Hum. Reprod. Advance Access published online on February 15, 2008
Human Reproduction, doi:10.1093/humrep/den010
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Presumed pluripotency markers UTF-1 and REX-1 are expressed in human adult testes and germ cell neoplasms
1 University Department of Growth and Reproduction, Section GR5064, Rigshospitalet, Blegdamsvej 9, 2100 Copenhagen, Denmark 2 Department of Pathology, Rigshospitalet, Blegdamsvej 9, 2100 Copenhagen, Denmark
3Correspondence address. E-mail: moebjerg{at}imbg.ku.dk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
BACKGROUND: UTF-1 and REX-1/ZFP42 are transcription factors involved in pluripotency. Because of phenotypic similarities between pluripotent embryonic stem cells and testicular germ cell tumours (TGCT) and the derivation of pluripotent cells from testes, we investigated the expression of UTF-1 and REX-1 during human gonadal development and in TGCT.
METHODS: Expression of UTF-1 and REX-1 was studied in 52 specimens from human gonadal development and in 86 samples from TGCT.
RESULTS: UTF-1 and REX-1 were expressed throughout male gonadal development. In the mature testis, UTF-1 was expressed in spermatogonia, whereas REX-1 was expressed in meiotic cells and, together with OCT-3/4, in primary oocytes. Both UTF-1 and REX-1 were expressed in testicular carcinoma in situ and in TGCT. Contrarily to REX-1, UTF-1 was expressed in all spermatocytic seminomas.
CONCLUSIONS: Unlike other pluripotency markers NANOG and OCT-3/4, UTF-1 and REX-1 are expressed throughout human testes development. The expression pattern indicated that UTF-1 plays a possible role in spermatogonial self-renewal, whereas expression of REX-1 in meiotic cells from both testes and ovary indicate a role in meiosis. UFT-1 and REX-1 are expressed in TGCT and the high abundance of UTF-1 in spermatocytic seminomas is consistent with the hypothesis that this tumour type originates from spermatogonia.
Key words: germ cell differentiation/pluripotency/UTF-1/REX-1/germ cell neoplasms
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Self-renewal and pluripotency with a tightly controlled ability to differentiate are the hallmarks of stem cells. The mechanisms involved in this process have only recently begun to be unravelled. Two of the few transcription factors known to be involved in self-renewal both in vivo at the blastocyst stage and in vitro in human and mouse embryonic stem (ES) cells are UFT-1 (undifferentiated embryonic cell transcription factor 1) and REX-1/ZFP42 (reduced expression 1/zinc-finger protein-42) (Niwa, 2001
; Richards et al., 2004). The murine variants of both UTF-1 and REX-1 were first identified from screening of mouse embryonic carcinoma (EC) cells and were shown to be rapidly extinguished after cells were induced to differentiate by retinoic acid (Hosler et al., 1989; Okuda et al., 1998). The UTF-1 protein contains a leucine zipper motif and its mRNA transcripts are, besides from being expressed in EC, also found in ES cells and in mouse germ line tissues, but have not been detected in any other adult tissues. The Utf-1 gene is one of the target genes of an embryonic octamer binding transcription factor, Oct-3/4 (also known as Oct-3 and Oct-4), and expression is regulated by the synergistic action of Oct-3/4 and another embryonic factor, Sox-2 (Nishimoto et al., 1999). Results suggest that Oct-3/4 induces rapid proliferation and tumorigenic properties of ES cells through activation of Utf-1 that also plays a role in teratoma formation (Nishimoto et al., 2005). In addition, recent data show that Utf-1 is a stably chromatin-associated transcriptional repressor and knockdown in both mouse ES cells and a carcinoma cell line results in delay or block of differentiation (Van den Boom et al., 2007). REX-1 is a zinc finger motif containing protein, whose mRNA level is high in ES cells and is present in the inner cell mass of the blastocyst. As with Utf-1, studies have shown that the Oct-3/4 transcription factor can activate but also repress the Rex-1 promoter, depending on the cellular environment (Ben Shushan et al., 1998). The only adult mouse tissue reported to contain detectable amounts of Rex-1 mRNA is the testis (Rogers et al., 1991), however, recently REX-1 has been detected in the cytoplasm of cells in normal human renal tissue (Raman et al., 2006).
Testicular germ cell tumours (TGCT) may contain teratomatous elements of all somatic tissue types, suggesting that the precursor cell retains or activates pluripotency (Kleinsmith and Pierce, 1964; Andrews et al., 2005). Despite this histological variability, both classic seminoma and non-seminomas, including teratomas, are derived from a common cancer stem cell, the carcinoma in situ (CIS) cell (Skakkebaek, 1972). In contrast to these tumours that occur in young adults, the rare spermatocytic seminoma occurring in elder men is not associated with CIS cells and its origin remains unresolved (Rajpert-De Meyts et al., 2003; Looijenga et al., 2006). Studies of the phenotype of CIS have provided strong evidence for a close similarity between CIS and fetal germ cells. Accordingly, CIS cells and CIS-derived classical seminoma and EC retain a high expression of pluripotency markers OCT-3/4 and NANOG (reviewed in Rajpert-De Meyts, 2006). However, the expression of UTF-1 and REX-1 in these tissues and in normal human ovaries and testes is at present unresolved.
The aims of this study were, first, to establish the ontogenesis of pluripotency markers UTF-1 and REX-1 expression in normal human fetal gonads of both sexes, and second, to examine whether there are any deviations in the normal pattern of expression in the gonads of patients with different types of TGCT.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Tissue samples
The regional Committee for Medical Research Ethics in Denmark approved the use of human tissue samples for this project. Material included 14 normal fetal tissue samples (nine testicular and five ovaries) from tissue archives of Rigshospitalet obtained after induced or spontaneous abortions or stillbirths, mainly due to placental or maternal problems. Developmental stage was calculated from the last menstrual bleeding, supported by foot size of the fetus. Normal samples (n = 13) ranging from 3 months to 13 years (post-natal, prepubertal and peripubertal) were obtained from infants who died suddenly of causes unrelated to the reproductive system, or from testicular biopsies performed in boys with acute leukaemia for monitoring the spread of the disease. Adult testicular (n = 38) samples were from orchidectomy specimens with preserved testicular parenchyma and complete spermatogenesis performed due to testicular cancer. Remaining specimens (n = 110) were CIS and overt testicular germ cell tumours, including classical seminomas, non-seminomas and spermatocytic seminomas, obtained directly after orchidectomy. The diagnosis of tumours and CIS were confirmed by morphological criteria (Eble et al., 2004
), with additional staining for placental-like alkaline phosphatase (PLAP) (Jacobsen and Norgaard-Pedersen, 1984).
Immunohistochemistry
Tissue samples were fixed overnight at 4°C in Stievés fluid, Bouin’s fluid, buffered formalin or 4% paraformaldehyde (PFA) and subsequently embedded in paraffin. The following commercially available antibodies were used: mouse monoclonal anti-human UTF-1 (MAB4337, Chemicon, Temecula, CA, USA), biotinylated sheep anti-human REX-1 (BAF3598, R&D systems, Minneapolis, MN, USA), and monoclonal mouse anti-human OCT-3/4 (SC-5279, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). UTF-1 antibody was applied to dewaxed and rehydrated sections fixed in 4% PFA. Antigen demasking was performed in 10 mM citrate buffer (pH 6.0) in a microwave oven (1 min 750 W, 15 min 300 W). Subsequently, sections were treated with 0.5% H2O2 to inhibit endogenous peroxidase, followed by a blockade of unspecific binding sites with 2% non-immune goat serum (Zymed Histostain kit, San Francisco, CA, USA). The UTF-1 antibody was diluted 1:2000 in TBS and incubated overnight at 4°C. Biotinylated goat anti-mouse IgG (Zymed Histostain kit) was applied as a secondary antibody and a peroxidase conjugated streptavidin complex (Zymed Histostain kit) was used as a tertiary layer. Visualization was performed with aminoethyl carbasole (Zymed Histostain kit). Between incubation steps, the slides were washed with TBS. When needed counterstaining was performed with Meyer’s haematoxylin. A direct approach was used for the REX-1 antibody. Deparaffination, antigen demasking in citrate buffer (1 min 750 W, 15 min 375 W) and H2O2 blockade of endogenous peroxidase was carried out in the same manner as for UTF-1. Non-immune human serum (Rigshospitalet) diluted 1:4 in TBS was used for blockade of unspecific binding, followed by incubation overnight (4°C) with the biotinylated sheep anti-human REX-1 antibody diluted 1:25 in TBS. After TBS washing, a streptavidin-conjugated alkaline phosphatase complex (1:1000 in TBS) (Roche Diagnostics, Basel, Switzerland) was applied for 1 h. Excess streptavidin complex was removed by washing with TBS, followed by 5 min in development buffer (0.1 M Tris–HCl pH 9.5; 0.1 M NaCl; 50 mM MgCl2). Colour development was carried out with 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) (Sigma-Aldrich, St Louis, MO, USA) with levamisol (Sigma-Aldrich) to inhibit endogenous phosphatases. The REX-1 antibody stained in all combinations of fixatives and microwave treatments using citrate buffer, TEG buffer and 5% urea, except for the combination of PFA and urea microwave treatment. Immunohistochemical (IHC) staining for OCT-3/4 (diluted 1:250) was performed using a standard indirect peroxidase method, as previously described (Rajpert-De Meyts et al., 2004). All experiments were performed with control staining without the primary antibody.
Examination was done on a Nikon Microphot-FXA microscope (Nikon, Tokoyo, Japan) and two investigators scored results. Staining intensity was assessed using an arbitrary semi-quantitative score of staining intensity: ++, strong staining; +, weak staining and neg, no staining.
Reverse transcription–polymerase chain reaction
Total RNA was isolated with NucleoSpin RNA II purification kit as described by the manufacturer (Macherey-Nagel, Düren, Germany). cDNA was synthesized using a dT20 primer and random hexamers. Specific primers (
20 bp) targeting each mRNA were designed. RT–PCR was performed using specific primers spanning intron–exon boundaries, including RPS20 as an internal control (UTF-1: CGCCGCTACAAGTTCCTTAAA & GGATCTGCTCGTCGAAGGG; REX-1: GGAATGTGGGAAAGCGTTCGT & CCGTGTGGATGCGCACGT; RPS20: AGACTTTGAGAATCACTACAAGA & ATCTGCAATGGTGACTTCCAC). Cycle conditions were: one cycle of 2 min at 95°C; 40 cycles of 30 sec at 95°C, 1 min at 55°C (UTF-1) or 62°C (REX-1 & RPS20), 1 min at 72°C and finally one cycle of 5 min at 72°C. RT–PCR for UTF-1 was furthermore performed with a 50% supplement of 7-deaza-dGTP (Roche Diagnostics) due to a very high C+G% in transcript. PCR products were run on 1.5% agarose gels and visualized by ethidium bromide staining. Representative bands from each primer combination were excised and sequenced for verification (DNA Technology, Aarhus, Denmark).
In situ hybridization
Probes for ISH were prepared by RT–PCR amplification of REX-1 transcripts (GCTGCCCTGAGAAAGCATCT & GCGTTAGGATGTGGGCTTTC) and reamplification of PCR fragments using nested primers specific to the fragments with an added T3-promotor sequence in combination with the T7-extended downstream primer (AATTAACCCTCACTAAAGGGTGAGAGCTCAAAACTAA & TAATACGACTCACTATAGGGCTTTCAGGTTATTTGAC; T3 and T7 promoters sequencers are underlined). PCR conditions were: 5 min 95°C; five cycles of 30 sec 95°C, 1 min 45°C, 1 min 72°C; 20 cycles of 30 sec 95°C, 1 min 65°C, 1 min 72°C and finally 5 min 72°C. The resulting PCR product was purified on a 2% low melting point agarose gel and sequenced from both ends, using primers complementary to the added T3 and T7 tags. Aliquots of 
200 ng were used for in vitro transcription labelling, using the MEGAscript-T3 (sense) or MEGAscript-T7 (anti-sense) kits, as described by the manufacturer (Ambion/ABI, Austin, TX, USA). To estimate quantity and labelling efficiencies, aliquots of the labelled RNA product were analysed by agarose gel electrophoresis. ISH was performed as described previously (Nielsen et al., 2003). In brief, sections were re-fixed in 4% PFA, treated with proteinase K (Sigma-Aldrich) (1.0–5.0 mg/ml), post-fixed in PFA, pre-hybridized 1 h at 50°C and hybridized overnight at 50°C with biotinylated antisense and sense control probes. Excess probe was removed with x0.1 standard saline citrate (60°C). Visualization was performed with streptavidin conjugated with alkaline phosphatase (1:1000) (Roche Diagnostics) followed by a development with BCIP/NBT.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
The ontogeny of UFT-1 expression in normal human testes and ovaries
UTF-1 staining was present exclusively in germ cells and confined to the cell nucleus, with the exception of cytoplasmic staining observed in some infantile spermatogonia from a 6 years old boy (Fig. 1B). UTF-1 was present in germ cells in a specimen from a male fetus at 14 weeks of gestation (
14 weeks of development), whereas other specimens from gestation week 15, 16 and 41 were negative. UTF-1 staining was also seen post-natally in a 4-month-old boy, where some of the infantile spermatogonia were positive (Fig. 1A). This pattern persisted in all pre-pubertal, peri-pubertal and adult testicular samples with consistent staining of spermatogonia in adult testes. The strongest UTF-1 staining was seen in gonocytes in a testis from gestation week 14, in single isolated infantile spermatogonia in the testis from a 4 months old boy, and in mature spermatogonia (Fig. 2A). No staining was observed in ovaries at gestational week 26 and 40. All staining results are listed in Table 1. The IHC staining of germ cells was further supported by RT–PCR showing the presence of UTF-1 transcripts in adult testes, whereas an adult testis without germ cells (Sertoli cell only) was negative (Fig. 1E). UTF-1 ISH results were unreliable due to a high C+G% in the transcript.
|
|
|
The ontogeny of REX-1 expression in normal human testes and ovaries
REX-1 expression was observed in germ cells at gestation week 16, 23 and 41 during male fetal gonadal development. REX-1 staining was also seen post-natally, where the majority of the infantile spermatogonia were positive. The staining of germ cells persisted in all prepubertal, peripubertal and adult testes (Fig. 3A). In addition, some immature Sertoli cells in post-natal and prepubertal specimens had a possible weak staining, which was absent in mature testes. In adult testes, REX-1 staining of spermatogonia was weak and only observed in specimens fixed in PFA (Fig. 3B). However, spermatocytes were strongly positive (in all fixatives) and these cells showed the strongest expression observed. RT–PCR further documented the presence of REX-1 transcript in germ cells in adult testes, whereas an adult testis without germ cells (Sertoli cell only) was negative (Fig. 1E). ISH confirmed the presence of REX-1 transcripts in spermatogonia, spermatocytes and round spermatids (Fig. 3C).
|
Strong IHC staining of REX-1 was also observed during female development, as all samples from gestation week 26 and 40 were positive (Fig. 1C). Staining was, with the exception of gonocytes at gestation week 16, confined to the cytoplasm in all tissues during gonadal development and in adult testes.
Expression of UTF-1 and REX-1 in testicular germ cell neoplasms
There was nuclear UTF-1 expression in CIS cells (Fig. 2B) and strong nuclear expression in germ cell neoplasms derived from CIS cells (Fig. 2C and E). This was further supported by the transcriptional level with RT–PCR, as classic seminoma, teratoma, EC, EC with yolk sac and choriocarcinoma all showed expression of the UTF-1 transcript (Fig. 1E). RT–PCR on four different CIS samples showed varying levels of UTF-1 transcript ranging from high to nearly undetectable expression. In classical seminoma, the majority of cells had nuclear expression of UTF-1; however, single cells in cytokinesis showed a cytoplasmic staining of the UTF-1 protein, presumably due to the absence of the nuclear membrane (Fig. 2E). All spermatocytic seminomas (n = 18) expressed UTF-1, but the staining varied from scattered single cells to intense staining of all cells (Fig. 2F).
CIS cells and classical seminoma showed positive staining for REX-1 in the cytoplasm (Fig. 3E and H). CIS cells were generally strongly stained and a small fraction was negative, whereas seminomas were weakly stained. Non-seminomas showed strong cytoplasmic staining, however three of seven examined tumours included groups of cells with stained nuclei (Fig. 3I). RT–PCR confirmed the presence of the REX-1 transcripts in four different CIS samples, classic seminoma, teratoma, EC and EC with yolk sac and choriocarcinoma (Fig. 1E). Moreover, ISH further showed the presence of REX-1 transcripts in the cytoplasm of CIS cells (Fig. 3F), classic seminoma and EC. Spermatocytic seminomas were examined by IHC (n = 19), and the majority were weakly positive for REX-1 protein, whereas two were completely negative. In two of the positive samples, both cytoplasm and nuclei were stained, whereas all others had only cytoplasmic REX-1 expression (Fig. 3K).
OCT-3/4 staining in ovary and EC
A fetal ovary from gestation week 33 was examined for OCT-3/4 expression and showed weak staining in the cytoplasm of the oocytes in meiotic prophase (Fig. 1D). Furthermore, serial sections of EC were made to compare OCT-3/4 expression with REX-1 and UTF-1, respectively. The results showed that areas expressing OCT-3/4 in the nuclei overlapped with similar areas expressing UTF-1 in the nuclei and REX-1 in the cytoplasm (Figs 2D and 3J); however, weak REX-1 staining was sometimes observed outside these cell groups.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
REX-1 and UTF-1 are presumed markers for pluripotency (Niwa, 2001
; Richards et al., 2004). The present study established the ontogeny of expression of UTF-1 and REX-1 in normal human testes and ovaries during development and investigated aberrations of this expression in TGCTs.
We demonstrated that during normal human development both proteins are expressed in the gonads. However, the results showed a marked difference in the cellular localization of the two transcription factors. Whereas UTF-1 expression was always nuclear with the exception of few single cells in a specimen from a 6 years old boy, REX-1 was, with the exception of gonocytes at gestation week 16, exclusively localized to the cytoplasm during male development. The nuclear presence of UTF-1 in early gonocytes (14 weeks of gestation) and spermatogonia together with REX-1 in early development, indicate possible roles in proliferation (Nishimoto et al., 2005) and in establishing a chromatin state that renders the cells susceptible to differentiation (Van den Boom et al., 2007), similar to what has been shown for ES cells. Although we see a strong staining for UTF-1 of gonocytes at 14 weeks of gestation, this staining is absent in all samples from later stages of fetal development, but reappears in single cells post-natally at 4 months of age and in a larger percentage of cells as the maturation of spermatogonia proceeds. This could suggest that UTF-1 is down-regulated as the gonocytes enters mitotic arrest, where differentiation is blocked, and become re-expressed as the maturation proceeds towards the spermatogonia, preparing the chromatin for the spermatogonial differentiation programme. This fits well with recent data showing that UTF-1 renders ES cells prone for differentiation (Van den Boom et al., 2007). The reason for the cytoplasmic UTF-1 staining in prespermatogonia in a specimen from a 6 years old boy could be that cells are under differentiation and have not yet translocated the protein to the nucleus.
The cytoplasmic localization of REX-1 later during development and in normal testes was surprising taking into consideration that the protein is reported to be a transcription factor (Hosler et al., 1989; Ben Shushan et al., 1998). A similar cytoplasmic expression has been shown in normal human renal tissue with a different antibody (Raman et al., 2006). Intriguingly, a recent study has shown that transcription factors can have dual roles. Caraveo et al. (2006) reported that the transcription factor TFII-I affects Ca2+ channels not through its effects on gene expression, but by competing with the channel for binding the enzyme phospholipase C (PLC). Since REX-1 is exclusively localized to the cytoplasm in nearly all our samples, it seems plausible that the protein is not merely sequestered but is having some unresolved functional roles in the cytoplasm. A role in meiosis is likely, when taking into consideration the up-regulation seen in meiotic cells in testes together with the co-expression with OCT-3/4 in meiotic oocytes. A similar scenario has previously been suggested for Oct-3/4 in mouse oocyte maturation. Pesce et al. (1998) reported that mouse oocytes start to re-express Oct-3/4 preceding the end of meiotic prophase I and argued that the factor could play a role(s) in oocyte growth and the acquisition of the competence to resume meiosis.
Expression patterns of UTF-1 and REX-1 in male development are quite unlike that observed for other pluripotency markers such as OCT-3/4 and NANOG, which are gradually down-regulated during gestation and finally disappear at 2–4 months of age (Rajpert-De Meyts et al., 2004; Hoei-Hansen et al., 2005). During this period of early infancy, a transient increase in the production of testicular hormones occurs, known as the "mini-puberty" (Forest et al., 1973), which coincides with the final stage of differentiation of gonocytes into infantile spermatogonia (Hadziselimovic et al., 1986). Our observation of REX-1 and UTF-1 expression is in concert with the expression of Oct-3/4 in mice, which continues in germ cells from birth into adolescence and in adult type A spermatogonia (Pesce et al., 1998). The pluripotent potential of mouse spermatogonia is evident by the recent derivation of cells with ES cell properties from adult spermatogonia (Guan et al., 2006).
CIS cells are the cancer stem cells for both classical seminomas and non-seminomas and they express both NANOG and OCT-3/4. Interestingly, REX-1 was exclusively expressed in the cytoplasm in CIS cells, classical seminoma and half of the non-seminomas, whereas the remaining non-seminomas had groups of cells expressing REX-1 in both cytoplasm and nuclei. This could indicate that REX-1 is transferred to the nucleus as the tumour progress towards a more pluripotent phenotype. Detection of UTF-1 and REX-1 in CIS cells, and in classical seminoma and non-seminomas derived from CIS cells, also shows the classic association with OCT-3/4 and pluripotency known from studies on ES cells (Ben Shushan et al., 1998; Niwa, 2001; Nishimoto et al., 2005). Although un-coupled from OCT-3/4 and NANOG, the continued expression of UTF-1 and REX-1 shows that some features of the embryonic phenotype still persist in the germ cells in the mature human testes. However, the role of these factors in the adult germ cells may no longer be related to pluripotency, but rather to a high rate of proliferation and self-renewal (UTF-1) or meiotic division (REX-1).
Female gonadal development is very different from the male, as development of meiotic cells is initiated during fetal development. Hence, the expression of pluripotency associated genes in oogenesis do not seem to differ much between humans and mice, which probably is due to the differentiation of oogonia to oocytes already during fetal life (Rajpert-De Meyts et al., 2004). In contrast to the ovary, the differentiation and specialization of male germ cells is spread over a much longer period, and is associated with a gradual differentiation of primordial germ cells, first into gonocytes and later into infantile spermatogonia. This long period of differentiation may render the male germ cells more vulnerable to errors leading to transformation to CIS cells.
In addition to the surprising continued expression of the pluripotency markers UTF-1 and REX-1 throughout human gonadal development, this study also indicates a possible role for these proteins in spermatocytic seminoma. Spermatocytic seminomas are benign testicular tumours found predominately in the testes of relatively older men (Eble, 1994). It is becoming increasingly evident that these tumours are not derived from CIS cells and hence are not a variant of classical seminomas. However, in spite of its name, the cell of origin for spermatocytic seminoma is at the moment unresolved with both spermatogonia and spermatocytes being possible candidates (Rajpert-De Meyts et al., 2003; Looijenga et al., 2006). Since UTF-1 is solely expressed in spermatogonia in the mature testes and REX-1 is predominantely expressed in spermatocytes with a weak trace in spermatogonia, expression of the two proteins may reflect the origin of spermatocytic seminoma. UTF-1 was expressed in all investigated spermatocytic seminomas, whereas REX-1 expression was absent from two specimens and was generally weak when compared with spermatocytes in normal testes, which supports an origin of spermatocytic seminoma from spermatogonia (Rajpert-De Meyts et al., 2003). These results also fit with the prevailing concept of the "cancer stem cell" hypothesis, which argue that tumours originate from either tissue stem cells or their immediate progeny through malfunctions in the process of self-renewal. As a result of this, tumours contain so-called "cancer stem cells" that retain key stem cell properties (Wicha et al., 2006). In the testes, spermatogonia are the stem cells and the only cells that self-renew, whereas all other cells are in different stages of meiosis.
In summary, our study demonstrates that UTF-1 and REX-1, which in ES cells are associated with pluripotency, are expressed in human germ cells throughout development and continue to be expressed in germ cells in adult testes. This scenario is different from the pattern known from other pluripotency markers (NANOG and OCT-3/4), which are finally down-regulated at around 3 months of age. In mature testes, UTF-1 is exclusively expressed in spermatogonia indicating a role in self-renewal, whereas REX-1 predominantly is expressed in meiotic cells during both oogenesis and spermatogenesis. The expression of UTF-1 in all investigated spermatocytic seminomas supports the origin of this tumour type from spermatogonia.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
The Danish Cancer Society and the Svend Andersen Foundation supported this study.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
The authors wish to thank Brian Vendelbo Hansen and Pernille Timmerby Sørensen for skilful technical assistance.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Andrews PW, Matin MM, Bahrami AR, Damjanov I, Gokhale P, Draper JS. Embryonic stem (ES) cells and embryonal carcinoma (EC) cells: opposite sides of the same coin. Biochem Soc Trans (2005) 33:1526–1530.[CrossRef][Web of Science][Medline]
Ben Shushan E, Thompson JR, Gudas LJ, Bergman Y. Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol Cell Biol (1998) 18:1866–1878.
Caraveo G, van Rossum DB, Patterson RL, Snyder SH, Desiderio S. Action of TFII-I outside the nucleus as an inhibitor of agonist-induced calcium entry. Science (2006) 314:122–125.
Eble JN. Spermatocytic seminoma. Hum Pathol (1994) 25:1035–1042.[CrossRef][Web of Science][Medline]
Eble JN, Sauter G, Epstein JI, Sesterhenn IA. Pathology and Genetics of Tumours of the Urinary System and Male Genital Organs (2004) Lyon, France: Thieme-Stratton Inc. 1–359.
Forest MG, Cathiard AM, Bertrand JA. Evidence of testicular activity in early infancy. J Clin Endocrinol Metab (1973) 37:148–151.
Guan K, Nayernia K, Maier LS, Wagner S, Dressel R, Lee JH, Nolte J, Wolf F, Li M, Engel W, et al. Pluripotency of spermatogonial stem cells from adult mouse testis. Nature (2006) 440:1199–1203.[CrossRef][Medline]
Hadziselimovic F, Thommen L, Girard J, Herzog B. The significance of postnatal gonadotropin surge for testicular development in normal and cryptorchid testes. J Urol (1986) 136:274–276.[Web of Science][Medline]
Hoei-Hansen CE, Almstrup K, Nielsen JE, Brask SS, Graem N, Skakkebaek NE, Leffers H, Rajpert-De Meyts E. Stem cell pluripotency factor NANOG is expressed in human fetal gonocytes, testicular carcinoma in situ and germ cell tumours. Histopathology (2005) 47:48–56.[CrossRef][Web of Science][Medline]
Hosler BA, LaRosa GJ, Grippo JF, Gudas LJ. Expression of REX-1, a gene containing zinc finger motifs, is rapidly reduced by retinoic acid in F9 teratocarcinoma cells. Mol Cell Biol (1989) 9:5623–5629.
Jacobsen GK, Norgaard-Pedersen B. Placental alkaline phosphatase in testicular germ cell tumours and in carcinoma-in-situ of the testis. An immunohistochemical study. Acta Pathol Microbiol Immunol Scand (1984) 92:323–329.
Kleinsmith LJ, Pierce GB. Multipotentiality of single embryonal carcicoma cells. Cancer Res (1964) 24:1544–1551.
Looijenga LH, Hersmus R, Gillis AJ, Pfundt R, Stoop HJ, van Gurp RJ, Veltman J, Beverloo HB, van Drunen E, van Kessel AG, et al. Genomic and expression profiling of human spermatocytic seminomas: primary spermatocyte as tumorigenic precursor and DMRT1 as candidate chromosome 9 gene. Cancer Res (2006) 66:290–302.
Nielsen JE, Hansen MA, Jorgensen M, Tanaka M, Almstrup K, Skakkebaek NE, Leffers H. Germ cell differentiation-dependent and stage-specific expression of LANCL1 in rodent testis. Eur J Histochem (2003) 47:215–222.[Web of Science][Medline]
Nishimoto M, Fukushima A, Okuda A, Muramatsu M. The gene for the embryonic stem cell coactivator UTF1 carries a regulatory element which selectively interacts with a complex composed of Oct-3/4 and Sox-2. Mol Cell Biol (1999) 19:5453–5465.
Nishimoto M, Miyagi S, Yamagishi T, Sakaguchi T, Niwa H, Muramatsu M, Okuda A. Oct-3/4 maintains the proliferative embryonic stem cell state via specific binding to a variant octamer sequence in the regulatory region of the UTF1 locus. Mol Cell Biol (2005) 25:5084–5094.
Niwa H. Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct Funct (2001) 26:137–148.[CrossRef][Web of Science][Medline]
Okuda A, Fukushima A, Nishimoto M, Orimo A, Yamagishi T, Nabeshima Y, Kuro-o M, Nabeshima Y, Boon K, Keaveney M, et al. UTF1, a novel transcriptional coactivator expressed in pluripotent embryonic stem cells and extra-embryonic cells. EMBO J (1998) 17:2019–2032.[CrossRef][Web of Science][Medline]
Pesce M, Wang X, Wolgemuth DJ, Scholer H. Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation. Mech Dev (1998) 71:89–98.[CrossRef][Web of Science][Medline]
Rajpert-De Meyts E. Developmental model for the pathogenesis of testicular carcinoma in situ: genetic and environmental aspects. Hum Reprod Update (2006) 12:303–323.
Rajpert-De Meyts E, Jacobsen GK, Bartkova J, Aubry F, Samson M, Bartek J, Skakkebaek NE. The immunohistochemical expression pattern of Chk2, p53, p19INK4d, MAGE-A4 and other selected antigens provides new evidence for the premeiotic origin of spermatocytic seminoma. Histopathology (2003) 42:217–226.[CrossRef][Web of Science][Medline]
Rajpert-De Meyts E, Hanstein R, Jorgensen N, Graem N, Vogt PH, Skakkebaek NE. Developmental expression of POU5F1 (OCT-3/4) in normal and dysgenetic human gonads. Hum Reprod (2004) 19:1338–1344.
Raman JD, Mongan NP, Liu L, Tickoo SK, Nanus DM, Scherr DS, Gudas LJ. Decreased expression of the human stem cell marker, Rex-1 (zfp-42), in renal cell carcinoma. Carcinogenesis (2006) 27:499–507.
Richards M, Tan SP, Tan JH, Chan WK, Bongso A. The transcriptome profile of human embryonic stem cells as defined by SAGE. Stem Cells (2004) 22:51–64.[CrossRef][Web of Science][Medline]
Rogers MB, Hosler BA, Gudas LJ. Specific expression of a retinoic acid-regulated, zinc-finger gene, Rex-1, in preimplantation embryos, trophoblast and spermatocytes. Development (1991) 113:815–824.[Abstract]
Skakkebaek NE. Abnormal morphology of germ cells in two infertile men. Acta Pathol Microbiol Scand (1972) 80:374–378.
Van den Boom V, Kooistra SM, Boesjes M, Geverts B, Houtsmuller AB, Monzen K, Komuro I, Essers J, Drenth-Diephuis LJ, Eggen BJ. UTF1 is a chromatin-associated protein involved in ES cell differentiation. J Cell Biol (2007) 178:913–924.
Wicha MS, Liu S, Dontu G. Cancer stem cells: an old idea–a paradigm shift. Cancer Res (2006) 66:1883–1890.
Submitted on September 19, 2007; resubmitted on October 24, 2007; accepted on December 5, 2007.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||