Hum. Reprod. Advance Access originally published online on December 12, 2007
Human Reproduction 2008 23(2):340-351; doi:10.1093/humrep/dem319
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences in the endometrial transcript profile during the receptive period between women who were refractory to implantation and those who achieved pregnancy
1 Departamento de Biología, Universidad de Santiago de Chile, Santiago, Chile 2 Laboratory of Molecular Technology, National Cancer Institute–Science Applications International Corporation, Frederick, MD, USA 3 Unidad de Medicina Reproductiva, Clínica Las Condes, Santiago, Chile 4 Instituto de Investigaciones Materno-Infantil, Universidad de Chile, Santiago, Chile 5 Instituto Chileno de Medicina Reproductiva (ICMER), Santiago, Chile 6 Millenium Institute for Fundamental and Applied Biology, Santiago, Chile
8 Correspondence address. E-mail: atapiap{at}gmail.com
| Abstract |
|---|
|
|
|---|
BACKGROUND: Gene expression profiling of normal receptive endometrium has been characterized, but intrinsic defects in endometrial gene expression associated with implantation failure have not been reported.
METHODS: Women who had previously participated as recipients in oocyte donation cycles and repeatedly exhibited implantation failure (Group A, study group) or had at least one successful cycle (Group B, control group) and spontaneously fertile women (Group C, normal fertility group) were recruited. All were treated with exogenous estradiol and progesterone to induce an endometrial cycle, and an endometrial biopsy was taken on the seventh day of progesterone administration. RNA from each sample was analysed by cDNA microarrays to identify differentially expressed genes between groups.
RESULTS: 63 transcripts were differentially expressed (
2-fold) between Groups A and B, of which 16 were subjected to real time RT–PCR. Eleven of these were significantly decreased in Group A with regard to Groups B and C. Among the dysregulated genes were MMP-7, CXCR4, PAEP and C4BPA.
CONCLUSIONS: Repeated implantation failure in some oocyte recipients is associated with an intrinsic defect in the expression of multiple genes in their endometrium. Significantly decreased levels of several transcripts in endometria without manifest abnormalities is demonstrated for the first time and shown to be associated with implantation failure.
Key words: endometrium/implantation/microarrays/oocyte donation/uterine receptivity
| Introduction |
|---|
|
|
|---|
The success of embryo implantation depends on blastocyst quality and endometrial receptivity (Giudice, 1995
5 day duration, from Days 20 to 24 of the cycle (Bergh and Navot, 1992
Microarray technology has been used to identify transcripts whose level change significantly throughout the endometrial cycle (Ponnampalam et al., 2004
; Talbi et al., 2006
) or during the transition from the late proliferative (Kao et al., 2002
; Borthwick et al., 2003
) or from the early secretory phase (Carson et al., 2002
; Riesewijk et al., 2003
; Mirkin et al., 2005
) to the receptive phase. However, in the human, progesterone not only drives the acquisition of receptivity in preparation for an embryo that may reach the uterine cavity, but also sets up the machinery to carry on menstruation in the absence of embryonic signaling. Hence, not all transcripts whose level changes throughout the luteal phase are necessarily involved in endometrial receptivity. Another approach utilized to identify genes potentially relevant to endometrial receptivity has been to characterize the endometrial gene expression profile under conditions of diminished fertility such as endometriosis (Kao et al., 2003
) or intrauterine device (IUD) (Horcajadas et al., 2006
).
The strategy reported here was to identify genes whose disturbed expression is consistently associated with implantation failure, in the absence of recognizable genital tract, embryonic and endocrine factors. We hypothesized that the pattern of gene expression in the endometrium during the receptive period may differ between women who have had successful embryo implantation, and those who have not, after repeated embryo transfer. Thus, we investigated whether the pattern of gene expression in the human endometrium during a receptive period induced with exogenous E2 and progesterone has a defined relationship with previous outcomes of repeated oocyte donation cycles. Microarrays were used to assess levels of multiple transcripts in endometrial biopsies taken during the implantation window induced by exogenous hormones in women who were previously recipients in oocyte donation cycles. These women had either no evidence of implantation in more than one cycle of embryo transfer or had become pregnant.
| Materials and Methods |
|---|
|
|
|---|
Subjects
All volunteers were enrolled after giving informed consent, under a protocol conducted in accordance with the guidelines in The Declaration of Helsinki, independently approved by the Ethics and Scientific Review Committees of Instituto Chileno de Medicina Reproductiva, Universidad de Chile and Clínica Las Condes.
Three groups of women were recruited. Group A comprised 5 women whose endometrial biopsies were used for microarray analysis (n = 3) and real time RT–PCR confirmation (n = 5). Women in this group had never been pregnant and had previously participated more than once as recipients in an oocyte donation program. At no time had they born evidence of embryo implantation after transfer of embryos of good morphology, at least equivalent to embryos transferred to the oocyte donor who became pregnant. Since good quality embryos with the ability to implant and develop normally derive from good quality oocytes, it was required that the oocyte donor had become pregnant from the same oocyte pool. Group B comprised 6 women who had previously become pregnant as recipients in oocyte donation cycles and delivered live infants. Group C comprised six women with a history of normal fertility in natural cycles (three or more live births). Women of Group C were surgically sterilized at least 1 year prior to their participation for reasons unrelated to this study and had regular menstrual cycles (26–35 days). Women of Groups A and B underwent a comprehensive evaluation. The general exclusion criteria for all volunteers included: metabolic or endocrine diseases other than those leading to ovarian failure, chronic use of medication other than HRT, drug abuse, obesity, endometriosis, pelvic inflammatory disease and current genital tract infection. None of the participants had polycystic ovary syndrome. In Group A, all the standard clinical investigations were done including laparoscopy and known causes of implantation failure attributable to endocrine, endometrial, tubal or pelvic pathologies, as well as to any male factor potentially relevant for IVF were ruled out.
Induction of endometrial cycle
All subjects from Groups A, B and C underwent the induction of an artificial endometrial cycle with exogenous E2 and progesterone. The pattern of gene expression in the human endometrium during the receptive period induced by replacement therapy with E2 and progesterone has not been established, but it is known to be compatible with implantation.
Women having spontaneous menstrual cycles were treated with an oral contraceptive (levonorgestrel 0.25 mg and ethinyl E2 0.05 mg) for 10–21 days as convenient, to suppress spontaneous cyclicity. Down-regulation of ovarian function with the gonadotrophin-releasing hormone (GnRH) agonist, leuprolide acetate (Lupron; TAP pharmaceuticals, Deerfield, IL, USA), was initiated on the last day of contraceptive administration at a dose of 0.5 mg s.c. daily for 7 days. Women with no ovarian function did not receive GnRH agonist therapy. Before proceeding with the hormonal replacement therapy, all volunteers with spontaneous menstrual cycles had serum E2 <100 pmol/l, serum luteinizing hormone
3 international units and no ovarian cysts detected by ultrasound on the seventh day of leuprolide acetate administration.
In order to induce endometrial proliferation and differentiation, cycling and non-cycling women underwent the same hormonal replacement therapy. The protocol used was the same as in their oocyte donation cycles. For estrogen replacement, micronized E2 was given at a dose of 4 mg/day on Days 1–7 and 6 mg/day on Days 8–20 (Day 1 = first day of E2 administration). The endometrial response was assessed on Day 14 measuring endometrial thickness by ultrasound, and values
11 mm were considered adequate. Micronized progesterone, 600 mg/day, was administered from Days 14 to 20 inclusive as follows: 400 mg/day orally and 200 mg/day vaginally. On Day 20, endometrial thickness was documented by ultrasound and an endometrial biopsy was taken from the uterine fundus.
Biopsies from all groups were performed using a standard endometrial suction curette (Pipelle de Cornier; Laboratoire C.C.D., Paris, France) under sterile conditions. A portion of each sample was fixed in 4% paraformaldehyde in phosphate-buffered saline for histological evaluation and the remainder was snap frozen in liquid nitrogen and stored at –80°C until use. All biopsies were classified as normal secretory endometrium with no differences between the groups. No sign of inflammatory process was found in any of them.
cDNA microarrays
cDNA microarrays were produced at the National Cancer Institute, LMT microarray core facility (NCI-Frederick, Frederick, MD, USA). The cDNA set from the human UniGEM 2.0 library, comprised 9128 PCR products (Incyte Genomics Inc., Palo Alto, CA, USA), spotted on poly-L-lysine (Sigma; St Louis, MO, USA) coated glass slides with a MicroGrid II microarrayer (Biorobotics; Cambridgeshire, UK). The gene list is available at http://nciarray.nci.nih.gov.
RNA isolation, amplification and target labeling
Total RNA was isolated from tissue samples using Trizol reagent (Invitrogen, Gaithersburg, MD, USA) as directed by the manufacturer, using Phase lock tubes (Eppendorf, Westbury, NY, USA) to maximize RNA recovery. The quality of the RNA was checked with the Lab-on-a-Chip total RNA nano biosizing assay (Agilent Technologies, Inc., Palo Alto, CA, USA) by examining the 18s and 28s ribosomal bands. Purity of isolated RNAs was quantified spectrophotometrically by the A260/A280 ratio.
Three of five endometrial biopsies from Group A were individually used for microarray analysis, whereas RNA samples from control groups (B, n = 6 and C, n = 6) were pooled within their respective groups. Total RNA (5 µg) was subjected to one round of amplification according to the Eberwine procedure (Van Gelder et al., 1990
) using the RiboAmp RNA kit (Arcturus, Mountain View, CA, USA) according to the manufacturer instructions. After amplification, antisense RNA (aRNA) was used to make fluorescence labeled cDNA targets using the LabelStar Array kit (Qiagen, Valencia, CA, USA). About 5 µg of aRNA was used as starting template and subjected to reverse transcription driven by random hexamers allowing direct labeling of DNA with Cy3-dUTP or Cy5-dUTP (Amersham Biosciences, Piscataway, NJ, USA).
Hybridization on glass cDNA microarrays
Hybridization of cDNA microarrays was performed as described (DeRisi et al., 1997
). Briefly, the appropriate Cy3 and Cy5 targets were combined, along with 20 µg of Human COT-1 DNA (Invitrogen), 20 µg of poly-d(A)40–60 (Amersham Biosciences), 2.6 µl of 20X Sodium chloride-sodium citrate buffer (SSC), 1 µl of 10% (w/v) sodium dodecyl sulphate (SDS) and Tris–EDTA to a final volume of 40 µl. The hybridization solution was heated for 2 min at 99°C and centrifuged for 10 min at 16 000 g in an Eppendorf centrifuge. Slides were hybridized in a water bath overnight (14–16 h) at 55°C. After hybridization, slides were washed for 1 min in 2x SSC and 0.1% SDS, in 1x SSC, for 1 min and in 0.05x SSC for 10 s, then spun until dry.
Scanning, feature extraction and analysis
Fluorescent images from microarray slides were captured using the GenePix 4000 Scanner (Axon Instruments Inc., Foster City, CA, USA) at 10-µm resolution. Photomultiplier voltage settings were set to obtain maximum signal intensities with >1% probe saturation. Feature extraction was done with GenePix Pro 4.0 (Axon Instruments Inc.) software. Spots with high local background or aberrant spot shape were flagged by the software and checked manually. For each slide, the average foreground signal intensity adjusted for local channel specific background was calculated. Spots with signal intensity <100 in both channels were excluded. If at least one channel had intensity above 100, the intensity under 100 was set at 100.
Analysis of array data
Both image and signal intensity data were stored in the NCI Microarrays Data Base (mAdb) supported by the Centre for Information Technology of NIH (http://nciarray.nci.nih.gov). Normalization of microarray data was done on single individual slides using the global normalization method which assumes that the red and green intensities are related by a constant factor. Cy3:Cy5 intensity ratio was calculated for each spot and subsequently adjusted to ratios of overall signal intensity from the corresponding channel to make the median value of log2 ratio equal to zero.
In all data sets included in the analysis, ratios of overall signal intensity ranged from 0.7 to 1.25. Ratios extracted from microarray images exhibited normal distribution, constant coefficient of variation and high positive signal. Ratios of 2 or larger and 0.5 or smaller were considered indicative of differential transcript level between two samples hybridized to the same array spot.
Control pools from Groups B and C were hybridized with a dye swap in duplicate (four microarray slides in total) and a histogram of ratios was performed. Most ratios were between 0.51 and 1.9 (98.2%), whereas ratios
0.5 or
2.0 were 0.96 and 1.81%, respectively. None of the differentially expressed genes found in Group A with regard to Groups B and C were among the genes with ratios over 2-fold between Groups B and C.
Real time RT–PCR verification of gene expression determined by microarray analyses
First-strand cDNA was synthesized from total RNA from each endometrial sample in duplicate by reverse transcription using the Omniscript Reverse Transcriptase (Qiagen), according to the manufacturers protocol.
Real time RT–PCR was performed using an ABI PRISM 7900HT sequence detection system (TaqMan) according to the manufacturers instructions. Prevalidated primers and probes (Assays-on-demand, PE Applied Biosystems, Foster City, CA, USA) were used for all genes submitted to Real Time RT-PCR confirmation, except CXCR4, to determine their respective transcript levels. The primers and probe for CXCR4 were designed by using PRIMER EXPRESS V.5.0 software (Applied Biosystems): forward CCTGCCCTCCTGCTGACTA, reverse GGGTAGAAGCGGTCACAGAT and probe TCCCGACTTCATCTTTG. Expression values for all transcripts analysed were normalized against those from the control glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Assays-on-demand, PE Applied Biosystems) to account for differing amounts of starting material.
The thermal cycling conditions included an initial activation step at 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of denaturation and annealing-amplification (95°C for 15 s, 60°C for 1 min). QPCR Reference Total RNA, Human (Stratagene, La Jolla, CA, USA) was used as a reference expression level.
| Results |
|---|
|
|
|---|
A total of 17 women were treated as recipients in a mock oocyte donation cycle, and an endometrial biopsy was taken on Day 7 of treatment with progesterone. The anthropometric and functional parameters of participating women did not show relevant differences between groups (Table I).
|
At the time of performing the microarrays, only three samples from Group A and all the samples from control groups were available. In order to identify differentially expressed genes, RNA samples within each control group were pooled and were compared with the RNA from each individual sample of Group A.
Fourteen genes were differentially expressed by at least 2-fold in 3/3 samples from Group A, compared with the pool of samples from Group B (Table II). Sixteen genes were differentially expressed by at least 2-fold in 3/3 samples of Group A when they were compared with the pool of samples from Group C (Table III). Nine of the differentially expressed genes were common to both comparisons (Table III, bold genes), suggesting a very similar expression profile between the two control groups, considering that nearly 10 000 transcripts were compared.
|
|
When a filter with less stringency, i.e. two-third samples, was applied to the comparison between Groups A and B, 63 transcripts showed a
2-fold difference in intensity. This larger list of 63 transcripts was contrasted with a database constructed with previously reported transcript level changes from non-receptive to receptive stage (Carson et al., 2002
|
The 63 transcripts were also contrasted with genes differentially expressed in endometrial biopsies taken during the receptive period: from women with or without endometriosis (Kao et al., 2003
|
In order to confirm differences in transcript levels found in the microarrays, a selected set of transcripts (Table VI) was submitted to real time RT–PCR. Selection was done according to the following criteria: (i) transcripts that consistently displayed up- or down-regulation in the cDNA microarrays analysis in 3/3 samples from Group A compared with pooled samples from Groups B and C; (ii) transcripts that were differentially expressed in two-third samples from Group A compared with Group B and that also were coincident with genes whose expression profile has been reported to change with acquisition of receptivity, or are differentially expressed in women with endometriosis or with an inert IUD. Transcripts selected with these criteria are listed in Table VI. Endometrial samples used for this purpose were from Groups A (n = 5), B (n = 6) and C (n = 6). The results are shown in Fig. 1 (panels a–p). mRNA levels for genes AVIL, C4BPA, MMP-7, MAO-A, MGST1, NNMT, CXCR4, CLU, SERPINB9, PAEP and RRM1 were reduced in Group A compared with both control groups in agreement with the microarray data. The transcript level of CXCR4 was also different between Groups B and C (Wilcoxon Rank-Sum test, P < 0.05). The mRNA levels for ANK3 appeared to be greater in Group A compared with the control groups, but the differences were not statistically significant. RAP1GAP, EDNRB, SOD2 and FLJ39 046, which displayed differences in the microarray analysis, did not show statistically significant differences either in this independent assay.
|
|
| Discussion |
|---|
|
|
|---|
The present study assessed the expression level of
10 000 genes and expressed sequence tags (Ests) in endometrial tissue, during the receptive period in mock oocyte donation cycles of three women who apparently had an endometrial defect impeding embryo implantation (Group A). Their profiles were compared with the one obtained from endometria which in the same oocyte donation program had been receptive to embryo implantation (Group B), or which exhibited receptivity in natural spontaneous cycles (Group C). The data show unequivocally a strong association between defective gene expression in the endometrium and implantation failure. Since all women were subjected to the same steroid hormone stimulation protocol prior to taking the biopsies, differentially expressed genes in Group A would likely reflect a permanent dysregulation of gene expression in their endometrium i.e. not compatible with implantation. Transcript level differences found between women from Group A with regard to Groups B and C can be attributed to dysregulation in transcriptional control or in messenger stability although transcript level regulation occurs mainly at the rate of transcription.
Real time RT–PCR reactions confirmed that the level of several transcripts in Group A was significantly lower than in Groups B and C, and showed a tendency for some transcript levels of Group C to be lower than in Group B, the difference being statistically significant in the case of chemokine receptor 4. The reason for such behavior is not clear, but may be an epiphenomenon related to biological differences between Groups B and C, that made women of the former group candidates for oocyte donation.
Differential expression of a set of 11 genes in the group refractory to implantation was confirmed by real time RT–PCR. Some of them have been reported before to be involved in endometrial receptivity, whereas others are circumstantially associated with such process for the first time in this report.
C4b-binding protein (C4BP), also known as proline-rich protein, is a regulatory protein in the complement system and works mainly in the classical pathway. It binds to the activated complement component C4b and also to C3b, though very weakly, through the
chain. It works as cofactor in the degradation of C3b and C4b by factor I and/or in preventing the formation of C3/C5 convertase (Liszewski et al., 1996
; Ogata et al., 1993
; Blom et al., 2001
). The complement system activity has been suggested to be present in the endometrium throughout the menstrual cycle (Nogawa Fonzar-Marana et al., 2006
), and it is postulated that the complement system might be conferring immunity to the uterine cavity, defending it against bacterial infection. Complement-regulatory molecules are up-regulated in human endometrium during the secretory phase, suggesting a protective role in maintaining the epithelial integrity of human endometrium (Young et al., 2002
; Nogawa Fonzar-Marana et al., 2006
). However, these complement regulatory molecules might be protecting the embryo since decreased expression of an inhibitor of the complement system activation could increase the chance of a misdirected complement attack on the embryo if perceived as a semiallograft. C4BP has been reported previously to be abnormally diminished in endometrial tissue during the receptive phase in women with endometriosis (Isaacson et al., 1989
; Kao et al., 2003
).
Glycodelin, also known as progestagen-associated endometrial protein (PAEP), placental protein 14 or placental
2-macroglobulin (Seppala et al., 1998
, 2002
) is the main progesterone-regulated glycoprotein secreted into uterine luminal cavity. Glycodelin has immunosuppressive activity including inhibition of NK cell activity (Okamoto et al., 1991) and its high concentration at the feto-maternal interface may contribute to protect the embryo against immune system attack.
Advillin is a member of the gelsolin/villin family of actin regulatory proteins. Due to the structural similarity of advillin with gelsolin family members, it is thought to play an important role in dynamic changes in the actin cytoskeleton during a variety of forms of cell motility (Kwiatkowski, 1999
). Gelsolin severs assembled actin filaments in two, and caps the fast-growing plus end of a free or newly severed filament. Northern blot analysis has shown high levels of advillin mRNA expression in murine uterus and in situ mRNA analysis of adult murine tissues demonstrates that the message is most highly expressed in the endometrial epithelium (Marks et al., 1998
). If this protein is expressed in the human endometrial epithelial cells as well, its function may mediate the cytoskeleton modification these cells undergo from a polarized to a non-polarized phenotype, in preparation for cell-to-cell adhesion (Thie et al., 1995
; Martin et al., 2000
).
Clusterin in its predominant form is a secreted sulphated heterodimeric glycoprotein of 75–80 kDa comprised of the disulfide-linked subunits
and β (de Silva et al., 1990; Kirszbaum et al., 1992
). Its mRNA has been shown to be expressed in the endometrial surface and in endometrial glands of mouse and human uterus (Brown et al., 1995
), and has been suggested as a marker of blastocyst implantation in the mouse (Brown et al., 1996
). Clusterin inhibits the membrane attack complex of complement proteins activated as a result of inflammation (Murphy et al., 1988
; Choi et al., 1989
; Jenne and Tschopp, 1989
; McDonald and Nelsestuen, 1997
) and interacts with immunoglobulin G, increasing the rate of formation of insoluble immune complexes (Wilson et al., 1991
). Since gene expression of this molecule has been reported to increase from the pre-receptive to the receptive state of the endometrium, it seems that clusterin could be another modulator of the immune system in the endometrium playing an immunosuppressive role during the receptive period.
Monoamine oxidase (MAO) is an enzyme of the mitochondrial outer membrane (Johnston, 1968
) critical in the neuronal metabolism (Castro Costa et al., 1980
) that preferentially degrades 5-hydroxy tryptamine (serotonin, 5-HT) and norepinephrine (Zhu et al., 1992
). Progesterone provokes a selective rise of MAO-A activity in the rat uterus (Mazumder et al., 1980
) and in human endometrium its activity markedly increase during the mid-secretory phase of the menstrual cycle, coincident with plasmatic progesterone peak levels and endometrial receptivity (Ryder et al., 1980
). Promoter sequence analysis for the gene coding for MAO-A has shown response elements to progesterone, suggesting direct transcriptional regulation by this hormone (Borthwick et al., 2003
). Enzymes responsible for monoamine synthesis have been demonstrated in normal endometrium as well as in early pregnancy deciduas (Manyonda et al., 1998
). Conditioned media from human embryos induce the expression of β-adrenergic receptors in endometrial cell cultures (Bruzzone et al., 2005
), suggesting the occurrence of a signaling pathway in the endometrium, mediated by catecholamines. 5-HT has been shown to inhibit decidualization (Mitchell et al., 1983
; Maekawa and Yamanouchi, 1996
). Expression of MAO-A gene might possibly represent a protective mechanism, which maintains low levels of 5-HT thereby assuring decidualization.
Matrix metalloproteinase-7 (MMP-7, matrilysin or uterine metalloproteinase) degrades casein, fibronectin and gelatin types I, III, IV and V (Muller et al., 1988
; Imai et al., 1995
). MMP-7 has been shown to be localized only to endometrial glandular or luminal epithelium during the proliferative and premenstrual/menstrual stage of the cycle. (Rodgers et al., 1994
; Bruner et al., 1995
). MMP-7 is down-regulated by progesterone in human endometrium and strongly up-regulated during menses. We found by real time RT-PCR that MMP-7 transcript levels were further decreased in the infertile group. This finding suggests that MMP-7 is expressed during the receptive phase, although to a small extent that cannot be detected by less sensitive techniques, as its transcript has been reported in other study using microarrays in secretory human endometrium (Yanaihara et al., 2004
). The proteolytic activity of MMPs is regulated by zymogen activation and inhibition by physiologic tissue inhibitors (TIMPs) (Chambers and Matrisian, 1997
; Gomez et al., 1997
; Nagase and Woessner, 1999
), so the participation of MMP-7 in endometrial receptivity has yet to be determined.
CXC chemokine receptor-4 (CXCR4) is the only physiological receptor for stromal cell-derived factor-1 (SDF-1) and has a potent chemotactic activity for lymphocytes (Bleul et al., 1996
). CXCR4 mRNA and protein levels are up-regulated during the implantation window in natural and HRT cycles. Chemokine receptors are up-regulated in cultured endometrial epithelial cells and polarization of CXCR4 receptors occurs in the presence of a human blastocyst (Dominguez et al., 2003
), suggesting that this receptor is implicated in the adhesion phase of human implantation. Moreover, since neutralization of CXCR4 effectively inhibit metastasis in mice (Geminder et al., 2001
; Muller et al., 2001
; Taichman et al., 2002
), it is speculated that trophoblast invasion through the stromal compartment of the endometrium, might be dependent on the SDF-1/CXCR4 pathway. SDF-1 is expressed by invasive trophoblasts and induces the specific migration of CD56+ CD16– human natural killer (NK) cells. Such NK phenotype is predominant in the maternal decidua and is found to be in direct contact with the fetal extravillous trophoblast.
The membrane-bound microsomal glutathione transferase 1 (MGST1) is found in abundance in the endoplasmic reticulum and outer mitochondrial membranes. MGST1 is involved in the protection of cells against oxidative damage by membrane lipids (Bannenberg et al., 1999
; Kelner et al., 2000
). It has been reported that MGST1 is up-regulated in human endometrial stromal cells in vitro by progesterone (Okada et al., 2003
). Besides the possible protective role this enzyme may play in endometrial cells, its participation in endometrial receptivity remains obscure.
Nicotinamide N-methyltransferase catalyzes the N-methylation of nicotinamide, pyridines and structural analogs (Alston and Abeles, 1988
). It is involved in the biotransformation of many drugs and xenobiotic compounds. The action of the enzyme in some cases detoxifies its substrates, whereas in other cases it leads to the production of toxic products (Alston and Abeles, 1988
). In human endometrium, transcipt levels for NNMT have been reported to be down-regulated from the proliferative to the receptive phase (Carson et al., 2002
) and up-regulated in the transition from the early secretory phase to the receptive phase (Riesewijk et al., 2003
). In addition, the function of NNMT in endometrial cells is unclear, so the effects of its down-regulation in infertile women remain to be determined.
Ribonucleotide reductase catalyzes the reduction of all four ribonucleotide diphosphates to their corresponding deoxyribonucleotides, an essential step for DNA synthesis and repair (Cory and Sato, 1983
; Reichard, 1993
; Tanaka et al., 2000
). In spite of its essential function in cell proliferation, the role of this enzyme in endometrial receptivity is unclear.
Proteinase inhibitor 9 (PI-9, also designated SERPINB9, cytoplasmic antiproteinase 3) is a 42 kDa member of the ovalbumin family of serpins (Dahlen et al., 1997
; Sun et al., 1997
, 1998
). PI-9 efficiently inhibits granzyme B (graB) in vitro and in vivo (Heusel et al., 1994
; Sun et al., 1996
; Bird et al., 1998
), which is found in granules produced by citotoxic T lymphocytes (CTLs), and thus graB-mediated apoptosis. PI-9 is also an inhibitor of caspase-1 and, to a smaller extent, caspase-4 and caspase-8 (Annand et al., 1999
; Dahlen et al., 1999
; Kanamori et al., 2000
). PI-9 is an estrogen-regulated gene (Krieg et al., 2001
) which is also up-regulated in response to inflammatory stimuli. Since PI-9 inhibits both caspase 1, which is involved in the maturation of inflammatory cytokines, and granzyme B, which is used by CTLs to induce the death of target cells, an anti-inflammatory role for this protein is suggested. PI-9 is expressed at high levels in immune-privileged sites such as placenta and endometrium (Bladergroen et al., 2001
), increasing in the latter during the window of implantation (Carson et al., 2002
). Since uterine proinflammatory responses have been suggested to be the result of maternal immunological reactions to the embryo and include localized increased stromal vascular permeability (Psychoyos, 1973), edema (Potts, 1968
) and increased levels of prostaglandins (Kennedy, 1977
) in the regions of blastocyst implantation, it is reasonable to assume that PI-9 endometrial expression may be controlling those inflammatory processes.
The fact that an important proportion of genes displaying diminished expression in Group A with regard to Groups B and C are related to the modulation of the immune system is physiologically relevant because it stresses the importance of up-regulation of immunomodulators to create a milieu permissive for successful implantation. This suggests that implantation failure in this group of women could result from an exaggerated response of the elements that react against foreign proteins leading to rejection of the embryo, even before implantation takes place.
The complement system and NK cells are part of innate immunity and have an important role in protecting exposed epithelial surfaces such as the endometrium. Since the activated complement system can kill self or foreign cells, endometrial cells and an eventual embryo are protected by the local expression of molecules that inhibit complement activation such as complement component 4 binding protein (C4BP) (Ogata et al., 1993
; Liszewski et al., 1996
; Blom et al., 2001
) and clusterin (Murphy et al., 1988
; Choi et al., 1989
; Jenne and Tschopp, 1989
; McDonald and Nelsestuen, 1997
). In addition, glycodelin (PAEP) modulates the activity of NK cells (Okamoto et al., 1991
) and PI-9 (serpin B) inhibits cytotoxic activity of T lymphocytes and NK cells (Dahlen et al., 1997
; Sun et al., 1997
, 1998
). All these molecules which modulate immune responses increase their expression level in the secretory phase endometrium, but their transcript level was reduced in Group A.
There are several potential disadvantages and limitations in the model used for the present study. First is the inability to detect differences in gene expression level that may occur in response to embryonic signals. Therefore, the findings are limited to the gene expression profiling resulting from endocrine-driven unfolding of receptivity.
Secondly, contrary to Groups B and C, the uterus of women from Group A had never been exposed to pregnancy, and this could be responsible for the differences found with the other two groups. Since we compared endometrial samples of women who had implantation of transferred embryos with women who never had implantation, we cannot exclude the possibility that pregnancy itself induced an imprinting in the endometrium that could lead to differential expression of certain genes in subsequent menstrual cycles. Experimental data from animals suggest that pregnancy produces a permanent epigenetic change in mammary gland cells, altering their subsequent response to hormones (Ginger et al., 2001
). To our knowledge, there is no evidence for epigenetic modifications or permanent imprinting in the endometrium attributable to pregnancy. However, we cannot discard a priori the possibility that differences found between Group A and the controls, are consequence of previous pregnancy in control groups rather than the cause of implantation failure in the infertile group. Nevertheless, the endometrium of those women who get pregnant for the first time has never been exposed to pregnancy; therefore, the essential gene repertoire for endometrial receptivity must be expressed in such condition.
Thirdly, differential gene expression was determined in a mock oocyte donation cycle, and the possibility that expression profiles differ between natural and artificially induced endometrial cycles can not be ruled out even if such difference does not affect the rate of implantation. Nevertheless, all three groups had this caveat and we assume that the transcriptional profile displayed by endometria refractory to implantation in previous oocyte donation cycles and in the mock cycle were similar.
Finally, only one-third of the genome was examined; therefore, the alterations found are most likely a partial view of the whole picture.
It is of interest that the genes C4BPA and PAEP whose transcript levels appeared decreased in the endometria of women from Group A have been also reported to be decreased in women with endometriosis (Isaacson et al., 1989
; Kao et al., 2003
) and/or in women with an inert IUD (Horcajadas et al., 2006
). Diminished fertility in endometriosis is likely to be associated with an endometrial defect. Inert IUDs may reduce fertility interfering with several reproductive processes, but their primary effect is to cause an inflammatory reaction at the endometrial level (Croxatto et al., 1994
). The common defect displayed by these groups of women suggests an important role of the genes in question in embryo implantation.
It is interesting also that several transcripts found to be decreased in Group A have been reported to be up-regulated by chorionic gonadotropin in the baboon endometrium during the window of implantation. They are MMP-7, CXCR4 and PAEP plus three others: serpin A3, complement component 4A and complement component 4B, which belong to the same family as serpin b and C4BPA, reported in the present investigation. Such finding also suggests these genes may have an important role in embryo implantation.
We conclude that repeated implantation failure in some recipients of oocyte donation is associated with an intrinsic defect in the expression of multiple genes in the endometrium at the onset of the implantation window. To our knowledge, reduced levels of several transcripts during the receptive period in endometria that display no other manifest abnormality have been demonstrated for the first time in association with implantation failure.
| Funding |
|---|
|
|
|---|
Funding for this work was provided by CONRAD (CIG-02-83 to L.V.); CONICYT (Beca Apoyo para realización de Tesis Doctoral 2002 to A.T.); Beca Fulbright-CONICYT (to A.T.); DICYT (to L.V.) and with Federal Funds from the National Cancer Institute, National Institutes of Health, under contract no. N01-CO-12400 (Article H.36 of the Prime Contract). The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the US Government.
| Author Roles |
|---|
|
|
|---|
Study design, sample processing, microarrays and PCR analysis, manuscript writing—A.T.
Microarray analysis—L.M.G., S.H., M.Q., M.V., M.R., D.J.M.
Volunteer recruitment, sample collection—F.Z.-H., J.B., R.P., L.T., I.M.P., A.M.S., S.H., M.Q.
Microarrays and PCR analysis—M.V.
Data interpretation—M.V., D.J.M., H.B.C.
Manuscript correction—D.J.M., H.B.C., L.V.
| Acknowledgements |
|---|
|
|
|---|
We thank all volunteers who participated in this study. We also thank Dr Fernando Gabler for the histopathological evaluations and Dr Antonio Mackenna, Dr Emilio Fernandez and Dr Patricio Masoli for performing the endometrial sampling. Thanks also to Dr Ulises Urzua for his helpful guidance on microarray analysis.
| Footnotes |
|---|
7 Present address. Prince Henrys Institute of Medical Research, 246 Clayton Road, PO Box 5152, Clayton, Victoria 3168, Australia
| References |
|---|
|
|
|---|
Alston TA, Abeles RH. Substrate specificity of nicotinamide methyltransferase isolated from porcine liver. Arch Biochem Biophys (1988) 260:601–608.[CrossRef][Web of Science][Medline]
Annand RR, Dahlen JR, Sprecher CA, De Dreu P, Foster DC, Mankovich JA, Talanian RV, Kisiel W, Giegel DA. Caspase-1 (interleukin-1beta-converting enzyme) is inhibited by the human serpin analogue proteinase inhibitor 9. Biochem J (1999) 342:655–665.[CrossRef][Web of Science][Medline]
Bannenberg G, Dahlen SE, Luijerink M, Lundqvist G, Morgenstern R. Leukotriene C4 is a tight-binding inhibitor of microsomal glutathione transferase-1. Effects of leukotriene pathway modifiers. J Biol Chem (1999) 274:1994–1999.
Bergh PA, Navot D. The impact of embryonic development and endometrial maturity on the timing of implantation. Fertil Steril (1992) 58:537–542.[Web of Science][Medline]
Bird CH, Sutton VR, Sun J, Hirst CE, Novak A, Kumar S, Trapani JA, Bird PI. Selective regulation of apoptosis: the cytotoxic lymphocyte serpin proteinase inhibitor 9 protects against granzyme B-mediated apoptosis without perturbing the Fas cell death pathway. Mol Cell Biol (1998) 18:6387–6398.
Bladergroen BA, Strik MC, Bovenschen N, van Berkum O, Scheffer GL, Meijer CJ, Hack CE, Kummer JA. The granzyme B inhibitor, protease inhibitor 9, is mainly expressed by dendritic cells and at immune-privileged sites. J Immunol (2001) 166:3218–3225.
Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J Exp Med (1996) 184:1101–1109.
Blom AM, Kask L, Dahlback B. Structural requirements for the complement regulatory activities of C4BP. J Biol Chem (2001) 276:27136–27144.
Borthwick JM, Charnock-Jones DS, Tom BD, Hull ML, Teirney R, Phillips SC, Smith SK. Determination of the transcript profile of human endometrium. Mol Hum Reprod (2003) 9:19–33.
Brown TL, Moulton BC, Baker VV, Mira J, Harmony JA. Expression of apolipoprotein J in the uterus is associated with tissue remodeling. Biol Reprod (1995) 52:1038–1049.[Abstract]
Brown TL, Moulton BC, Witte DP, Swertfeger DK, Harmony JA. Apolipoprotein J/clusterin expression defines distinct stages of blastocyst implantation in the mouse uterus. Biol Reprod (1996) 55:740–747.[Abstract]
Bruner KL, Rodgers WH, Gold LI, Korc M, Hargrove JT, Matrisian LM, Osteen KG. Transforming growth factor beta mediates the progesterone suppression of an epithelial metalloproteinase by adjacent stroma in the human endometrium. Proc Natl Acad Sci USA (1995) 92:7362–7366.
Bruzzone ME, Fabres C, Benitez DA, Castellon EA, Zegers-Hochschild F. Influence of embryonic conditioned media upon the endometrial beta-adrenergic receptor. Reprod Biomed Online (2005) 11:58–63.[Web of Science][Medline]
Carson DD, Lagow E, Thathiah A, Al-Shami R, Farach-Carson MC, Vernon M, Yuan L, Fritz MA, Lessey B. Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Mol Hum Reprod (2002) 8:871–879.
Castro Costa MR, Edelstein SB, Castiglione CM, Chao H, Breakefield XO. Properties of monoamine oxidase in control and Lesch-Nyhan fibroblasts. Biochem Genet (1980) 18:577–590.[CrossRef][Web of Science][Medline]
Chambers AF, Matrisian LM. Changing views of the role of matrix metalloproteinases in metastasis. J Natl Cancer Inst (1997) 89:1260–1270.
Choi NH, Mazda T, Tomita M. A serum protein SP40,40 modulates the formation of membrane attack complex of complement on erythrocytes. Mol Immunol (1989) 26:835–840.[CrossRef][Web of Science][Medline]
Cory JG, Sato A. Regulation of ribonucleotide reductase activity in mammalian cells. Mol Cell Biochem (1983) 53–54:257–266.
Croxatto HB, Ortiz ME, Valdez E. IUD mechanism of action. In: Proceedings from the Fourth International Conference on IUDs—Bardin CW, Mishell DR Jr, eds. (1994) Newton, MA, USA: Butterworth-Heinemann. 44–62.
Dahlen JR, Foster DC, Kisiel W. Human proteinase inhibitor 9 (PI9) is a potent inhibitor of subtilisin A. Biochem Biophys Res Commun (1997) 238:329–333.[CrossRef][Web of Science][Medline]
Dahlen JR, Foster DC, Kisiel W. Inhibition of neutrophil elastase by recombinant human proteinase inhibitor 9. Biochim Biophys Acta (1999) 1451:233–241.[Medline]
DeRisi JL, Iyer VR, Brown PO. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science (1997) 278:680–686.
de Silva HV, Stuart WD, Park YB, Mao SJ, Gil CM, Wetterau JR, Busch SJ, Harmony JA. Purification and characterization of apolipoprotein J. J Biol Chem (1990) 265:14292–14297.
Dominguez F, Galan A, Martin JJ, Remohi J, Pellicer A, Simon C. Hormonal and embryonic regulation of chemokine receptors CXCR1, CXCR4, CCR5 and CCR2B in the human endometrium and the human blastocyst. Mol Hum Reprod (2003) 9:189–198.
Geminder H, Sagi-Assif O, Goldberg L, Meshel T, Rechavi G, Witz IP, Ben-Baruch A. A possible role for CXCR4 and its ligand, the CXC chemokine stromal cell-derived factor-1, in the development of bone marrow metastases in neuroblastoma. J Immunol (2001) 167:4747–4757.
Ginger MR, Gonzalez-Rimbau MF, Gay JP, Rosen JM. Persistent changes in gene expression induced by estrogen and progesterone in the rat mammary gland. Mol Endocrinol (2001) 15:1993–2009.
Giudice LC. Endometrial growth factors and proteins. Semin Reprod Endocrinol (1995) 13:93–101.[CrossRef][Web of Science]
Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP. Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol (1997) 74:111–122.[Web of Science][Medline]
Heusel JW, Wesselschmidt RL, Shresta S, Russell JH, Ley TJ. Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells. Cell (1994) 76:977–987.[CrossRef][Web of Science][Medline]
Horcajadas JA, Sharkey AM, Catalano RD, Sherwin JR, Dominguez F, Burgos LA, Castro A, Peraza MR, Pellicer A, Simon C. Effect of an intrauterine device on the gene expression profile of the endometrium. J Clin Endocrinol Metab (2006) 91:3199–3207.
Imai K, Yokohama Y, Nakanishi I, Ohuchi E, Fujii Y, Nakai N, Okada Y. Matrix metalloproteinase 7 (matrilysin) from human rectal carcinoma cells. Activation of the precursor, interaction with other matrix metalloproteinases and enzymic properties. J Biol Chem (1995) 270:6691–6697.
Isaacson KB, Coutifaris C, Garcia CR, Lyttle CR. Production and secretion of complement component 3 by endometriotic tissue. J Clin Endocrinol Metab (1989) 69:1003–1009.
Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glycoprotein 2, a constituent of rat testis fluid. Proc Natl Acad Sci USA (1989) 86:7123–7127.
Johnston JP. Some observations upon a new inhibitor of monoamine oxidase in brain tissue. Biochem Pharmacol (1968) 17:1285–1297.[CrossRef][Web of Science][Medline]
Kanamori H, Krieg S, Mao C, Di Pippo VA, Wang S, Zajchowski DA, Shapiro DJ. Proteinase inhibitor 9, an inhibitor of granzyme B-mediated apoptosis, is a primary estrogen-inducible gene in human liver cells. J Biol Chem (2000) 275:5867–5873.
Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC. Global gene profiling in human endometrium during the window of implantation. Endocrinology (2002) 143:2119–2138.
Kao LC, Germeyer A, Tulac S, Lobo S, Yang JP, Taylor RN, Osteen K, Lessey BA, Giudice LC. Expression profiling of endometrium from women with endometriosis reveals candidate genes for disease-based implantation failure and infertility. Endocrinology (2003) 144:2870–2881.
Kelner MJ, Bagnell RD, Montoya MA, Estes LA, Forsberg L, Morgenstern R. Structural organization of the microsomal glutathione S-transferase gene (MGST1) on chromosome 12p13.1-13.2. Identification of the correct promoter region and demonstration of transcriptional regulation in response to oxidative stress. J Biol Chem (2000) 275:13000–13006.
Kennedy TG. Evidence for a role for prosaglandins in the initiation of blastocyst implantation in the rat. Biol Reprod (1977) 16:286–291.[Abstract]
Kirszbaum L, Bozas SE, Walker ID. SP-40,40, a protein involved in the control of the complement pathway, possesses a unique array of disulphide bridges. FEBS Lett (1992) 297:70–76.[CrossRef][Web of Science][Medline]
Krieg SA, Krieg AJ, Shapiro DJ. A unique downstream estrogen responsive unit mediates estrogen induction of proteinase inhibitor-9, a cellular inhibitor of IL-1beta- converting enzyme (caspase 1). Mol Endocrinol (2001) 15:1971–1982.
Kwiatkowski DJ. Functions of gelsolin: motility, signaling, apoptosis, cancer. Curr Opin Cell Biol (1999) 11:103–108.[CrossRef][Web of Science][Medline]
Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP. Control of the complement system. Adv Immunol (1996) 61:201–283.[Web of Science][Medline]
Maekawa F, Yamanouchi K. Effect of deprivation of serotonin by p-chlorophenylalanine on induction and maintenance of pseudopregnancy in female rats. Brain Res Bull (1996) 39:317–321.[CrossRef][Web of Science][Medline]
Manyonda IT, Slater DM, Fenske C, Hole D, Choy MY, Wilson C. A role for noradrenaline in pre-eclampsia: towards a unifying hypothesis for the pathophysiology. Br J Obstet Gynaecol (1998) 105:641–648.[Web of Science][Medline]
Marks PW, Arai M, Bandura JL, Kwiatkowski DJ. Advillin (p92): a new member of the gelsolin/villin family of actin regulatory proteins. J Cell Sci (1998) 111:2129–2136.[Abstract]
Martin JC, Jasper MJ, Valbuena D, Meseguer M, Remohi J, Pellicer A, Simon C. Increased adhesiveness in cultured endometrial-derived cells is related to the absence of moesin expression. Biol Reprod (2000) 63:1370–1376.
Mazumder RC, Glover V, Sandler M. Progesterone provokes a selective rise of monoamine oxidase A in the female genital tract. Biochem Pharmacol (1980) 29:1857–1859.[CrossRef][Web of Science][Medline]
McDonald JF, Nelsestuen GL. Potent inhibition of terminal complement assembly by clusterin: characterization of its impact on C9 polymerization. Biochemistry (1997) 36:7464–7473.[CrossRef][Web of Science][Medline]
Mirkin S, Arslan M, Churikov D, Corica A, Diaz JI, Williams S, Bocca S, Oehninger S. In search of candidate genes critically expressed in the human endometrium during the window of implantation. Hum Reprod (2005) 20:2104–2117.
Mitchell JA, Hammer RE, Goldman H. Serotonin-induced disruption of implantation in the rat: II. Suppression of decidualization. Biol Reprod (1983) 29:151–156.[Abstract]
Muller D, Quantin B, Gesnel MC, Millon-Collard R, Abecassis J, Breathnach R. The collagenase gene family in humans consists of at least four members. Biochem J (1988) 253:187–192.[Web of Science][Medline]
Muller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, McClanahan T, Murphy E, Yuan W, Wagner SN, et al. Involvement of chemokine receptors in breast cancer metastasis. Nature (2001) 410:50–56.[CrossRef][Medline]
Murphy BF, Kirszbaum L, Walker ID, dApice AJ. SP-40,40, a newly identified normal human serum protein found in the SC5b-9 complex of complement and in the immune deposits in glomerulonephritis. J Clin Invest (1988) 81:1858–1864.[Web of Science][Medline]
Nagase H, Woessner JF Jr. Matrix metalloproteinases. J Biol Chem (1999) 274:21491–21494.
Nogawa Fonzar-Marana RR, Ferriani RA, Soares SG, Cavalcante-Neto FF, Teixeira JE, Barbosa JE. Expression of complement system regulatory molecules in the endometrium of normal ovulatory and hyperstimulated women correlate with menstrual cycle phase. Fertil Steril (2006) 86:758–761.[CrossRef][Web of Science][Medline]
Ogata RT, Mathias P, Bradt BM, Cooper NR. Murine C4b-binding protein. Mapping of the ligand binding site and the N-terminus of the pre-protein. J Immunol (1993) 150:2273–2280.[Abstract]
Okada H, Nakajima T, Yoshimura T, Yasuda K, Kanzaki H. Microarray analysis of genes controlled by progesterone in human endometrial stromal cells in vitro. Gynecol Endocrinol (2003) 17:271–280.[Web of Science][Medline]
Okamoto N, Uchida A, Takakura K, Kariya Y, Kanzaki H, Riittinen L, Koistinen R, Seppala M, Mori T. Suppression by human placental protein 14 of natural killer cell activity. Am J Reprod Immunol (1991) 26:137–142.[Web of Science][Medline]
OMalley BW, Tsai MJ. Molecular pathways of steroid receptor action. Biol Reprod (1992) 46:163–167.[Abstract]
Ponnampalam AP, Weston GC, Trajstman AC, Susil B, Rogers PA. Molecular classification of human endometrial cycle stages by transcriptional profiling. Mol Hum Reprod (2004) 10:879–893.
Potts DM. The ultrastructure of implantation in the mouse. J Anat (1968) 103:77–90.[Web of Science][Medline]
Psychoyos A. Endocrine control of egg implantation. In: Handbook of Physiology.—Greep RO, Astwood EG, Geiger SR, eds. (1973) Washington, DC: American Physiological Society. 187–215.
Psychoyos A. Uterine receptivity for nidation. Ann NY Acad Sci (1986) 476:36–42.[Web of Science][Medline]
Reichard P. From RNA to DNA, why so many ribonucleotide reductases? Science (1993) 260:1773–1777.
Riesewijk A, Martin J, van Os R, Horcajadas JA, Polman J, Pellicer A, Mosselman S, Simon C. Gene expression profiling of human endometrial receptivity on days LH+2 versus LH+7 by microarray technology. Mol Hum Reprod (2003) 9:253–264.
Rodgers WH, Matrisian LM, Giudice LC, Dsupin B, Cannon P, Svitek C, Gorstein F, Osteen KG. Patterns of matrix metalloproteinase expression in cycling endometrium imply differential functions and regulation by steroid hormones. J Clin Invest (1994) 94:946–953.[Web of Science][Medline]
Ryder TA, MacKenzie ML, Lewinsohn R, Pryse-Davies J, Sandler M. Amine oxidase histochemistry of the human uterus during the menstrual cycle. Histochemistry (1980) 67:199–204.[CrossRef][Web of Science][Medline]
Seppala M, Bohn H, Tatarinov Y. Glycodelins. Tumour Biol (1998) 19:213–220.[CrossRef][Medline]
Seppala M, Taylor RN, Koistinen H, Koistinen R, Milgrom E. Glycodelin: a major lipocalin protein of the reproductive axis with diverse actions in cell recognition and differentiation. Endocr Rev (2002) 23:401–430.
Sun J, Bird CH, Sutton V, McDonald L, Coughlin PB, De Jong TA, Trapani JA, Bird PI. A cytosolic granzyme B inhibitor related to the viral apoptotic regulator cytokine response modifier A is present in cytotoxic lymphocytes. J Biol Chem (1996) 271:27802–27809.
Sun J, Ooms L, Bird CH, Sutton VR, Trapani JA, Bird PI. A new family of 10 murine ovalbumin serpins includes two homologs of proteinase inhibitor 8 and two homologs of the granzyme B inhibitor (proteinase inhibitor 9). J Biol Chem (1997) 272:15434–15441.
Sun J, Stephens R, Mirza G, Kanai H, Ragoussis J, Bird PI. A serpin gene cluster on human chromosome 6p25 contains PI6, PI9 and ELANH2 which have a common structure almost identical to the 18q21 ovalbumin serpin genes. Cytogenet Cell Genet (1998) 82:273–277.[CrossRef][Web of Science][Medline]
Tabibzadeh S. Molecular control of the implantation window. Hum Reprod Update (1998) 4:465–471.
Taichman RS, Cooper C, Keller ET, Pienta KJ, Taichman NS, McCauley LK. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res (2002) 62:1832–1837.
Talbi S, Hamilton AE, Vo KC, Tulac S, Overgaard MT, Dosiou C, Le Shay N, Nezhat CN, Kempson R, Lessey BA, et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology (2006) 147:1097–1121.[CrossRef][Web of Science][Medline]
Tanaka H, Arakawa H, Yamaguchi T, Shiraishi K, Fukuda S, Matsui K, Takei Y, Nakamura Y. A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage. Nature (2000) 404:42–49.[CrossRef][Medline]
Thie M, Harrach-Ruprecht B, Sauer H, Fuchs P, Albers A, Denker HW. Cell adhesion to the apical pole of epithelium: a function of cell polarity. Eur J Cell Biol (1995) 66:180–191.[Web of Science][Medline]
Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD, Eberwine JH. Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc Natl Acad Sci USA (1990) 87:1663–1667.
Wilson MR, Roeth PJ, Easterbrook-Smith SB. Clusterin enhances the formation of insoluble immune complexes. Biochem Biophys Res Commun (1991) 177:985–990.[CrossRef][Web of Science][Medline]
Yanaihara A, Otsuka Y, Iwasaki S, Koide K, Aida T, Okai T. Comparison in gene expression of secretory human endometrium using laser microdissection. Reprod Biol Endocrinol (2004) 2:66.[CrossRef][Medline]
Young SL, Lessey BA, Fritz MA, Meyer WR, Murray MJ, Speckman PL, Nowicki BJ. In vivo and in vitro evidence suggest that HB-EGF regulates endometrial expression of human decay-accelerating factor. J Clin Endocrinol Metab (2002) 87:1368–1375.
Zhu QS, Grimsby J, Chen K, Shih JC. Promoter organization and activity of human monoamine oxidase (MAO) A and B genes. J Neurosci (1992) 12:4437–4446.[Abstract]
Submitted on November 6, 2007; resubmitted on July 15, 2007; accepted on September 12, 2007.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. Mansouri-Attia, J. Aubert, P. Reinaud, C. Giraud-Delville, G. Taghouti, L. Galio, R. E. Everts, S. Degrelle, C. Richard, I. Hue, et al. Gene expression profiles of bovine caruncular and intercaruncular endometrium at implantation Physiol Genomics, September 1, 2009; 39(1): 14 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
The ESHRE Capri Workshop Group Intrauterine insemination Hum. Reprod. Update, May 1, 2009; 15(3): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



