universal’ cytoplasts (Campbell, 1999Go). Individual (unsynchronized) blastomeres were then fused with activated cytoplasts. The objective was to introduce the donor nucleus after the decline of MPF activity, thereby, eliminating the need for NEBD and PCC. This approach supports the coordinated replication of G1-, S- and G2-phase donor nuclei and the production of normal diploid nuclear transfer embryos (Campbell, 1999Go).

SCNT, on the other hand, is dependant on successful reprogramming of the donor nucleus by factors present in the unfertilized (non-activated) MII oocyte resulting in immediate inhibition of transcription in the transferred nucleus and the subsequent establishment of temporal and spatial patterns of embryonic gene expression associated with normal development (Campbell, 1999Go). Initially, morphological and biochemical changes occur in the donor nucleus that constitute nuclear remodeling, including NEBD, PCC and dispersion of nucleoli (Szollosi et al., 1988Go); those events that may be particularly important in facilitating access of ooplasmic remodeling factors to the donor cell chromatin.

Previously, we reported that modifications in our monkey SCNT protocols resulted in improved reprogramming and significant blastocyst development compared with the conventional approach. However, molecular mechanisms underlying such apparent differences remained unclear. In this study, we focused on nuclear remodeling, monitored by lamin A/C staining, as an indicator of reprogramming and sought clarification of the mechanisms and steps in SCNT that were critical to successful outcomes in the monkey.

Lamins, the intermediate filament superfamily of proteins, are part of the nuclear lamina found on the inner layer of the nuclear envelope. Although B type lamins are expressed in all cell types, A and C type lamins, splicing variants of the LMNA gene, are expressed in most differentiated somatic cells. Lamins A/C play essential roles in maintaining structural lamina stability and determine the size, shape and strength of the nuclear envelope (Hutchison and Worman, 2004Go) and change in composition during early cleavage stages; these proteins depolymerize during late prophase and are thus undetectable in the MI or MII oocytes. Upon fertilization cytoplasmic lamins are recruited into the newly forming pronucleus (Schatten et al., 1985Go; Prather et al., 1989Go), however, reactivity of lamin A/C to antibodies is significantly down-regulated in cleavage stage mouse, bovine and porcine embryos (Schatten et al., 1985Go; Prather et al., 1989Go). Changes in nuclear lamina organization during early preimplantation development has allowed use of lamin A/C to assess the extent of nuclear remodeling following SCNT in cattle and mice (Moreira et al., 2003Go; Sullivan et al., 2004Go; Hall et al., 2005Go) and, as shown in this study, in monkeys.

Nuclear lamina disassembly and chromosome condensation have been associated with the direct phosphorylating activity of MPF (Nigg, 1993Go). Moreover, a role for oocyte MPF and possibly mitogen-activated protein kinase (MAPK) activities in nuclear remodeling has been recognized for years based on experiments in the mouse documenting NEBD within 30 min of nuclear transfer followed by PCC when the non-activated MII oocyte was used as a recipient cytoplast, (Czolowska et al., 1984Go; Latham, 2005Go) and the loss of this ability in activated cytoplasts (Szollosi et al., 1988Go; Gao et al., 2004Go). Extended exposure of donor chromatin to non-activated MII cytoplast has been associated with improved reprogramming and development following SCNT presumably reflecting more robust remodeling (Cibelli et al., 1998Go; Wakayama et al., 1998Go). In contrast, partial or incomplete NEBD and PCC has been reported in bovine, porcine and sheep SCNT embryos, and in the present study with monkey embryos, and associated with inefficient reprogramming (Hall et al., 2005Go; Kawahara et al., 2005Go; Lee and Campbell, 2006Go). However, the universal role of nuclear remodeling in reprogramming following SCNT remains unclear as a recent report concluded that PCC is not essential for reprogramming in bovine SCNT (Sung et al., 2007Go). Here, we demonstrated that robust nuclear remodeling following modified SCNT was associated with remarkably improved in vitro development in the monkey. Conversely, SCNT embryos reconstructed by conventional approaches displayed incomplete NEBD and PCC and failed to develop to blastocysts. Although it should be noted that due to the lack of sufficient numbers, monkey oocytes were not randomly allocated to experimental SCNT treatments precluding robust comparisons between results.

Strategies designed to increase MPF and MAPK activities have been reported including the use of caffeine, a protein phosphatase inhibitor (Kawahara et al., 2005Go; Lee and Campbell, 2006Go) or the proteasome inhibitor, MG-132 (Zhou et al., 2003Go). When used in SCNT protocols, these treatments increased the occurrence of remodeling events in the donor nucleus. Alternatively, pre-treatment of donor cells with mitotic cell extracts facilitated PCC and was associated with improved reprogramming and development of SCNT embryos (Sullivan et al., 2004Go). Interestingly, the first successful cloning of rats was achieved using brief exposure of MII oocytes to MG-132 to prevent spontaneous activation (Zhou et al., 2003Go). In pigs, a short exposure to MG-132 in the first 2 h after SCNT resulted in improved embryonic development, blastocyst quality and live birth suggesting that this treatment was at least compatible with normal development (Prather et al., 2004Go). However, MG-132 treatment of mouse SCNT embryos resulted in increased blastocyst formation levels without an effect on term development rates (Gao et al., 2005Go). Thus, inhibition of proteasome activity may overcome some detrimental effects of oocyte manipulation, such as premature activation, but impacts subsequent developmental events, as seen in the present study with fertilized monkey embryos. In contrast, elevated MPF levels achieved by exposure to less toxic caffeine, resulted in high cleavage rates and timely blastocyst development of monkey SCNT embryos.

Here, we also demonstrated that monkey oocytes are particularly vulnerable to premature activation and MPF degradation during in vitro manipulations, a likely characteristic of primates but with potential relevance to SCNT success in other mammals. It is appropriate to add that since aged oocytes also show a tendency to undergo spontaneous activation, it follows that therapeutic cloning or ESC derivation trials from discarded, aged or failed-to-fertilize human oocytes are unlikely to succeed.

Species-specific challenges in non-human primate SCNT embryo development were claimed to be a consequence of the depletion of microtubule and centrosomal proteins during oocyte enucleation with subsequent formation of defective mitotic spindles originating from the transferred nucleus (Simerly et al., 2003Go). Thus, reproductive cloning in non-human primates was concluded to be unachievable (Simerly et al., 2003Go). However, results of this study and previously published reports (Ng et al., 2004Go; Zhou et al., 2006Go) suggest that obstacles in monkey SCNT are most likely due to incomplete reprogramming and can be overcome by protocol alterations. Since conventional SCNT protocols have failed in monkeys, alternatives have been sought for a number of years. Modified protocols described by us previously (Zhou et al., 2006Go) and in this study resulted in the production of reconstructed embryos that develop to the blastocyst stage in vitro after using a variety of somatic cell types as the nuclear donor cell. Several changes in protocol appear fundamental to this success. The first modification involves spindle removal. BisBenzimide staining of oocytes followed by UV exposure is a standard enucleation procedure in many nuclear transfer protocols, for instance, resulting in live offspring in sheep, cattle and pigs (Wells et al., 1997Go, 1999Go; Cibelli et al., 1998Go; Polejaeva et al., 2000Go). However, in the relatively transparent monkey oocyte, potential detrimental effects of bisBenzimide staining, UV illumination or a combination of both on the developmental potential of the reconstructed embryo were apparent. Secondly, spindle removal and/or introduction of the donor cell nucleus by electrofusion with concurrent activation of the recipient cytoplast was also implicated as a mechanism to account for premature cytoplast activation and SCNT failure. Electroporation in Ca2+-containing fusion medium has resulted in increased intracellular calcium levels which, in turn, trigger a rapid decline in histone H1 kinase and, possibly, MPF activity (Mitalipov et al., 1999Go). The exclusion of Ca2+ from the electrofusion buffer with subsequent exposure of the transferred SN to non-activated cytoplast has also been associated with improved in vitro and in vivo development of cloned pig embryos (Boquest et al., 2002Go). We substituted the electrofusion step with direct intracytoplasmic injection of donor nuclei similar to that developed initially in the mouse (Wakayama et al., 1998Go) or electrofusion in Ca2+ and Mg2+ free buffer. In addition, to further minimize the possibility of premature cytoplast activation, all manipulations were performed in Ca2+- and Mg2+-free medium. Under these modified conditions, lamin A/C profiles in reconstructed embryos were similar to those detected in sperm-fertilized control embryos. The achievement of reproducible blastocyst in vitro development rates from multiple donor cell types is a breakthrough that allows, for the first time, characterization of SCNT blastocysts in this species. However, the ultimate test is to demonstrate normal term development following embryo transfer. Limited embryo transfer trials involving monkey SCNT embryos have not yet resulted in term development suggesting either a restricted in vivo developmental potential of these embryos or inadequate trials (Ng et al., 2004Go; Simerly et al., 2004Go; Zhou et al., 2006Go). The in vivo developmental potential of SCNT embryos in species in which cloning is routine remains extremely low; less than 3% of transferred cattle, sheep, pig and mice SCNT embryos reconstructed from various somatic cell nuclei result in live offspring with the majority of embryos failing before or soon after implantation (Yanagimachi, 2002Go). This suggests that additional embryo transfer efforts are needed to confirm the in vivo developmental potential of monkey SCNT embryos.

In summary, we found lamin A/C expression to be a useful tool for rapidly monitoring remodeling events in individual cytoplasts/reconstructed embryos during SCNT. This could be especially relevant in species where MPF levels may be inherently low secondary to in vitro maturation, premature activation or oocyte recovery from animals subjected to ovarian stimulation (Hiiragi and Solter, 2005Go), despite the ability of IVF- or ICSI-produced embryos from such oocytes in many cases to develop readily into blastocysts in vitro and support term births following embryo transfer. We provided evidence in individual cytoplasts, albeit indirect, that the extent of nuclear remodeling is MPF dependent, since it is well documented that MPF plays a major role in nuclear lamina disassembly, NEBD and PCC. Direct assessment of MPF activity, while possible, is highly impractical in the monkey as relatively large numbers of oocytes/cytoplasts would be required to provide averaged rather than individual values.

The availability of reliable, efficient methods for producing viable SCNT embryos in the monkey should support the derivation, characterization and transplantation of autologous, immunocompatible ESCs in efforts to restore form and function to damaged tissues in a preclinical model. However, our goal of producing neurodegenerative disease models in the monkey from gene targeted donor cells will require pregnancy establishment following SCNT embryo transfer into synchronized recipients.


    Acknowledgements
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The authors acknowledge the Division of Animal Resources and the Endocrine Services Core at the Oregon National Primate Research Center for their assistance and technical services. We are grateful to Lisa Clepper, Cathy Ramsey, Michelle Sparman, Carrie Thomas, Mary Ann Zink and Daniel Meehan for their technical assistance; Dr John Fanton and Darla Jacobs for laparoscopic oocyte retrieval; Julianne White for administrative support and Joel Ito for help with illustration materials. The ART Core facility assisted by providing semen samples, oocytes and media. This study was supported by NIH grants NS044330 and RR16030 to S. Mitalipov, HD18185 to R. Stouffer and RR00163 to D. Dorsa; the Chinese Academy of Sciences KSCX1-05, and Major State Research Development Program 2006CB701500.


    References
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Bavister BD, Yanagimachi R. The effects of sperm extracts and energy sources on the motility and acrosome reaction of hamster spermatozoa in vitro. Biol Reprod (1977) 16:228–237.[Abstract]

Boquest AC, Grupen CG, Harrison SJ, McIlfatrick SM, Ashman RJ, d'Apice AJ, Nottle MB. Production of cloned pigs from cultured fetal fibroblast cells. Biol Reprod (2002) 66:1283–1287.[Abstract/Free Full Text]

Campbell KH. Nuclear transfer in farm animal species. Semin Cell Dev Biol (1999) 10:245–252.[CrossRef][Web of Science][Medline]

Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, Ponce de Leon FA, Robl JM. Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science (1998) 280:1256–1258.[Abstract/Free Full Text]

Czolowska R, Modlinski JA, Tarkowski AK. Behaviour of thymocyte nuclei in non-activated and activated mouse oocytes. J Cell Sci (1984) 69:19–34.[Abstract]

Fluckiger AC, Marcy G, Marchand M, Negre D, Cosset FL, Mitalipov S, Wolf D, Savatier P, Dehay C. Cell cycle features of primate embryonic stem cells. Stem Cells (2006) 24:547–556.[CrossRef][Web of Science][Medline]

Fulka J Jr, Loi P, Fulka H, Ptak G, Nagai T. Nucleus transfer in mammals: noninvasive approaches for the preparation of cytoplasts. Trends Biotechnol (2004) 22:279–283.[CrossRef][Web of Science][Medline]

Gao S, Chung YG, Parseghian MH, King GJ, Adashi EY, Latham KE. Rapid H1 linker histone transitions following fertilization or somatic cell nuclear transfer: evidence for a uniform developmental program in mice. Dev Biol (2004) 266:62–75.[CrossRef][Web of Science][Medline]

Gao S, Han Z, Kihara M, Adashi E, Latham KE. Protease inhibitor MG132 in cloning: no end to the nightmare. Trends Biotechnol (2005) 23:66–8.[CrossRef][Web of Science][Medline]

Hall VJ, Cooney MA, Shanahan P, Tecirlioglu RT, Ruddock NT, French AJ. Nuclear lamin antigen and messenger RNA expression in bovine in vitro produced and nuclear transfer embryos. Mol Reprod Dev (2005) 72:471–82.[CrossRef][Web of Science][Medline]

Hiiragi T, Solter D. Reprogramming is essential in nuclear transfer. Mol Reprod Dev (2005) 70:417–421.[CrossRef][Web of Science][Medline]

Hutchison CJ, Worman HJ. A-type lamins: guardians of the soma? Nat Cell Biol (2004) 6:1062–1067.[CrossRef][Web of Science][Medline]

Josefsberg LB, Galiani D, Dantes A, Amsterdam A, Dekel N. The proteasome is involved in the first metaphase-to-anaphase transition of meiosis in rat oocytes. Biol Reprod (2000) 62:1270–1277.[Abstract/Free Full Text]

Kawahara M, Wakai T, Yamanaka K, Kobayashi J, Sugimura S, Shimizu T, Matsumoto H, Kim JH, Sasada H, Sato E. Caffeine promotes premature chromosome condensation formation and in vitro development in porcine reconstructed embryos via a high level of maturation promoting factor activity during nuclear transfer. Reproduction (2005) 130:351–357.[Abstract/Free Full Text]

Kirchoff V, Wong S, St JS, Pari GS. Generation of a life-expanded rhesus monkey fibroblast cell line for the growth of rhesus rhadinovirus (RRV). Arch Virol (2002) 147:321–333.[CrossRef][Web of Science][Medline]

Latham KE. Early delayed aspects of nuclear reprogramming during cloning. Biol Cell (2005) 97:119–132.[CrossRef][Web of Science][Medline]

Lee JH, Campbell KH. Effects of enucleation caffeine on maturation- promoting factor (MPF), mitogen-activated protein kinase (MAPK) activities in ovine oocytes used as recipient cytoplasts for nuclear transfer. Biol Reprod (2006) 74:691–698.[Abstract/Free Full Text]

Marangos P, Carroll J. Fertilization and InsP3-induced Ca2 + release stimulate a persistent increase in the rate of degradation of cyclin B1 specifically in mature mouse oocytes. Dev Biol (2004) 272:26–38.[CrossRef][Web of Science][Medline]

McKiernan SH, Bavister BD. Culture of one-cell hamster embryos with water soluble vitamins: pantothenate stimulates blastocyst production. Hum Reprod (2000) 15:157–164.[Abstract/Free Full Text]

Meng L, Ely JJ, Stouffer RL, Wolf DP. Rhesus monkeys produced by nuclear transfer. Biol Reprod (1997) 57:454–459.[Abstract]

Mitalipov SM, Kuo HC, Hennebold JD. Oct-4 expression in pluripotent cells of the rhesus monkey. Biol Reprod (2003) 69:1785–1792.[Abstract/Free Full Text]

Mitalipov SM, Nusser KD, Wolf DP. Parthenogenetic activation of rhesus monkey oocytes and reconstructed embryos. Biol Reprod (2001) 65: 253–9.[Abstract/Free Full Text]

Mitalipov SM, White KL, Farrar VR, Morrey J, Reed WA. Development of nuclear transfer and parthenogenetic rabbit embryos activated with inositol 1,4,5-trisphosphate. Biol Reprod (1999) 60:821–827.[Abstract/Free Full Text]

Mitalipov SM, Yeoman RR, Nusser KD, Wolf DP. Rhesus monkey embryos produced by nuclear transfer from embryonic blastomeres or somatic cells. Biol Reprod (2002) 66:1367–1373.[Abstract/Free Full Text]

Moreira PN, Robl JM, Collas P. Architectural defects in pronuclei of mouse nuclear transplant embryos. J Cell Sci (2003) 116:3713–3720.[Abstract/Free Full Text]

Ng SC, Chen N, Yip WY, Liow SL, Tong GQ, Martelli B, Tan LG, Martelli P. The first cell cycle after transfer of somatic cell nuclei in a non-human primate. Development (2004) 131:2475–2484.[Abstract/Free Full Text]

Nigg EA. Targets of cyclin-dependent protein kinases. Curr Opin Cell Biol (1993) 5:187–193.[CrossRef][Medline]

Polejaeva IA, Chen SH, Vaught TD, Page RL, Mullins J, Ball S, Dai Y, Boone J, Walker S, Ayares DL, et al. Cloned pigs produced by nuclear transfer from adult somatic cells. Nature (London) (2000) 407:86–90.[CrossRef][Medline]

Prather RS, Sims MM, Maul GG, First NL, Schatten G. Nuclear lamin antigens are developmentally regulated during porcine and bovine embryogenesis. Biol Reprod (1989) 41:123–132.[Abstract]

Prather RS, Sutovsky P, Green JA. Nuclear remodeling and reprogramming in transgenic pig production. Exp Biol Med (Maywood) (2004) 229:1120–1126.[Abstract/Free Full Text]

Schatten G, Maul GG, Schatten H, Chaly N, Simerly C, Balczon R, Brown DL. Nuclear lamins and peripheral nuclear antigens during fertilization and embryogenesis in mice and sea urchins. Proc Natl Acad Sci USA (1985) 82:4727–4731.[Abstract/Free Full Text]

Schramm RD, Bavister BD. Onset of nucleolar and extranucleolar transcription and expression of fibrillarin in macaque embryos developing in vitro. Biol Reprod (1999) 60:721–728.[Abstract/Free Full Text]

Simerly C, Dominko T, Navara C, Payne C, Capuano S, Gosman G, Chong KY, Takahashi D, Chace C, Compton D, et al. Molecular correlates of primate nuclear transfer failures. Science (2003) 300:297.[Free Full Text]

Simerly C, Navara C, Hyun SH, Lee BC, Kang SK, Capuano S, Gosman G, Dominko T, Chong KY, Compton D, et al. Embryogenesis and blastocyst development after somatic cell nuclear transfer in nonhuman primates: overcoming defects caused by meiotic spindle extraction. Dev Biol (2004) 276:237–252.[CrossRef][Web of Science][Medline]

Sullivan EJ, Kasinathan S, Kasinathan P, Robl JM, Collas P. Cloned calves from chromatin remodeled in vitro. Biol Reprod (2004) 70:146–153.[Abstract/Free Full Text]

Sung LY, Shen PC, Jeong BS, Xu J, Chang CC, Cheng WT, Wu JS, Lee SN, Broek D, Faber D, et al. Premature chromosome condensation is not essential for nuclear reprogramming in bovine somatic cell nuclear transfer. Biol Reprod (2007) 76:232–240.[Abstract/Free Full Text]

Szollosi D, Czolowska R, Szollosi MS, Tarkowski AK. Remodeling of mouse thymocyte nuclei depends on the time of their transfer into activated, homologous oocytes. J Cell Sci (1988) 91:603–613.[Abstract/Free Full Text]

Wakayama T, Perry AC, Zuccotti M, Johnson KR. Yanagimachi R. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature (1998) 394:369–374.[CrossRef][Medline]

Wells DN, Misica PM, Day TA, Tervit HR. Production of cloned lambs from an established embryonic cell line: a comparison between in vivo- and in vitro-matured cytoplasts. Biol Reprod (1997) 57:385–393.[Abstract]

Wells DN, Misica PM, Tervit HR. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod (1999) 60:996–1005.[Abstract/Free Full Text]

Wilson JF, Erlandsson R. Sexing of human and other primate DNA. Biol Chem (1998) 379:1287–1288.[Web of Science][Medline]

Wolf DP, Thormahlen S, Ramsey C, Yeoman RR, Fanton J, Mitalipov S. Use of assisted reproductive technologies in the propagation of rhesus macaque offspring. Biol Reprod (2004) 71:486–493.[Abstract/Free Full Text]

Yanagimachi R. Cloning: experience from the mouse and other animals. Mol Cell Endocrinol (2002) 187:241–248.[CrossRef][Web of Science][Medline]

Zelinski-Wooten MB, Hutchison JS, Hess DL, Wolf DP, Stouffer RL. Follicle stimulating hormone alone supports follicle growth and oocyte development in gonadotrophin-releasing hormone antagonist-treated monkeys. Hum Reprod (1995) 10:1658–1666.[Abstract/Free Full Text]

Zhou Q, Renard JP, Le Friec G, Brochard V, Beaujean N, Cherifi Y, Fraichard A, Cozzi J. Generation of fertile cloned rats by regulating oocyte activation. Science (2003) 302:1179.[Free Full Text]

Zhou Q, Yang SH, Ding CH, He XC, Xie YH, Hildebrandt TB, Mitalipov SM, Tang XH, Wolf DP, Ji WZ. A comparative approach to somatic cell nuclear transfer in the rhesus monkey. Hum Reprod (2006) 10:2564–2571.

Submitted on December 26, 2006; resubmitted on February 20, 2007; accepted on April 17, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Med. EthicsHome page
S Camporesi and L Bortolotti
Reproductive cloning in humans and therapeutic cloning in primates: is the ethical debate catching up with the recent scientific advances?
J. Med. Ethics, September 1, 2008; 34(9): e15 - e15.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
B.V. Johnson, N. Shindo, P.D. Rathjen, J. Rathjen, and R.A. Keough
Understanding pluripotency--how embryonic stem cells keep their options open
Mol. Hum. Reprod., September 1, 2008; 14(9): 513 - 520.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. A. Byrne
Generation of isogenic pluripotent stem cells
Hum. Mol. Genet., April 15, 2008; 17(R1): R37 - R41.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
22/8/2232    most recent
dem136v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitalipov, S.M.
Right arrow Articles by Wolf, D.P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitalipov, S.M.
Right arrow Articles by Wolf, D.P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?