Hum. Reprod. Advance Access originally published online on July 18, 2007
Human Reproduction 2007 22(9):2528-2537; doi:10.1093/humrep/dem222
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cyclosporine A induces titin expression via MAPK/ERK signalling and improves proliferative and invasive potential of human trophoblast cells
1 Laboratory for Reproductive Immunology, Hospital and Institute of Obstetrics and Gynecology, Fudan University Shanghai Medical College, Shanghai 200011, Peoples Republic of China 2 Department of Obstetrics and Gynecology, The Affiliated Hospital, Hainan Medical College, Haikou 570102, Peoples Republic of China
3 Correspondence address. Laboratory for Reproductive Immunology, Hospital and Institute of Obstetrics and Gynecology, Fudan University Shanghai Medical College, Shanghai 200011, Peoples Republic of China. Tel, Fax: +86 21 6345 7331; E-mail: djli{at}shmu.edu.cn
| Abstract |
|---|
|
|
|---|
BACKGROUND: Cyclosporin A (CsA) is a powerful immunosuppressive that has been widely used to prevent organ rejection and to treat certain autoimmune diseases. Our previous study showed that CsA at low concentrations could promote proliferation and invasion, and inhibit apoptosis, of human first trimester trophoblasts. In the present study, we further explored the potential mechanism and signal pathway.
METHODS: After treatment of JAR cells with CsA, we screened the differentially expressed genes by suppression subtractive hybridization (SSH), and characterized the differentially expressed gene, titin, in human first-trimester trophoblasts by reverse transcription–polymerase chain reaction and Western blot. Mitogen-activated protein kinase (MAPK) activity was evaluated by ELISA.
RESULTS: CsA stimulated proliferation and invasion of human trophoblasts in a dose-dependent manner, and this appeared to be positive correlated with titin transcription, suggesting that CsA regulates biological functions of human trophoblast by inducing titin expression. Furthermore, the CsA treatment increased the MAPK activity, and blocking of the signaling pathway by Mitogen-activated protein MAPK (MEK) inhibitor, U0126, inhibited CsA-induced titin transcription in trophoblasts.
CONCLUSIONS: Our results indicate that titin expression is induced by CsA via activation of MAPK pathways and this may possibly be involved in promoting human trophoblast growth and invasiveness, which is beneficial to embryo viability.
Key words: cyclosporin A/proliferation and invasion/titin/MAPK/ERK/trophoblast
| Introduction |
|---|
|
|
|---|
Since the embryo expresses paternal antigens foreign to the mother, the maternal immune system, must tolerate the persistence of paternal alloantigen in a successful pregnancy; otherwise, it would reject the embryo, leading to pregnancy wastage. Maternal immune rejection against her fetus is postulated to be an important cause of unexplained pregnancy loss. For many years, the term fetal allograft has been widely used for description of fetal immunological status during pregnancy. The idea of materno-fetal tolerance itself, however, was first recognized and discussed in depth by Sir Peter Medawar (1953)
A successful pregnancy is a complex programme, which requires not only maternal tolerance to an allogeneic fetus, but also the most fascinating properties of trophoblast cells. The first-trimester trophoblast cells proliferate, migrate and invade into the decidua and decidual vasculature in order to nourish the developing fetus, in a way i.e. imitated by malignant tumour. Either insufficient invasion or inadequate proliferation can contribute to spontaneous pregnancy loss, intrauterine growth retardation, pregnancy-induced hypertension or pre-eclampsia (Qumsiyeh et al., 2000
; Lyall et al., 2001
; Olivares et al., 2002
; Crocker et al., 2003
; Greer, 2003
; Bose et al., 2005
). Our previous studies have found that treatment with CsA at low dosage can promote proliferation and invasion of human first-trimester trophoblast and in mice, increase fetal viability in abortion-prone matings to levels observed with normal pregnant matings (Yan et al., 2002
; Du et al., 2007
). Thus it is possible that CsA exerts a dual regulatory effect at the materno-fetal interface, i.e. stimulating trophoblast and suppressing maternal immuno-competent cell functions. However, the mechanism by which CsA regulates the trophoblast functions is still unclear.
Titin is a giant sarcomeric protein responsible for the elasticity of striated muscle. Accumulating evidence has suggested a role for titin not only in myofibrillar assembly and muscle elasticity, but potentially in the architecture of mitotic chromosomes (Machado et al., 1998
). It was reported that titin is expressed in the terminal web region of the brush border array of microvilli of intestinal epithelial cells, where it is thought to mediate the association of myosin II and alpha-actinin with the cytoskeleton (Eilertsen and Keller, 1992
). Recently, Opitz et al. (2004) showed evidence of a previously unknown isoform of titin, termed as N2BA-1, and this novel isoform is dominant in the fetus and almost absent by birth in the rat. Thus it is likely that titin expression in the fetus may be involved in the process of placentation and embryo development.
In this study, we observed the effects of CsA on proliferation and invasiveness of human trophoblasts, and then screened for the differentially expressed genes by suppression subtractive hybridization (SSH) in order to investigate the functional genes that mediate the biological functions of CsA in these cells. We then confirmed the up-regulation of titin gene expression in human first-trimester trophoblast cells by reverse transcription–polymerase chain reaction (RT–PCR) and Western blot, and investigated the potential signal pathways involved in the proliferative and invasive improvement of human trophoblast cells by CsA.
| Materials and Methods |
|---|
|
|
|---|
Isolation and cultivation of human first-trimester trophoblast
First-trimester human placentas (6–9 weeks of gestation) were obtained from clinically normal pregnancies which were terminated for non-medical reasons, at the Hospital of Obstetrics and Gynecology, Fudan University Shanghai Medical College. The study has been approved by the Fudan University Human Investigation Committee, and each patient completed a signed, written consent form.
The trophoblast cells were isolated by trypsin-DNase I digestion, and discontinuous Percoll gradient centrifugation, as described by our previous study (Wu et al., 2004
). This assay supplies a 95% purity of trophoblast cells. The isolated human trophoblast cells and the choriocarcinoma JAR cell line were cultured in DMEM supplemented with 2 mM glutamine, 10% heat inactivated FCS, 25 mM HEPES, 100 UI/ml penicillin and 100 µg/ml streptomycin at 37°C in 95% air and 5% CO2.
[3H]-Thymidine incorporation forhuman trophoblast proliferation
The effect of CsA on human trophoblast cell proliferation was measured by using the [3H]-thymidine incorporation assay. The isolated trophoblast cells and JAR cells were seeded at a density of 2–3 x 104 cells/well into 96-well, round-bottom microtiter plates (Nunc, Roskilde, Denmark) in a final volume of 100 µl of complete medium. The cells were treated with a series of doses of CsA (0, 0.0001, 0.001, 0.01, 0.1, 1 and 10 µmol/l) in DMEM containing 2% FBS for 42 h after 12 h of serum-starvation. [3H]-thymidine (1 µCi/well) was added to each well and incubated for an additional 6 h, and then the cells were harvested onto a glass-fiber paper using a semiautomatic cell harvester, and the thymidine incorporation was measured in a liquid scintillation counter. Ten independent experiments were performed, each in triplicate (involving 41 placentas).
Propidium iodide staining and flow cytometry
The trophoblast cells were synchronized, and stimulated with increasing doses of CsA in DMEM containing 2% FBS for 48 h. After being harvested and fixed overnight with 70% ethanol at 4°C, the cells were pelleted, resuspended in 0.5 ml of PBS containing RNase (100 µg/ml), incubated at 37°C for 30 min, and stained for 10 min at room temperature with propidium iodide (50 µg/ml). All analysis was conducted on a BD Biosciences FACScan flow cytometer. Ten independent experiments were performed, each in triplicate. The purified trophoblast cells were derived from 40 placental samples.
Scanning electron microscopy
Trophoblast cells were seeded at a density of 5 x 105 on the 25 mm round glass coverslips in six-well plates overnight (37°C, 5% CO2), and then treated with a series of doses of CsA (0, 0.01, 0.1, 1 and 10 µmol/l) for 48 h. The cells were fixed with 3% glutaraldehyde in 0.1 mol/l cacodylate buffer (pH 7.4), and post-fixed with 2% osmium tetroxide OsO4. The samples were dehydrated by using graded ethanol, coated with gold and examined by using a scanning electron microscope (DSM 950; Carl Zeiss, Inc., Thornwood, NJ, USA).
Matrigel invasion assay
To evaluate the effect of CsA on invasiveness of human trophoblast cells, transwell inserts (6.5-mm filters, 8 µm pore size; Corning, Corning, NY, USA) containing polycarbonate filters were used. The upper side was coated with 25 µl of diluted Matrigel (1:2 in serum-free DMEM) and allowed to gel. The cells (1 x 105 cells) were plated in 200 µl DMEM with 2% FBS in the presence or absence of CsA (0, 0.001, 0.01, 0.1, 1 and 10 µmol/l) and/or mitomycin C (10 µg/ml) to the transwell. The lower chamber was filled with 600 µl DMEM with 10% FBS. After 48 h of incubation at 37°C, 5% CO2, the cells from the upper surface of the filter were completely removed with gentle swabbing, and the migrant cells of the lower surface were fixed in methanol for 10 min at room temperature, and stained with hematoxylin. The invasion was determined by counting the number of stained cells on the membranes in 10 randomly selected, non-overlapping fields at x200 magnification using a light microscope. Each condition was tested in triplicate wells, and the experiments were repeated 10 times. The purified trophoblast cells were derived from 43 placental samples.
RNA isolation
Total JAR RNA was isolated using TriZol (Invitrogen, Carlsbad, CA, USA), and mRNAs were purified by the Oligotex mRNA purification system (QIAGEN, Santa Clara, CA, USA), treated with DNaseI to remove genomic DNA, then extracted by acid phenol and precipitated with ethanol.
SSH and analysis of the subtracted cDNAs
A PCR-based SSH was performed according to Diatchenko using the PCR-Select cDNA Subtraction kit (Clontech, Nottinghamshire, UK) following the manufacturer's instructions (Diatchenko et al., 1996
). Briefly, the mix of cDNAs that were reverse-transcribed from 2 µg mRNA of JAR treated with 1.0 µmol/l of CsA for three days was used as a tester, and the cDNA from untreated JAR was used as a driver. The cDNAs were digested with RsaI and then ligated to different adapters. Two rounds of hybridization and PCR amplification were processed to normalize, and enrich the differentially expressed cDNAs. After SSH, the PCR products were subcloned into PCR 2.1-TOPO vector (TOPO TA Cloning kits, Invitrogen, CA, USA), then transformed into the Escherichia coli strain of competent JM109 cells (Promega, Madison, WI, USA). Colonies were grown for 16 h at 37°C on Luria-Bertani agar plates containing ampicillin, X-gal and isopropylthio-D-galactoside (IPTG) for blue/white colony selection. The positive colonies were picked randomly for plasmid extraction, and screened by size after PCR amplification of the insert, and then subjected to sequence analysis. Sequence homology was analyzed using the BLAST program. All the sequences were subjected to a homology search through the BLASTX program (http://ncbi.nlm.nih.gov/BLAST/).
RT–PCR analysis of titin expression in human first-trimester trophoblast
The isolated trophoblast cells were seeded at a density of 5 x 105 cells/well on 6-well plates. After culture in DMEM with 1% FBS for 12 h, the cells were treated with a series of concentrations of CsA (0, 0.01, 0.1, 1 and 10 µmol/l) or stimulated with the combinations of 1.0 µmol/l CsA with different concentrations of U0126 for the indicated duration of incubation at 37°C. Total cellular RNA of these cells was extracted using Trizol reagent (Life Technologies, Merelbeke, Belgium).
The total RNA of 2 µg was denatured, and RT was performed for 1 h at 42°C with 0.5 µg Oligo (dT)18, 1 mM 4dNTP, 20 U RNasin Ribonuclease inhibitor (Promega, Madison, Wisconsin), 200 U Moloney virus-reverse transcriptase (Superscript II; Life Technologies, Paisley, United Kingdom) and 5x reaction buffer in a total volume of 20 µl. Amplification was performed with 5 µl cDNA, 0.2 mM dNTP, 1 mM MgCl2, 2.5 U AmpliTaq DNA Polymerase (Perkin-Elmer, Norwalk, Conn), 0.8 mM specific sense and antisense primers and 10x reaction buffer in a 50 µl reaction volume. The primers used for the titin and house keeping gene
-actin were indicated as following: titin: sense primer: 5'aagccaacagtggacgat3', antisense primer: 5'gtggcatttacagaataggtc3';
-actin: sense primer: 5'ggacttcgagcaagagatgg 3', antisense primer: 5'agcactgtgttggcgtacag 3'. After 5 min precycle at 95°C, the reaction was followed by 30 cycles of 1 min at 94°C, 1 min at 55°C and 1 min at 72°C. When the final cycle was over, samples were kept at 72°C for 15 min for the further extension. The PCR reaction products of 10 µl were electrophoresed on 1.5% agarose gels and ethidium bromide-stained bands were photographed, and analysed by gel imaging systems. The relative intensity of titin is the ratio of absorbance value of titin to that of
-actin. Four independent experiments were performed, each in triplicate (involving 18 placental samples).
Immunohistochemistry for titin in placental bed sampling
Paraffin-embedded sections of human first-trimester placental bed samples were deparaffinized, rehydrated and antigen retrieved. Endogenous peroxides activity was quenched with 3% H2O2. Samples were covered with normal blocker serum and incubated with mouse anti-human titin antibody (CHEMICON, Temecula, CA, USA) or CK7 antibody (Zymed Laboratories, USA) overnight at 4°C. The sections were then treated with appropriate avidin–biotin histostain kit according to the manufacturer's instructions (Sino-America). Slides were stained with DAB and counterstained with haematoxylin. The isotype-matched control antibodies were used to exclude non-specific staining.
Protein extraction and immunoblot
After being serum-starved overnight, and then treated with 1.0 µmol/l of CsA for 72 h, the first-trimester human trophoblast cells and JAR cells were lysed in RIPA buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 10 mM NaF, 0.25% sodium deoxycholate, 1 mM EDTA, 1 mM PMSF and phosphatase inhibitors; Roche), and the extracts were incubated for 20 min on ice and cleared by centrifugation. The cell lysates were assayed for protein contents using the Bradford protein assay. The samples were separated by 2–10% (50 µg/lane) and transferred onto nitrocellulose membranes. Membranes were blocked in Tris-buffered saline, pH 7.4, 0.1% Tween-20 with 5% non-fat milk/blotto, incubated overnight at 4°C with primary antibody titin (Abcam, Cambridge, UK) (1:5000 dilution) in blocking buffer, washed with Tris-buffered saline, pH 7.4, 0.1% Tween-20 and incubated with horseradish peroxidase secondary antibodies. The bands were visualized with the enhanced chemiluminescence detection kit (ECL, Amersham Pharmacia Biotech). The experiments were carried out in triplicate, and repeated three times (involving 15 placental samples).
MAPK activity assay
The trophoblast cells were serum-starved overnight, and treated with diverse concentrations of CsA for indicated times. The cells were lysed in RIPA buffer, and an assay of kinase activity was carried out by using non-radioactive MAPkinase (ERKone-half) activity assay kits (CHEMICON, Temecula, CA, USA) according to the instruction manuals. The MAPK activity was expressed as the ratio of absorbance in treatment group to vehicle control. The experiments were carried out in triplicate, and repeated three times (involving 15 placental samples).
Statistical analysis
All values were expressed as the mean ± SD. Data were analysed using two-way ANOVA, with application of Dunnett' test. Differences were considered as statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
CsA at low concentrations promoted human first-trimester trophoblast proliferation
To probe into modulation of CsA on biological functions of human trophoblast, we first evaluated its effect on cell proliferation. As shown in Fig. 1, within 0.0001–1.0 µmol/l ranges of concentrations, CsA promoted the trophoblast proliferation in a dose-dependent manner. However, the higher dosage of CsA, 10 µmol/l, resulted in a reduction in proliferation of the cells, suggesting that CsA caused different effects on trophoblasts depending on the concentration: low concentrations of CsA promoted human trophoblast cell proliferation, whereas the higher concentration of CsA decreased proliferation of trophoblast (P < 0.05, P < 0.01, P < 0.01, P < 0.01 and P < 0.05). Likewise, CsA affected JAR cell proliferation in a similar manner. Because the purity of the isolated human trophoblast cells is 95%, it is possible that CsA might also be promoting the proliferation of non-trophoblast cells.
|
CsA may regulate human first-trimester trophoblast cell cycle
A change of cell cycle would affect cell proliferation. Since CsA showed a dose-dependent effect on human trophoblast proliferation, we investigated whether CsA influences the cell cycle parameters of the trophoblast. We found, by flow cytometry, that the S phase of the trophoblasts increased, and apoptosis decreased, after the cells had been treated with 1.0 µmol/l CsA for 48 h (P < 0.01). However, when the concentration of CsA reached 10 µmol/l, the S phase decreased, and apoptosis increased (P < 0.01, Fig. 2). Therefore, it seems that the effect of CsA on human trophoblast proliferation may in part be due to changes in the cell cycle.
|
CsA-induced morphological changes of human first-trimester trophoblast
We observed the cell morphology by using scanning electron microscopy, and found that the first-trimester human trophoblast cells elongated after treatment with CsA, whereas the cells displayed the cuboidal appearance without CsA treatment. Moreover, the CsA-treated cells formed more pseudopodia. The size and number of the pseudopodia increased along with the increase in CsA concentration. However, when the concentration of CsA was up to 10 µmol/l, fewer pseudopodia were protruding, indicating that the effect of CsA was dose-related (Fig. 3).
|
CsA improved invasiveness of human first-trimester trophoblast
To test the effects of CsA on human trophoblast cell invasion, a Matrigel-based transwell assay was carried out. The trophoblasts were added into the upper chamber, and a serum gradient was used between the upper and the lower chamber in order to accelerate cell invasion. As shown in Fig. 4, CsA substantially increased invasiveness of human first-trimester trophoblast cells in a specific dose-responsive manner, which was consistent with the results of our other study (Zhou et al., 2007
|
Since CsA could increase human trophoblast invasion, and meanwhile promote the cell proliferation, the enhanced invasiveness induced by CsA may be coupled to the increased proliferation. Hence, we evaluated the invasiveness in the presence of the antimitotic agent mitomycin C, an inhibitor of DNA replication. In fact, treatment with mitomycin C inhibited cell replication by 90%, and reduced the number of cells which invaded through the polycarbonate membranes, but had no effect on the invasiveness relative to that of respective vehicle-control group (2.71 versus 2.67, Fig. 4B). Hence, only the number of cells invading, but not the fold increase in invasion, depended on cell proliferation.
Differentially expressed functional genes in the CsA-treated JAR cells by suppression substractive hybridization
Following SSH, 39 positive colonies containing differentially expressed cDNA were obtained, and then subjected to sequence analysis. Sequence homology was evaluated using the BLAST program. As shown in Table 1, there were six genes that were expressed differentially after treatment with CsA. Of the 39 colonies, almost half contained the cDNA for titin, two were predicted genes and three were ESTs located on chromosome 16, suggesting overall that the titin gene was the most abundantly up-regulated of the six differentially expressed genes.
|
Titin transcription increased in the CsA-treated human first-trimester trophoblast
As shown in Fig. 5A, treatment with various concentrations of CsA increased the transcription of titin in trophoblast cells in a dose-dependent manner. The ratios of the band intensities of titin to that of
-actin were 0.167 ± 0.042, 0.301 ± 0.056, 0.512 ± 0.063 and 0.908 ± 0.097, respectively. Then we further observed the transcription of titin in the primary cultured first-trimester trophoblast cells after treatment with 1.0 µmol/l CsA for different times. The results in Fig. 5B showed that titin transcription increased slightly after CsA treatment for 24 h, and then enhanced rapidly, and reached its peak at 72 h, but after 96 h of treatment, titin transcription is sustained at a high level.
|
CsA enhanced titin protein expression in vitro in human first-trimester trophoblasts and JAR
After observing increased titin transcription in the first-trimester human trophoblast cells treated with CsA, we analysed the translation of titin, in trophoblast cells cultured for 72 h, by SDS-polyacrylamide gel electropheresis (PAGE) and Western blot. Since titin has a huge molecular weight, 2–10% SDS–PAGE was used to separate the extracted protein. As shown in Fig. 6A, there appeared a new band in the CsA-treated human primary trophoblasts and JAR cells as well, which was located at the top of the lane. To further validate that the large molecule only was titin, we then, using titin-specific antibodies, directly analysed titin protein expression in trophoblast cells by Western blot. As shown in Fig. 6B, there was a positive band in the CsA-treated cells, suggesting titin was successfully induced by CsA in human trophoblast cells.
|
Human first-trimester cytotrophoblasts translated titin in vivo
By immunohistochemistry, we checked titin expression in the placental bed. The results in Fig. 7 showed that there was obviously positive staining in cytotrophoblasts from anchoring villus, especially in the proximal cell column, and dim staining in the distal cell column, while no staining of titin was observed in syncytiotrophoblasts and floating villus. Thus it is likely that titin expression might be involved in the proliferation and invasion of human extravillous trophoblasts.
|
Positive correlation of the proliferation and invasiveness of human first-trimester trophoblast to the titin transcription
We found that the addition of CsA to human trophoblast cells showed a dose-responsive (0–1.0 µmol/l) stimulation of proliferation and invasion. Meanwhile, treatment with CsA induced titin mRNA expression in trophoblast in a dose-dependent manner. Thus it was reasonable to guess that the CsA-induced titin expression may contributed to the change of the trophoblast functions. By CORREL analysis, we demonstrated a significant positive correlation of the trophoblast proliferation or fold increase in invasion to the titin transcriptional level. The correlation coefficient for linear association was r = 0.8727 (P = 0.042) and r = 0.9322 (P = 0.004), respectively (Fig. 8).
|
Extracellular signal-regulated kinase1/2 pathway was involved in the CsA-induced titin expression in human first-trimester trophoblast cells
To elucidate the intracellular signal pathway mediating the up-regulation in titin expression by CsA, we focused our attention on the activation of MAPK, which convert extracellular stimuli to intracellular signals that control gene transcription, cell proliferation and differentiation. Previous reports also suggested that some of the regulatory actions of CsA were mediated by activation of the MAPK signalling pathway (Paslaru et al., 1997
|
|
| Discussion |
|---|
|
|
|---|
A proper development of the human placenta is essential in normal pregnancy. This includes proliferation and differentiation of the trophoblast, invasion of extravillous cytotrophoblast (EVCT) to form anchoring villi and remodelling of the uterine maternal vasculature to provide adequate nutrition for the rapid fetal growth in the second half of pregnancy. Defects in these processes, which lead to an insufficient trophoblast growth and invasion, are associated with some of the major pregnancy complications, including fetal growth restriction, pre-eclampsia and early pregnancy loss (Brosens and Renear, 1972; Hustin et al., 1990
CsA is a potent immunosuppressant widely used to prevent rejections of organ transplantation. Our previous studies demonstrated that CsA could regulate cytokines secretion and induce Th2 bias at the materno-fetal interface, contributing to reduce embryo resorption in the abortion-prone model (Du et al., 2007
). It has been reported that CsA can stimulate cell proliferation (Andres et al., 2001
; Cotrim et al., 2003
). Recently, there has been an accumulating evidence for a direct anti-apoptotic effect of CsA on a variety of cell types (Pastorino et al., 1998
; Gafter-Gvili et al., 2004
). Moreover, preconditioning with sublethal doses of CsA is protective against a subsequent lethal dose of CsA in the proximal renal tubule (Yuan et al., 1996
). CsA at low dose promoted survival and anti-apoptosis of endothelial cells (Alvarez-Arroyo et al., 2002
; Mailloux et al., 2004
). These collective findings expanded the efficiency scope of the immunosuppressant. Additionally, it has been documented that CsA increases adenocarcinoma cell growth and invasion in vitro (Hojo et al., 1999
). These investigative studies gave some useful clues for exploring the effect of CsA on human trophoblast cells since the first-trimester human trophoblast cells function akin to tumour cells, and the tumour-like properties of trophoblasts are critical for appropriate materno-fetal interactions.
Interestingly, our previous study showed that CsA could promote proliferation and invasion of trophoblast cells from an abortion-prone model to that of normal pregnancy (Du et al., 2007
). These data suggest that the CsA-regulated proliferation and invasiveness of trophoblast cells may contribute to the improvement of pregnancy outcome in an abortion-prone model. It was surprising that the proliferation and invasiveness of trophoblast cells from mid to late gestation were not affected (data not shown). The results were coincident with the fact that the invasiveness of the first-trimester trophoblast not the mid-late trimester trophoblast affected the pregnant outcome, and also that administration with CsA on day 4 of gestation would not increase the danger of tumour development.
Consistent with these studies, the present study showed that administration with low concentration of CsA promoted proliferation and invasion, and inhibited cell apoptosis of human first-trimester trophoblasts. However, the potential mechanisms involved in regulating proliferation and invasiveness in human first-trimester trophoblasts remain unclear.
Accumulating evidence has shown that this process is associated with dramatic changes in the expression of genes that play important roles in trophoblastic proliferation and invasion (Huch et al., 1998
; Nie et al., 2005
). Although previous studies have shown several genes expressed in trophoblast are altered during differentiation (Nie et al., 2005
), the biological roles of these genes are unclear. It is also possible that some crucial genes involved in the trophoblast differentiation remain to be identified. In the present study, by SSH, we screened six genes that were expressed differentially in human trophoblast cells treated with CsA. Among them a known gene, titin, was the most abundant after treatment with CsA.
Titin (MW 3000 kDa) is a giant protein that spans in a spring-like fashion from the Z-disc (binding sites to a- actinin) to the M-band (binding sites to myoymesin) as a single molecule, and it is also connected to myosin via the C-protein. The Ig-like and fibronectin-like domains have been identified as that part of the molecule, i.e. responsible for its elastic behaviour. Titin filaments ensure the elasticity and extensibility of the sarcomere, and also its capability to restore original sarcomere length after application of passive stretch. Besides its mechanical properties, deposition of titin filaments has been found to be a pre-requisite for sarcomerogenesis, and lack of titin may therefore contribute to reduction of the contractile apparatus in failing hearts. Recent study demonstrated that titin mutation defines roles for angiogenic remodelling and vascular morphogenesis by affecting endothelial morphogenesis (May et al., 2004
). Therefore, the CsA-induced titin expression may contribute to human trophoblast cell invasion through altering elasticity and extensibility, and remodelling the maternal vascular system, thus opening the placental blood supply.
Titin exclusivity in striated muscle cells has been challenged by studies showing the expression of titin or titin-like protein in non-muscle cells. One non-muscle site of titin expression has been reported in the terminal web region of the brush border array of microvilli of intestinal epithelial cells, where it is thought to mediate the association of myosin II and alpha-actinin with the cytoskeleton (Eilertsen and Keller, 1992
). Likewise, our results have demonstrated that titin was expressed in the cytotrophoblasts from anchoring villus, especially in the proximal cell column, with dim staining in the distal cell column while no staining of titin was observed in syncytiotrophoblasts and floating villus, indicating the titin expression might be conducive to the differentiation of EVCT cells and be related to the proliferation and invasiveness of cytotrophoblast.
It has been reported that titin, a component of the contractile apparatus of the sarcomere, or a titin-like protein may reside in the nucleus of mammalian cells, and by analogy to its function in muscle, may play a critical role in the functional organization of the nucleus (Machado and Andrew, 2000
; Wernyj et al., 2001
). These results were coincident with the study that the titin performs a significant non-sarcomeric, nuclear function, i.e. participating in and possibly mediating chromosome condensation (Machado et al., 1998
). Thus it is speculative that the CsA-induced titin expression may be involved in cell mitosis, thus contributing to the proliferation of trophoblasts.
MAPK pathways are evolutionarily conserved signalling modules through which cells transduce extracellular signals into intracellular responses. The prototypical MAPK pathway is the ERK1/2. The two proteins are ubiquitously expressed in cell lines and tissues, although their relative abundance is variable. The ERK1/2MAPK pathway has been associated with the regulation of gene expression, cellular proliferation, differentiation, angiogenesis, embryo development and tumour invasion. Recently, it was reported that ERK1/2 were widely expressed throughout early-stage embryos, especially in villous cytotrophoblasts and EVCTs in the first-trimester gestation. Disruption of the ERK2 locus leads to embryonic lethality early in mouse development after implantation. In this study, we have also demonstrated that CsA increases the titin expression in trophoblast cells through activation of the ERK1/2 pathway. Thus it is proposed that the CsA-induced trophoblast cell titin expression may be involved in placentation and embryonic development.
Interestingly, we found in the present study that U0126 completely abolished the expression of titin, while it only partially suppressed the proliferation and invasiveness of the first-trimester human trophoblasts up-regulated by CsA (Zhou et al. 2007
), suggesting that other molecules or signal pathways may be involved in the CsA-promoted proliferation and invasion of human trophoblast. It was coincident with evidence that MMP-9 and MMP-2 played an important role in the CsA-enhanced invasiveness of the first-trimester human trophoblast cells (Zhou et al., 2007
). Thereby, the action of CsA on trophoblasts may be mediated through multiple signals and molecules rather than a certain specific molecule.
Our work has confirmed that CsA promotes titin expression in human trophoblasts through the ERK1/2 signal pathway. The study provides the first evidence for an association of titin with human trophoblast growth and invasion, and alludes to a potentially critical function for titin in the modulation of human trophoblast growth and invasion. Since our experiments were carried out in 20% oxygen, whereas the physiological oxygen tension is
3%, the conditions we had employed are somewhat artificial. However, under the same condition, CsA, not the vehicle, could up-regulate titin expression in trophoblasts. Moreover, titin expression in the trophoblast from the first-trimester placentae has been characterized by us. Further work will be needed to examine the titin expression in CsA-treated trophoblast under normal oxygen tension and elucidate the role of titin by ectopic expression and/or gene knock out in trophoblasts. These results above may provide an enhanced understanding of the materno-fetal relationship, and be useful in novel therapeutics of spontaneous pregnancy wastage and other pregnant complications.
| Acknowledgements |
|---|
|
|
|---|
The authors would like to thank Dr Larry Chamley from University of Aukland for his helpful revision on the manuscript, and thank Dr Luo Jianfen, Dr Li Xiaohong and Prof. Che Yan for their helps in statistics. This work was supported by National Basic Research Program of China 2006CB944009 (to D.-J.L.), Shanghai Foundations for Basic Research No.03JC14 016 (to D.-J.L.) and No.06ZR14 120 (to M.-R.D.) and Program for Outstanding Medical Academic Leader (to D.-J.L.).
| References |
|---|
|
|
|---|
Alvarez-Arroyo MV, Yague S, Wenger RM, Pereira DS, Jimenez S, Gonzalez-Pacheco FR, Castilla MA, Deudero JJ, Caramelo C. Cyclophilin-mediated pathways in the effect of cyclosporin A on endothelial cells. Circ Res (2002) 91:202–209.
Andres D, Diez-Fernandez C, Zaragoza A, Alvarez A, Cascales M. Induction of cell proliferation by cyclosporine A in primary cultures of rat hepatocytes. Biochem Pharmacol (2001) 61:427–435.[CrossRef][Web of Science][Medline]
Barber KJ, Franklyn JA, McCabe CJ, Khanim FL, Bulmer JN, Whitley GS, Kilby MD. The in vitro effects of triiodothyronine on epidermal growth factor-induced trophoblast function. J Clin Endocrinol Metab (2005) 90:1655–1661.
Bose P, Black S, Kadyrov M, Weissenborn U, Neulen J, Regan L, Huppertz B. Heparin and aspirin attenuate placental apoptosis in vitro: implications for early pregnancy failure. Am J Obstet Gynecol (2005) 192:23–30.[CrossRef][Web of Science][Medline]
Brosens I, Renaer M. On the pathogenesis of placental infarcts in pre-eclampsia. J Obstet Gynaecol Br Commonw (1972) 79:794–799.[Web of Science][Medline]
Cotrim P, Martelli-Junior H, Graner E, Sauk JJ, Coletta RD. Cyclosporin A induces proliferation in human gingival fibroblasts via induction of transforming growth factor-beta1. J Periodontol (2003) 74:1625–1633.[CrossRef][Web of Science][Medline]
Crocker IP, Cooper S, Ong SC, Baker PN. Differences in apoptotic susceptibility of cytotrophoblasts and syncytiotrophoblasts in normal pregnancy to those complicated with preeclampsia and intrauterine growth restriction. Am J Pathol (2003) 162:637–643.
Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, et al. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA (1996) 93:6025–6030.
Du MR, Dong L, Zhou WH, Yan FT, Li DJ. Cyclosporin A improves pregnancy outcome by promoting functions of trophoblasts and inducing maternal tolerance to the allogeneic fetus in abortion-prone matings in the mouse. Biol Reprod (2007) 76:906–914.
Eilertsen KJ, Keller TC III. Identification and characterization of two huge protein components of the brush border cytoskeleton: evidence for a cellular isoform of titin. J Cell Biol (1992) 119:549–557.
Gafter-Gvili A, Kalechman Y, Sredni B, Gal R, Gafter U. Cyclosporin A-induced hair growth in mice is associated with inhibition of hair follicle regression. Arch Dermatol Res (2004) 296:265–269.[CrossRef][Web of Science][Medline]
Greer IA. Thrombophilia: implications for pregnancy outcome. Thromb Res (2003) 109:73–81.[CrossRef][Web of Science][Medline]
Hojo M, Morimoto T, Maluccio M, Asano T, Morimoto K, Lagman M, Shimbo T, Suthanthiran M. Cyclosporine induces cancer progression by a cell-autonomous mechanism. Nature (1999) 397:530–534.[CrossRef][Medline]
Huch G, Hohn HP, Denker HW. Identification of differentially expressed genes in human trophoblast cells by differential-display RT-PCR. Placenta (1998) 19:557–567.[CrossRef][Web of Science][Medline]
Hustin J, Jauniaux E, Schaaps JP. Histological study of the materno-embryonic interface in spontaneous abortion. Placenta (1990) 11:477–486.[CrossRef][Web of Science][Medline]
Kiely B, Feldman G, Ryan MP. Modulation of renal epithelial barrier function by mitogen-activated protein kinases (MAPKs): mechanism of cyclosporine A-induced increase in transepithelial resistance. Kidney Int (2003) 63:908–916.[CrossRef][Web of Science][Medline]
Lyall F, Bulmer JN, Duffie E, Cousins F, Theriault A, Robson SC. Human trophoblast invasion and spiral artery transformation: the role of PECAM-1 in normal pregnancy, pre-eclampsia, and fetal growth restriction. Am J Pathol (2001) 158:1713–1721.
Machado C, Andrew DJ. D-Titin: a giant protein with dual roles in chromosomes and muscles. J Cell Biol (2000) 151:639–652.
Machado C, Sunkel CE, Andrew DJ. Human autoantibodies reveal titin as a chromosomal protein. J Cell Biol (1998) 141:321–333.
Mailloux A, Bruneel A, Vaubourdolle M, Baudin B. Cyclosporin A but not estradiol can protect endothelial cells against etoposide-induced apoptosis. Endothelium (2004) 11:141–149.[CrossRef][Web of Science][Medline]
May SR, Stewart NJ, Chang W, Peterson AS. A Titin mutation defines roles for circulation in endothelial morphogenesis. Dev Biol (2004) 270:31–46.[CrossRef][Web of Science][Medline]
Medawar PB. Some immunological and endocrinological problems raised by the evolution of viviparity in vertebrates. Soc Exp Biol (1953) 7:320.
Meisser A, Cameo P, Islami D, Campana A, Bischof P. Effects of interleukin-6 (IL-6) on cytotrophoblastic cells. Mol Hum Reprod (1999a) 5:1055–1058.
Meisser A, Chardonnens D, Campana A, Bischof P. Effects of tumor necrosis factor alpha, interleukin-1 alpha, macrophage colony stimulating factor and transforming growth factor beta on trophoblastic matrix metalloproteinases. Mol Hum Reprod (1999b) 5:252–260.
Nie G, Li Y, Salamonsen LA. Serine protease HtrA1 is developmentally regulated in trophoblast and uterine decidual cells during placental formation in the mouse. Dev Dyn (2005) 233:1102–1109.[CrossRef][Web of Science][Medline]
Olivares EG, Munoz R, Tejerizo G, Montes MJ, Gomez-Molina F, Abadia-Molina AC. Decidual lymphocytes of human spontaneous abortions induce apoptosis but not necrosis in JEG-3 extravillous trophoblast cells. Biol Reprod (2002) 67:1211–1217.
Opitz CA, Leake MC, Makarenko I, Benes Vand Linke WA. Developmentally regulated switching of titin size alters myofibrillar stiffness in the perinatal heart. Circ Res (2004) 94:967–975.
Paslaru L, Trigon S, Kuhlmann M, Morange M. MAP kinase activation by cyclosporine A. Biochem Biophys Res Commun (1997) 236:599–603.[CrossRef][Web of Science][Medline]
Pastorino JG, Chen ST, Tafani M, Snyder JW, Farber JL. The overexpression of Bax produces cell death upon induction of the mitochondrial permeability transition. J Biol Chem (1998) 273:7770–7775.
Qumsiyeh MB, Kim KR, Ahmed MN, Bradford W. Cytogenetics and mechanisms of spontaneous abortions: increased apoptosis and decreased cell proliferation in chromosomally abnormal villi. Cytogenet Cell Genet (2000) 88:230–235.[CrossRef][Web of Science][Medline]
Sheppard BL, Bonnar J. Uteroplacental hemostasis in intrauterine fetal growth retardation. Semin Thromb Hemost (1999) 25:443–446.[Web of Science][Medline]
Soundararajan R, Rao AJ. Trophoblast pseudo-tumorigenesis: Significance and contributory factors. Reprod Biol Endocrinol (2004) 2:15.[CrossRef][Medline]
Wernyj RP, Ewing CM, Isaacs WB. Multiple antibodies to titin immunoreact with AHNAK and localize to the mitotic spindle machinery. Cell Motil Cytoskeleton (2001) 50:101–113.[CrossRef][Web of Science][Medline]
Wu X, Li DJ, Yuan MM, Zhu Y, Wang MY. The expression of CXCR4/CXCL12 in first-trimester human trophoblast cells. Biol Reprod (2004) 70:1877–1885.
Yan FT, Li DJ, Sun XX, Zhu Y, Wang MY, Meng Y, Yu J. Effect of cyclosporin A on the growth of human first-trimester cytotrophoblasts in vitro. Zhonghua Fu Chan Ke Za Zhi (2002) 37:74–76.[Medline]
Yuan CM, Bohen EM, Musio F, Carome MA. Sublethal heat shock and cyclosporine exposure produce tolerance against subsequent cyclosporine nephrotoxicity. Am J Physiol (1996) 40:F571–F578.
Zhou WH, Du MR, Dong L, Zhu XY, He YY, Li DJ. Cyclosporin A improves expression of Matrix Metalloproteinase 9 and 2 and invasiveness in vitro of the first-trimester human trophoblast cells via MAPK pathway. Hum Reprod (2007) in press.
Submitted on January 27, 2007; resubmitted on June 14, 2007; accepted on June 21, 2007.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Wang, Y. Song, D.-B. Chen, and J. Zheng Protein Phosphatase 3 Differentially Modulates Vascular Endothelial Growth Factor- and Fibroblast Growth Factor 2-Stimulated Cell Proliferation and Signaling in Ovine Fetoplacental Artery Endothelial Cells Biol Reprod, October 1, 2008; 79(4): 704 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-R. Du, W.-H. Zhou, L. Dong, X.-Y. Zhu, Y.-Y. He, J.-Y. Yang, and D.-J. Li Cyclosporin A Promotes Growth and Invasiveness In Vitro of Human First-Trimester Trophoblast Cells Via MAPK3/MAPK1-Mediated AP1 and Ca2+/Calcineurin/NFAT Signaling Pathways Biol Reprod, June 1, 2008; 78(6): 1102 - 1110. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










