Hum. Reprod. Advance Access originally published online on November 13, 2007
Human Reproduction 2008 23(1):11-16; doi:10.1093/humrep/dem363
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Both protamine-1 to protamine-2 mRNA ratio and Bcl2 mRNA content in testicular spermatids and ejaculated spermatozoa discriminate between fertile and infertile men
1 Department of Urology and Pediatric Urology, University of Giessen, Germany 2 Institute of Pathology, University of Giessen, Germany 3 Department of Urology and Pediatric Urology, University of Marburg, Germany 4 Kinderwunschzentrum Mittelhessen, Germany 5 Department of Obstetrics and Gynecology, University of Münster, Germany 6 Department of Urology, University of Münster, Germany 7 Institute of Veterinary Anatomy, Histology and Embryology, University of Giessen, Germany
8 Correspondence address. Klinik und Poliklinik für Urologie und Kinderurologie, Rudolf-Buchheim-Strasse 7, 35385 Giessen, Germany. Tel: +49-641-99-44534; Fax: +49-641-99-44539; E-mail: Klaus.Steger{at}chiru.med.uni-giessen.de
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
BACKGROUND: Human sperm contain similar amounts of protamine-1 (P1) and protamine-2 (P2). Although aberrant protamine ratios have been observed in infertile men, functional evidence is provided by protamine knockout mice exhibiting male infertility. As sperm DNA integrity is known to be linked with DNA fragmentation and apoptosis, we investigated whether the protamine ratio or Bcl2 content represent a reliable biomarker to discriminate fertile and infertile men.
METHODS: Real-time quantitative RT-PCR was used for P1, P2 and the apoptotic marker Bcl2 in testicular biopsies (TB; 74 infertile men versus 17 controls) and ejaculates (E; 95 infertile men versus 10 controls).
RESULTS: The P1–P2 mRNA ratio differed significantly between groups, namely 1:4 versus 1:3.2 in TB (P = 0.0038) and 1:1.7 versus 1:1 in E (P = 0.0002), for infertile men and controls, respectively. Bcl2 mRNA content was correlated with protamine mRNA ratio (P = 0.0250 for TB; P = 0.0003 for E). Infertile men exhibit a more than 10-fold (P = 0.0155 for TB; P = 7.0 x 10–6 for E) higher Bcl2 mRNA content versus controls. No correlation was found between absolute sperm density and the protamine mRNA ratio or Bcl2 mRNA content. No significant correlation was demonstrated with fertilization rate after ICSI and either protamine ratio or Bcl2 content.
CONCLUSIONS: We found significantly aberrant protamine ratios and a higher Bcl2 content in TB and E of infertile men compared to controls, suggesting that these molecules may be useful biomarkers for predicting male infertility.
Key words: Bcl2/ejaculate/protamine/testicular sperm extraction/testis
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Genes for protamines 1 and 2 are transcribed in Step 1–4 spermatids (Steger et al., 2000
), while synthesis of the corresponding proteins starts, with temporal delay, in Step 4 spermatids (Le Lannic et al., 1993). Protamine–DNA interaction, subsequently, results in chromatin condensation and termination of gene expression (reviewed in Steger, 1999, 2001). Consequently, comparative microarray analysis revealed no differences in the gene expression pattern between testicular spermatids and ejaculated spermatozoa (Ostermeier et al., 2002).
In human sperm, the histone to protamine exchange is only 
80% complete (Tanphaichitr et al., 1978) and the protamine-1 (P1) to protamine-2 (P2) ratio is 0.8–1.2 (Balhorn et al., 1988). Numerous studies, however, demonstrated that male infertility is associated with an abnormal histone to protamine ratio (Zhang et al., 2006) and an aberrant P1–P2 ratio at both the protein level in ejaculated spermatozoa (Balhorn et al., 1988; Belokopytova et al., 1993) and the mRNA level in testicular spermatids (Steger et al., 2001, 2003). Recently, abnormal protein synthesis has been reported to be associated with aberrant mRNA retention suggesting that defects in protamine translational regulation may contribute to protamine deficiency in infertile men (Aoki et al., 2006b). Functional evidence is provided by knockout mice demonstrating that a knockout of only one of the two protamine alleles is sufficient to cause male infertility (Cho et al., 2001). For further details refer to reviews from Steger (2003) and Oliva (2006).
Applying real-time quantitative RT-PCR (qRT-PCR) in the present study, we aimed at clarifying whether the P1–P2 mRNA ratio represents a reliable biomarker for the discrimination of fertile and infertile men. We therefore analysed the protamine ratio in both testicular spermatids and ejaculated spermatozoa and compared data with the fertilization rate after ICSI. As sperm DNA integrity is known to be linked to the level of DNA fragmentation and apoptosis, we additionally studied whether amplification of the apoptotic marker Bcl2 is related with male fertility.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Testicular tissue
After written informed consent, testicular biopsies were obtained from 74 infertile men exhibiting impaired spermatogenesis. In 17 patients with obstructive azoospermia after vasectomy, biopsies were carried out for diagnostic purposes during vasectomy reversal. These patients revealed normal endocrine values and histologically normal spermatogenesis and served as controls (Table I). Although one part of the biopsy was cryopreserved for testicular sperm extraction (TESE), the other part was fixed in Boui
s fixative and embedded in paraffin. For histological evaluation, 5 µm paraffin sections were stained in hematoxylin and eosin and scored, according to Bergmann and Kliesch (1998).
|
Ejaculates
After written informed consent, ejaculates were obtained from 95 oligozoospermic infertile men and analysed, according to the World Health Organization (WHO, 1992
). Ejaculates from volunteers with normozoospermia (n = 10) served as controls (Table II). The semen was prepared by migration–sedimentation (Sanchez et al., 1996), a method based on the technique of the common swim-up. Native ejaculate was transferred into special tubes around an inner conus and overlayed with medium. The motile sperm migrated actively into the medium and was then sedimented passively into the conus by gravity. After incubation at 37°C for a period of 2–3 h, 10% of the native quantity of sperm with a motility of 90% could be detected in the medium.
|
RNA extraction and first strand cDNA synthesis
RNA extraction from testicular tissue was performed as published (Steger et al., 2003
). Briefly, six paraffin sections were collected in a reaction tube and deparaffinized in 500 µl xylene for 10 min at 53°C. After centrifugation, pellet was resuspended in 200 µl 1 M guanidine thiocyanate, 0.5% sarcosyl, 0.72% β-mercaptoethanol, 20 mM Tris–HCl (pH 7.5). After adding proteinase K to a final concentration of 0.5 µg/µl, samples were digested for 12–16 h at 58°C. Note that digestion with proteinase K is indispensable for the liberation of RNA from crosslined/fixed tissue (Fink et al., 2000) and RNA-binding proteins binding within the coding sequence of P1 and P2 mRNA in round spermatids (Steger et al., 2002). Subsequently, 20 µl 2 M sodium acetate, 220 µl phenol (pH 4.3) and 60 µl chloroform/isoamylalcohol (24/1) were added. Samples were vortexed and centrifuged for 15 min at 4°C. The aqueous layer was collected, 1 µl glycogen (10 mg/ml) added, and precipitated with 200 µl isopropanol. Samples were frozen for one hour at –20°C and centrifuged for 15 min at 12 000xg. Pellets were washed with 75% ethanol, air-dried and resuspended in 10 µl RNase-free water. RNA extraction from ejaculates was performed using the RNA extraction kit RNeasy MINI (Qiagen, Germany).
First strand complementary DNA (cDNA) synthesis was performed using Sensiscript (for testicular tissue) and Omniscript (for ejaculates), according to the manufacturers protocol (Qiagen, Germany).
Real-time qRT-PCR
Real-time qRT-PCR was performed using iQTM SYBR Green Supermix and iCycler (BioRad, Germany). Per sample, 4 µl cDNA were used for amplification of P1, P2 and Bcl2. Cycling conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 30 s, 58°C for 30 s, and 73°C for 30 s. The following primers were employed (MWG, Germany):
P1: 5'cggagctgccagacacgga3' (forward; bp 182–200) and 5'ctacatctcggtctgtacctggg3' (reverse; bp 224–246) resulting in a 65 bp amplification product.
P2: 5'aagacgctcctgcaggcac3' (forward; bp 344–362) and 5'gccttctgcatgttctctt3' (reverse; bp 396–414) resulting in a 71 bp amplification product.
Bcl2: 5'acatcgccctgtggatgact3' (forward; bp 1008–1027) and 5'gggccgtacagttccacaaa3' (reverse; bp 1085–1104) resulting in a 97 bp amplification product.
Negative controls included samples lacking reverse transcriptase. Furthermore, intron spanning primers were applied to avoid amplification of genomic DNA. All experiments were carried out in duplicate.
Values recorded for quantification were the fractional cycle numbers (Ct) where the background corrected amplification curves crossed a threshold value. The threshold value was set within the log-linear phase of the amplification curves.
Quality of oocytes and embryos
Oocytes were considered as good quality oocytes when they were in metaphasis II stage and had no morphological defects, such as vacuoles, granulation, fragmentation or deformation in various patterns.
To evaluate the embryo quality, we classified the embryos on day 2 into four groups, according to Steer et al. (1992). (A) no fragmentation, equal blastomeres; (B) low fragmentation (<20%); (C) 20–50% fragmentation; (D) high fragmentation (>50%). The number of blastomeres and the fragmentation grade (A= 4, B = 3, C = 2, D = 1) were added to a score. Pregnancy was defined as a serum βHCG level >30 mlU/ml 2 weeks after puncture, combined with the detection of a gestational sac.
Statistical analysis
Data were analysed using R (R Development Core Team, 2007). Ct values of technical replicates were averaged and averages were used for further calculations. Relative expression levels were expressed by 
Ct values which represent a measure of the log-ratio of the transcript abundances in the samples. The log-ratio of P1 and P2 is given by Ct = CtP2 – CtP1. The log-ratio of Bcl2 and P2 is given by Ct = CtP2 – CtBcl2. The normal distribution of Ct and Ct values was checked with normal-QQ plots. Differences of the mean values between groups were tested with the Welsh t-test (two-sided). Linear correlations were tested using the Pearson coefficient of correlation. All tests were performed at a confidence level of 95%. All values are presented as means ± SEM. Power analysis was performed with the software G-Power using the ‘compromise analysis’ for t-tests on the difference of sample means and correlations (Faul and Erdfelder, 1992). The power of the statistical tests at 
= 0.05 were >80%. The power of the two-sided two-sample Welsh t-test do detect at least ‘strong’ relative effects (Cohes d = 1). In the mean, Ct between patients and controls was 84% for ejaculates with n1 = 10; n2 = 95, and 94% for testicular tissue with n1 = 17; n2 = 74. The power of the correlation tests for r 
0.3 was 91% (n = 95) and 85% (n = 74).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Testicular tissue
Real-time qRT-PCR for P1, P2 and Bcl2 was performed for both testes per man. As no statistically significant difference could be observed between right and left testes, the mean value was used for further calculation. The mean of P1 in infertile men (Ct = 33.5 ± 0.23) is lower than in the control group (Ct = 30.5 ± 0.90), whereas the mean of P2 is almost identical in infertile men (Ct = 35.6 ± 0.16) and in the control group (Ct = 35.7 ± 0.36). The P1–P2 ratio is
1: 3.2 in the control group and 1:4 in infertile patients. The difference of the ratios between controls and infertile men is statistically significant (P = 0.0038) (Fig. 1a) and larger for P2 than for P1. In addition, infertile men exhibit more than 10-fold the amount of Bcl2 mRNA when compared with controls (P = 0.0155) (Fig. 1b). Furthermore, the Bcl2 content reveals a positive linear correlation (P = 0.0250) with the P1–P2 ratio (Fig. 2a).
|
|
TESE (n = 74) in combination with ICSI (max three cycles) produced nine pregnancies (12.1%), the fertilization rate was 28.6 ± 2.48%. Neither the fertilization rate nor the pregnancy rate revealed a significant correlation with the P1–P2 ratios. In addition, no significant correlation could be demonstrated between the pregnancy rate and the quality of oocytes and embryos. Results are summarized in Table I.
Ejaculates
The P1–P2 ratio is 1:1 in the control group and 1:1.7 in infertile men. The difference is statistically significant (P = 0.0002) (Fig. 1c). No correlation could be found between the absolute sperm density and the P1–P2 ratio or the amount of Bcl2 mRNA. However, the amount of Bcl2 in infertile men is more than 10-fold the amount of Bcl2 in the control group (P = 7.0 x 10–6) (Fig. 1d). In addition, the Bcl2 content revealed a positive linear correlation (P = 0.0003) with the P1–P2 ratio (Fig. 2b).
ICSI (1 cycle) with ejaculates (n = 95) resulted in 32 pregnancies (32.5%), the ferilization rate was 73.6 ± 2.18%. Similar to TESE, neither the fertilization rate nor the pregnancy rate revealed a significant relation with the P1–P2 ratio. In addition, no significant correlation could be demonstrated between the pregnancy rate and the quality of oocytes and embryos. Results are summarized in Table II.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Spermatozoa from normozoospermic men contain similar amounts of P1 and P2 (Balhorn et al., 1988
). An aberrant protamine ratio has been demonstrated in infertile men (Balhorn et al., 1988; Belokopytova et al., 1993). In previous studies, we demonstrated a significant correlation between the protamine ratio and successful fertilization using in situ hybridization (Steger et al., 2001; 65 patients; Mitchell et al., 2005; 41 patients) and qRT-PCR (Steger et al., 2003; 57 patients) on testicular biopsies, as well as Western blot analysis (Nasr-Esfahani et al., 2004; 71 patients) on ejaculated spermatozoa. Applying qRT-PCR, in the present study, we comparatively analysed the protamine ratio in testicular biopsies and ejaculates from fertile and infertile men. The testicular samples were different from those used in our previous studies (Steger et al., 2001, 2003).
We were able to demonstrate a significant difference in the P1–P2 ratio between infertile (1:4 in testicular biopsies and 1:1.7 in ejaculates) and fertile (1:3.2 in testicular biopsies and 1:1 in ejaculates) men. Both P1 and P2 change between fertile and infertile men but P2 changes more than P1, suggesting different mRNA stabilities for the two molecules. P1 and P2 may have different functions, as (1) P2, unlike P1, represents a zinc finger protein revealing a Cys2–His2 motif (Bianchi et al., 1992) and (2) P1 is invariably present in all mammals, while P2 is expressed only in some mammals (Corzett et al., 2002) suggesting a more basic and conserved function for P1 and an accessory function for P2.
As genes for protamines are solely transcribed in round spermatids (Steger et al., 2000) and stored as silent mRNAs for later translation in elongating spermatids in which transcription is no longer active (Steger, 1999, 2001; Aoki et al., 2006b), it is well justified to consider altered mRNA levels as a potential origin of altered protein levels. Owing to the fact that each spermatid contains 20,000 protamine transcripts (Braun et al., 1989) which may be stored as silent mRNAs for up to 7 days (Hecht, 1998), RNA extraction from routinely Bouin-fixed and paraffin-embedded testicular biopsies followed by qRT-PCR represents a suitable time- and tissue-saving procedure for the study of quantitative gene expression in haploid male germ cells. This method has already been reported to represent a valuable tool for RNA extraction from archive material (Godfrey et al., 2000).
In the present study, the amount of P2 mRNA in testicular spermatids was almost identical in patients and controls, while the amount of P1 was lower in infertile men compared with the control group: although this difference was not significant, data were similar to that of other analysed patients (Steger et al., 2003). By contrast, the protamine ratio exhibited a highly significant difference between patients and controls. However, no significant correlation could be demonstrated with the fertilization and pregnancy rates. This is in contrast with IVF rates that have been reported to be significantly reduced in patients with abnormally low and high P1–P2 protein ratios (Aoki et al., 2006c). However, success of ICSI—unlike IVF—highly depends on the selection of the spermatozoon, as sperm of a given semen sample is known to exhibit a significant intrasample heterogeneity of protamine content (Aoki et al., 2006a). Since the protamine ratio obtained by counting the percentage of protamine-positive round spermatids has been demonstrated to exhibit a significant correlation with successful fertilization (Steger et al. 2001), this may represent a more suitable predictive marker for the estimation of successful fertilization than the total amount of protamines obtained by qRT-PCR.
Ejaculated spermatozoa from fertile men contain equal amounts of P1 and P2, both at the protein level (Balhorn et al., 1988; Belokopytova et al., 1993) and at the mRNA level (this study). Interestingly, in testicular spermatids, we demonstrated an increased P1–P2 mRNA ratio of 1:3.2. Infertile men exhibited an aberrant protamine ratio, namely 1:1.7 in ejaculated spermatozoa and 1:4 in testicular spermatids. Abnormal protamine expression may be the result of an abnormal functioning of a regulator of transcription, translation or post-translational modification that affects not only protamines, but also a broad range of genes involved in spermatogenesis. Therefore, protamine expression may act as a checkpoint during spermiogenesis and abnormal protamine expression may lead to an increased level of apoptosis.
It is known that P1 and P2 haploinsufficient mice exhibit damaged DNA (Cho et al., 2003). When applying ICSI, it was possible to activate oocytes, however, only a few could progress to the blastocyst stage. A similar phenomenon has been described in infertile patients (Tesarik et al., 2004). There is evidence that links high DNA fragmentation indexes with diminished sperm DNA integrity (Aoki et al., 2005), decreased protamine content (Nasr-Esfahani et al., 2005) and lower IVF and ICSI rates (Evenson and Wixon, 2006). Although Oosterhuis et al. (2000)reported DNA strand breaks and apoptotic marker annexin V in ejaculated spermatozoa, Sakkas et al. (1999)suggested that DNA strand breaks and apoptotic markers did not coexist in mature spermatozoon, as ejaculated spermatozoa with apoptotic markers appeared to have escaped programmed cell death in a process called abortive apoptosis. Therefore, it will be important to distinguish between cells that show high levels of DNA strand breaks and cells that are positive for apoptotic markers.
In recent years, the Bcl2/Bax system has been implicated in the regulation of apoptosis in various physiological and pathological states of cells (reviewed in Koji and Hishikawa, 2003). Although Bcl2 blocks apoptosis, Bax promotes it. In the present study, we concentrated on Bcl2, as Bax have been demonstrated in all germ cells, whereas Bcl2 was present solely in pachytene spermatocytes and spermatids (Damavandi et al., 2002). We have shown that infertile men exhibit more than 10-fold the amount of Bcl2 mRNA in testicular spermatids and ejaculated spermatozoa when compared to the appropriate control group. Furthermore, a linear correlation with the protamine ratio was obvious. Investigations on a possible relation between apoptosis and male fertility in mice concentrate on the heterodimeric partner of Bcl2. Bax-deficient male mice have been demonstrated to be infertile due to an accumulation of premeiotic germ cells and a lack of adult spermatids in the seminiferous tubules (Knudson et al., 1995).
In conclusion, we found significantly aberrant protamine mRNA ratios and a higher Bcl2 mRNA content in both testicular spermatids and ejaculated spermatozoa of infertile men, identifying these molecules as suitable predictive biomarkers to discriminate between fertile and infertile men.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
This work was supported by a Research Grant of the University Medical Center Giessen and Marburg entitled ‘Protamine as prognostic parameter for the success of TESE and ICSI’.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
The skillful technical assistance of Tania Bloch, Barbara Fröhlich and Kerstin Wilhelm is gratefully acknowledged.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Aoki VW, Moskovtsev SI, Willis J, Liu L, Mullen JB, Carrell DT. DNA integrity is compromised in protamine-deficient human sperm. J Androl (2005) 26:741–748.
Aoki VW, Emery BR, Liu L, Carell DT. Protamine levels vary between individual sperm cells of infertile human males and correlate with viability and DNA integrity. J Androl (2006) 27(a):890–989.
Aoki VW, Liu L, Carrell DT. A novel mechanism of protamine expression deregulation highlighted by abnormal protamine transcript retention in infertile human males with sperm protamine deficiency. Mol Hum Reprod (2006) 12(b):41–50.
Aoki VW, Liu L, Jones KP, Hatasaka HH, Gibson M, Peterson CM, Carrell DT. Sperm protamine 1/protamine 2 ratios are related to in vitro fertilization pregnancy rates and predictive of fertilization ability. Fertil Steril (2006) 86(c):1408–1415.[CrossRef][Web of Science][Medline]
Balhorn R, Reed S, Tanphaichitr N. Aberrant protamine 1/protamine 2 ratios in sperm of infertile human males. Experientia (1988) 44:52–55.[CrossRef][Web of Science][Medline]
Belokopytova IA, Kostyleva EI, Tomilin AN, Vorob’ev VI. Human male infertility may be due to a decrease of the protamine P2 content in sperm chromatin. Mol Reprod Dev (1993) 34:53–57.[CrossRef][Web of Science][Medline]
Bergmann M, Kliesch S. Hodenbiopsie. In: Andrologie—Krause W, Weidner W, eds. (1998) Stuttgart: Ferdinand Enke Verlag. 66–71.
Bianchi F, Rousseaux-Prevost R, Sautiere P, Rousseaux J. P2 protamines from human sperm are zinc-finger proteins with one CYS2/HIS2 motif. Biochem Biophys Res Commun (1992) 182:540–547.[CrossRef][Web of Science][Medline]
Braun RE, Peschon JJ, Behringer RR, Brinster RL, Palmiter RD. Protamine 3'-untranslated sequences regulate temporal translational control and subcellular localization of growth hormone in spermatids of transgenic mice. Genes Dev (1989) 3:793–802.
Cho C, Willis WD, Goulding EH, Jung-Ha H, Choi YC, Hecht NB, Eddy EM. Haploinsufficiency of protamine-1 or -2 causes infertility in mice. Nat Genet (2001) 28:82–86.[CrossRef][Web of Science][Medline]
Cho C, Jung-Ha H, Willis WD, Goulding EH, Stein P, Xu Z, Schultz RM, Hecht NB, Eddy EM. Protamine 2 deficiency leads to sperm DNA damage and embryo death in mice. Biol Reprod (2003) 69:211–217.
Corzett M, Mazrimas J, Balhorn R. Protamine 1: Protamine 2 stoichiometry in the sperm of eutherian mammals. Mol Reprod Dev (2002) 61:519–527.[CrossRef][Web of Science][Medline]
Damavandi E, Hishikawa Y, Izumi S, Shin M, Koji T. Involvement of Bax redistribution in the induction of germ cell apoptosis in neonatal mouse testes. Acta Histochem Cytochem (2002) 35:449–459.[CrossRef]
Evenson DP, Wixon R. Clinical aspects of sperm DNA fragmentation detection and male infertility. Theriogenology (2006) 65:979–991.[CrossRef][Web of Science][Medline]
Faul F, Erdfelder E. GPOWER: A Priori, Post-hoc, and Compromise Power Analysis for MS-DOS (Computer program). (1992) Bonn, FRG: Bonn University, Dept of Psychology.
Fink L, Kinfe T, Stein MM, Ermert L, Hanze J, Kummer W, Seeger W, Bohle RM. Immunostaining and laser-assisted cell picking for mRNA analysis. Lab Invest (2000) 80:327–333.[Web of Science][Medline]
Godfrey TE, Kim SH, Chavira M, Ruff DW, Warren RS, Gray JW, Jensen RH. Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded tissues using 5' nuclease quantitative transcription-polymerase chain reaction. J Mol Diagn (2000) 2:84–91.
Hecht NB. Molecular mechanisms of male germ cell differentiation. BioEssays (1998) 20:555–561.[CrossRef][Web of Science][Medline]
Knudson CM, Tung KS, Tourtellotte WG, Brown GA, Korsmeyer SJ. Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science (1995) 270:96–99.
Koji T, Hishikawa Y. Germ cell apoptosis and its molecular trigger in mouse testis. Arch Histol Cytol (2003) 66:1–16.[CrossRef][Web of Science][Medline]
Le Lannic G, Arkhis A, Vendrely E, Chevaillier P, Dadoune JP. Production, characterization, and immunocytochemical applications of monoclonal antibodies to human sperm protamines. Mol Reprod Dev (1993) 36:106–112.[CrossRef][Web of Science][Medline]
Mitchell V, Steger K, Marchetti C, Herbaut JC, Devos P, Rigot JM. Cellular expression of protamine 1 and 2 transcripts in testicular spermatids from azoospermic men submitted to TESE-ICSI. Mol Hum Reprod (2005) 11:373–379.
Nasr-Esfahani MH, Salehi M, Razavi S, Mardani M, Bahramian H, Steger K, Oreizi F. Effect of protamine-2 deficiency on ICSI outcome. Reprod Biomed Online (2004) 9:652–658.[Web of Science][Medline]
Nasr-Esfahani MH, Salehi M, Razavi S, Anjomyshoa M, Rozbahani S, Moulavi F, Mardani M. Effect of sperm DNA damage and sperm protamine deficiency on fertilization and embryo development post-ICSI. Reprod Biomed Online (2005) 11:198–205.[Web of Science][Medline]
Oliva R. Protamines and male infertility. Hum Reprod Update (2006) 12:417–435.
Oosterhuis GJ, Mulder AB, Kalsbeek-Batenburg E, Lambalk CB, Schoemaker J, Vermes I. Measuring apoptosis in human spermatozoa: a biological assay for semen quality? Fertil Steril (2000) 74:245–250.[CrossRef][Web of Science][Medline]
Ostermeier GC, Dix DJ, Miller D, Khatri P, Krawetz SA. Spermatozoal RNA profiles of normal fertile men. Lancet (2002) 360:772–777.[CrossRef][Web of Science][Medline]
R Development Core Team. R: A language and environment for statistical computing. (2007) Vienna: R Foundation for Statistical Computing. ISBN 3-900051-07-0, Austria. http://www.R-project.org.
Sakkas D, Mariethoz E, St John JC. Abnormal sperm parameters in humans are indicative of an abortive apoptotic mechanism linked to the Fas-mediated pathway. Exp Cell Res (1999) 251:350–355.[CrossRef][Web of Science][Medline]
Sanchez R, Stalf T, Khanaga O, Turley H, Gips H, Schill WB. Sperm selection methods for intracytoplasmic sperm injection (ICSI) in andrological patients. J Assist Reprod Genet (1996) 13:228–233.[CrossRef][Web of Science][Medline]
Steer CV, Mills CL, Tan SL, Campbell S, Edwards RG. The cumulative embryso score: a predictive embryoscoring technique to select the optimal number of embryos to transfer in an in-vitro fertilization and embryo transfer program. Hum Reprod (1992) 7:117–119.
Steger K. Transcriptional and translational regulation of gene expression in haploid spermatids. Anat Embryol (1999) 199:471–487.[CrossRef][Medline]
Steger K. Haploid spermatids exhibit translationally repressed mRNAs. Anat Embryol (2001) 203:323–334.[CrossRef][Medline]
Steger K, Pauls K, Klonisch T, Franke FE, Bergmann M. Expression of protamine-1 and 2 mRNA during human spermiogenesis. Mol Hum Reprod (2000) 6:219–225.
Steger K, Failing K, Klonisch T, Behre HM, Manning M, Weidner W, Hertle L, Bergmann M, Kliesch S. Round spermatids from infertile men exhibit decreased protamine-1 and –2 mRNA. Hum Reprod (2001) 16:709–716.
Steger K, Fink L, Klonisch T, Bohle RM, Bergmann M. Protamine-1 and –2 mRNA in round spermatids is associated with RNA-binding proteins. Histochem Cell Biol (2002) 117:227–234.[CrossRef][Web of Science][Medline]
Steger K. Possible predictive factors for ICSI? Molecular biology techniques in combination with therapeutic testicular biopsies. Andrologia (2003) 35:200–208.[CrossRef][Web of Science][Medline]
Steger K, Fink L, Failing K, Bohle RM, Kliesch S, Weidner W, Bergmann M. Decreased protamine-1 transcript levels in testes from infertile men. Mol Hum Reprod (2003) 9:331–336.
Tanphaichitr N, Sohbon P, Taluppeth N, Chalermisarachai P. Basic nuclear proteins in testicular cells and ejaculated spermatozoa in man. Exp Cell Res (1978) 117:347–350.[CrossRef][Web of Science][Medline]
Tesarik J, Greco E, Mendoza C. Late, but not early, paternal effect on human embryo development is related to sperm DNA fragmentation. Hum Reprod (2004) 19:611–615.
WHO. Laboratory Manual for the Examination of the Human Semen and Semen-Cervical Mucus Interaction (1992) 3rd edn. Cambridge: Cambridge University Press, UK.
Zhang X, San Gabriel M, Zini A. Sperm nuclear histone to protamine ratio in fertile and infertile men: evidence of heterogeneous subpopulations of spermatozoa in the ejaculate. J Androl (2006) 27:414–420.
Submitted on July 25, 2007; resubmitted on October 2, 2007; accepted on October 18, 2007.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Ramalho-Santos, S. Varum, S. Amaral, P. C. Mota, A. P. Sousa, and A. Amaral Mitochondrial functionality in reproduction: from gonads and gametes to embryos and embryonic stem cells Hum. Reprod. Update, May 4, 2009; (2009) dmp016v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hecht, R. Behr, A. Hild, M. Bergmann, W. Weidner, and K. Steger The common marmoset (Callithrix jacchus) as a model for histone and protamine expression during human spermatogenesis Hum. Reprod., March 1, 2009; 24(3): 536 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Avendano, A. Franchi, E. Jones, and S. Oehninger Pregnancy-specific {beta}-1-glycoprotein 1 and human leukocyte antigen-E mRNA in human sperm: differential expression in fertile and infertile men and evidence of a possible functional role during early development Hum. Reprod., February 1, 2009; 24(2): 270 - 277. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||