Skip Navigation



Hum. Reprod. Advance Access published online on March 1, 2008

Human Reproduction, doi:10.1093/humrep/den050
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
23/5/1220    most recent
den050v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rohr, J.
Right arrow Articles by Sherman, S.L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rohr, J.
Right arrow Articles by Sherman, S.L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Anti-Mullerian hormone indicates early ovarian decline in fragile X mental retardation (FMR1) premutation carriers: a preliminary study

J. Rohr1, E.G. Allen1,3, K. Charen1, J. Giles1, W. He1, C. Dominguez2 and S.L. Sherman1,3

1 Department of Human Genetics, Emory University School of Medicine, 615 Michael Street, Suite 301, Whitehead Building, Atlanta, GA, 30322, USA 2 Department of Gynecology and Obstetrics, Emory University School of Medicine, Atlanta, GA 30322, USA

3 Correspondence address. E-mail: egraves{at}genetics.emory.edu (E.G.A.); ssherman{at}genetics.emory.edu (S.L.S.)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
BACKGROUND: Women who carry the fragile X mental retardation (FMR1) premutation are at risk for fragile X-associated primary ovarian insufficiency. Past studies have shown that carriers who are still cycling have increased levels FSH compared with non-carriers. As anti-Mullerian hormone (AMH) has been shown as an excellent marker of ovarian decline, we examined AMH levels among premutation carriers to characterize their ovarian function.

METHODS: We determined the level of FSH and AMH in serum samples collected during early follicular phase from women who carried longer FMR1 repeat alleles (defined as ≥70 repeats, n = 40) and those with shorter repeat alleles (<70 repeats, n = 75), identified by DNA analysis. Comparisons were made stratified by age and carrier status.

RESULTS: For all age groups, AMH levels were significantly lower among longer repeat allele carriers compared to shorter repeat allele carriers (P = 0.002, 0.006 and 0.020 for women ages 18–30, 31–40 and 41–50 years, respectively). In contrast, increased FSH indicative of early ovarian decline was only evident for longer repeat allele carriers aged 31–40 years (P = 0.089, 0.001 and 0.261 for women ages 18–30, 31–40 and 41–50 years, respectively).

CONCLUSIONS: These preliminary data suggest that AMH levels indicate early ovarian decline among women with longer FMR1 repeat alleles; moreover, AMH appears to be a better marker than FSH in identifying this early decline.

Key words: Mullerian inhibiting substance/fragile X/premature ovarian failure/FSH/menopause


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
The fragile X mental retardation (FMR1) premutation is now a well-established cause of premature ovarian failure (POF), or cessation of menses prior to age 40 years, and the leading known cause of inherited POF. The premutation is clinically defined as having 55–199 unmethylated CGG repeats in the 5' untranslated region (5' UTR) of the FMR1 gene (Sherman et al., 2005Go). When further expanded to over 200 repeats during transmission from mother to offspring and consequently hypermethylated, this allele is referred to as the full mutation and leads to fragile X syndrome, an inherited form of X-linked mental retardation. The prevalence of POF is only 1% in the general population, but reaches to over 20% among women carrying the premutation. Full mutation carriers do not have an increased risk for POF, thus ovarian insufficiency is restricted to premutation carriers (for review, see Sherman et al., 2007Go). Menopausal age is shifted to a younger age by ~5 years compared with non-carriers (Murray et al., 2000Go; Sullivan et al., 2005Go). Other measures of ovarian insufficiency have also been documented at higher frequencies among premutation carriers who are still cycling, including increased gonadotropins, altered menstrual cycle characteristics and infertility (Murray et al., 1999Go, 2000Go; Hundscheid et al., 2001Go; Welt et al., 2004Go; Sullivan et al., 2005Go; Allen et al., 2007Go). To capture this spectrum of traits associated with ovarian insufficiency among premutation carriers, the term fragile X-associated primary ovarian insufficiency (FXPOI) has been suggested (Welt, 2007Go; Abrams, 2007Go).

The significance of FXPOI among women with ovarian insufficiency has also been established. Studies which surveyed women with POF identified primarily through reproductive endocrinology clinics, (Murray et al., 1998Go; Marozzi et al., 2000Go; Mallolas et al., 2001Go; Bussani et al., 2004Go), estimate the frequency of women who are premutation carriers to be 11.5% in those with a family history of ovarian failure (familial POF) and 3.2% in those without a family history (sporadic POF). This frequency compares to the 1/250 frequency of premutation carriers present in the general population.

As yet there is no clinical marker that is prognostic of early ovarian decline among premutation carriers. We and others have shown that the severity of FXPOI is clearly associated with repeat size in a non-linear fashion (Sullivan et al., 2005Go; Ennis et al., 2006Go; Allen et al., 2007Go). Interestingly, the repeat size alleles that carry the highest risk of FXPOI are those in the mid-range of ~80 to ~99, not in those carrying the longest premutation repeat sizes (i.e. 100–200 repeats). Women who carry the 80–99 repeat size when compared to non-carriers have increased rates of infertility, have a 7-year reduction in mean age at menopause, and an increased prevalence of POF (32%) that initiates at younger ages. Carriers of both smaller and larger premutation repeat sizes also suffer from ovarian insufficiency, but not to as great an extent as women with 80–99 repeats (Allen et al., 2007Go).

In a post hoc analysis of the data of Allen et al. (2007)Go, it was concluded that more work needed to be done to determine the repeat size definition for alleles that lead to a high risk for FXPOI. For example, it was noted that among women in the low premutation repeat group, defined a priori as 59–79 repeats, 0/17 with 59–70 repeats and 5/22 with 71–79 repeats had POF. Thus, the lower limit of 'high risk' alleles may be better defined as ≥70 repeats. The repeat premutation size and its association with the risk of FXPOI is clinically important; however, repeat size does not provide an accurate marker to predict the onset and severity of FXPOI.

Recently, AMH, also referred to as Müllerian inhibitory substance, has been identified both as an important regulator of early follicular growth and as a marker of the size of the primordial follicle pool in women. As reviewed by Dr Themmen and his colleagues (van Rooij et al., 2004Go; Visser and Themmen, 2005Go; Visser et al., 2006Go) and based on the recent work of Visser et al. (2007)Go, the role of AMH in the menstrual cycle involves regulation of the recruitment from the primordial follicle pool and selection for dominance for ovulation. AMH, like activin and inhibin, is a member of the transforming growth factor-β family. Using immunohistochemistry in ovarian sections obtained from healthy regularly cycling women, Weenen et al. (2004)Go showed that AMH is only expressed in growing follicles and disappears in preovulatory follicles. Thus, serum AMH levels are indicative of the size of the growing follicle pool assuming that the number of follicles is indirectly reflected by the number of growing follicles (Scheffer et al., 1999Go). Thus, serum AMH levels may provide an excellent prognostic marker for premutation carriers. To test this hypothesis, we compared AMH levels among women with a wide range of FMR1 repeat sizes using frozen serum samples that had been previously collected for FSH studies. Our preliminary data suggest that AMH may be a better marker than FSH to detect early ovarian decline and should be applied in large population studies as a prognostic marker.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Study sample
The study sample comprised 219 women who were recruited through the Emory Study of Adult Learning and Reproduction. These participants are a sub-sample of the women reported in Sullivan et al. (2005)Go and Allen et al. (2007)Go. They were identified through families with fragile X syndrome (n = 80) and from the general population (n = 139), as described in detail in Sullivan et al. (2005)Go. All women were between the ages of 18 and 50 years and English-speaking. Each provided a venous blood sample for DNA to determine carrier status and for serum FSH studies. For women who were still cycling and not on hormonal medication, we obtained fasting blood samples on the third day of their cycle. Women were classified as being on hormone medication if they self-reported taking birth control pills, hormone shots or implants, or estrogen replacement therapy. For women using oral contraceptives, we obtained blood on the third day of their placebos. Medical exclusions for the hormone studies included women who had had their ovaries removed, those who had undergone chemotherapy or radiation therapy, and those who were pregnant or breast feeding at the time of interview. In addition, all women completed a questionnaire regarding her reproductive history. Of the 219 women for whom we had obtained FSH levels, we had stored frozen serum from 74 that could be used to conduct AMH analyses. We had an additional 41 serum samples from women ascertained under the same protocol from which we obtained AMH levels, but not FSH levels. The protocols and consent forms for each enrollment strategy were approved by the Institutional Review Board at Emory University, and informed consent was obtained from all participants.

Data collection
Questionnaires
The questionnaires provided information on women’s menstrual cycle characteristics and fertility. Women also provided information on other factors that may affect ovarian function including age, height and weight, smoking and hormone medication use. The questionnaires were administered in person, on the phone and in a self-administered format.

Hormone assays
Serum was extracted from a fresh 10 ml blood sample and stored at –70° until the assay was performed in batch. All samples were collected within the last 6 years.

An immunoradiometric procedure (Diagnostic Products; Los Angeles, CA, USA) was used to determine FSH levels for 178 samples that were reported in Sullivan et al. (2005)Go. The assay sensitivity was <0.2 mIU/ml and within assay coefficient of variation (CV) was 2–5%.

AMH levels were also obtained using a commercially prepared kit produced by Diagnostic Systems Laboratories (Webster, TX, USA). The normal assay range was 0.05–14.0 ng/ml given a 20 µl assay volume. The inter-assay quality control was between 6 and 11% depending on the concentration. Measures were repeated for samples whose CV between the replicates exceeded 20%. AMH values less than 0.05 ng/ml were recorded as zero for our statistical analyses. We also conducted those same analyses with the value recorded as 0.05 ng/ml instead of 0 ng/ml and found essentially the same results (data not shown).

FMR1 CGG repeat size
DNA was extracted from buccal samples or blood using Qiagen QiAmp DNA Blood Mini Kit. FMR1 CGG repeat sizes were determined by a fluorescent-sequencer method, as described elsewhere (Meadows et al., 1996Go), using the ABI Prism 377 DNA Sequencer. For females with only one allele, a second PCR-based, hybridization technique was used to identify a possible long repeat size band (Brown et al., 1993Go). The PCR reaction consisted of 1X PCR Buffer, 10% dimethylsulphoxide, 370 µM deazaG, 500 µM d(ACT), 0.3 µM each primer, 15 ng T4 gene 32 and 1.05 U Roche Expand Long Taq. Primers for the FMR1 repeat region were 5'Cy5GCTCAGCTCCGTTTCGGTTTCACTTCCGGT3' and 5'AGCCCCGCACTTCCACCAGCTCCTCCA3' (designated as primers C and F, respectively, in Fu et al., 1991Go).

Statistical analysis
Preliminary tests indicated that FSH and AMH levels were not normally distributed. FSH could be transformed to normality using a natural log function. No simple transformation could be applied to AMH, as the distribution was truncated at zero. Thus, we decided to use the Wilcoxon rank sum test, a non-parametric test, to compare both untransformed FSH and AMH by repeat size group.

We also evaluated the risk associated with carrying the longer repeat alleles on low ovarian reserve. Owing to the limited sample size and the non-normal distributions of FSH and AMH, a simple statistical approach was taken. Women were defined as having low ovarian reserve if they had AMH levels = 0 ng/ml or if they had FSH levels ≥10 mlU/ml. Logistic regression analyses were conducted to determine the strength of association between repeat size group and low ovarian reserve. We examined the following covariates as possible confounders or effect modifiers: age at blood draw, current hormone use, body mass index and current smoking. If the 95% confidence interval (CI) of the point estimate of the odds ratio (OR) for the covariate in the model did not include one, that variable was included in the model.

For all statistical tests, P < 0.05 was considered significant, although all alternative hypotheses were directional. Statistical analyses were computed using the Statistical Package for the Social Sciences (SPSS) 15.0, released in 2006 by SPSS Inc., Chicago, IL, USA, or using SAS V9.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
On the basis of our previous data related to the identification of high-risk alleles for FXPOI (Allen et al., 2007Go), we defined high-risk allele carriers as women with ≥70 repeats. We will refer to these allele groups as 'shorter' and 'longer' repeat size groups to be clear that these repeat-size definitions differ from those used to define premutation carriers. We first compared FSH levels (Table I, Fig. 1a) and AMH levels (Table II, Fig. 1b) among repeat size groups stratified by age at blood draw among all women, irrespective of hormone use. Among all women, AMH levels were significantly lower in women carrying longer repeat alleles (P = 0.002, 0.006 and 0.020 for women ages 18–30, 31–40 and 41–50 years, respectively). FSH values were significantly higher in women carrying longer repeat alleles, only for those women in the 31–40 year group (P = 0.001) as reported in Sullivan et al. (2005)Go.


View this table:
[in this window]
[in a new window]

 
Table I. Median FSH values (mIU/ml), range and sample size by age group and fragile X mental retardation (FMR1) gene CGG repeat size group.

 

Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1: (A) FSH (mlU/ml) and (B) anti-Mullerian hormone (AMH) (ng/ml) levels by age (years) at blood draw for women who carry <70 CGG repeats (white diamond) and ≥70 repeats (gray square) in the 5' untranslated region of the fragile X mental retardation (FMR1) gene.

 

View this table:
[in this window]
[in a new window]

 
Table II. Median anti-Müllerian hormone values (ng/ml), range and sample size by age group and FMR1 gene repeat size group.

 
When women on hormones were excluded from the analyses, AMH levels were significantly lower for longer repeat allele carriers among women ages 31–40 (P = 0.015), and not significant among women in the young or older age groups (P = 0.243 and 0.089, respectively, Table II). For FSH levels, the patterns were the same with and without women on hormones: only women in the 31–40 year age group showed a significant difference by repeat size alleles (P = 0.001, Table I).

We further examined FSH and AMH values within age and repeat size groups to determine if levels differed among women who used hormones and those who did not. No significant differences were found in any of the groups, although sample sizes were small and limited the ability to detect small differences (data not shown).

Lastly, we evaluated the OR associated with carrying the longer repeat alleles on low ovarian reserve. AMH and FSH levels were dichotomized to indicate low ovarian reserve and logistic regression analyses applied as described in Materials and Methods. For AMH levels =0 ng/ml as the indicator variable for low ovarian reserve, age at blood draw and current hormone use were significant covariates and were included in the model. The adjusted OR and 95% CI for longer repeat group was 22.8 (4.2–122.5). For FSH levels ≥10 mlU/ml as the outcome indicator variable for low ovarian reserve, only age at blood draw was a significant covariate. The age-adjusted OR for the longer repeat group was 1.6 (0.7–3.4).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Taken together, these preliminary data are intriguing. We tested the hypothesis that AMH levels may be a better marker of early ovarian decline compared with FSH. The data from this study suggest that this is true. This is the first report to show that AMH levels are significantly lower among women with longer FMR1 repeat alleles compared to those with shorter repeats, especially at the younger ages (Table II and Fig. 1b). Of importance, we report that FSH levels appear to be a later marker of ovarian decline (Table II and Fig. 1a). The greatest difference in FSH levels between women with longer and shorter repeat alleles occurred in the group aged 31–40 years. AMH levels in the oldest women showed only small differences among repeat size groups, as most women >35 years had AMH near or at zero, irrespective of repeat size. Thus, AMH levels may be a more sensitive marker for predicting the earliest signs of FXPOI rather than onset of menopause among women with the premutation.

Importantly, differences in AMH levels in women under 30 years of age suggest that ovarian reserve is reduced in premutation carriers from a young age. In our previous study using FSH as a marker of ovarian reserve, we concluded that women under age 30 may not be at risk of reduced ovarian reserve (Sullivan et al., 2005Go). Unfortunately, this conclusion does not hold when we use AMH, which is a more sensitive marker for this population and did show a reduction of ovarian reserve in the younger age group.

The results of this study are dependent on inclusion or exclusion of women on hormone medication. First, the sample size is reduced; thus, we cannot draw any strong conclusions. Second, we need to consider if excluding women who were prescribed hormone medication may be excluding those women who are already experiencing cycle irregularity and/or other symptoms of FXPOI. Thus, results would be biased. Further studies need to be conducted to both increase sample size and examine the effect of hormone use on AMH and FSH levels.

There are at least two viable mechanisms to explain FXPOI based on our knowledge of the function of FMRP, the protein produced by FMR1, and the molecular consequence of long repeat alleles in the 5' UTR of FMR1. First, the premutation allele produces a messenger RNA (mRNA) that includes a large repeat track. This premutation mRNA may cause a time-related cumulative toxic effect that eventually leads to an increased rate of follicular atresia during a woman’s reproductive life. Fragile X-related tremor/ataxia syndrome, another FMR1 premutation-associated disorder, has now been shown to be due to this type of mechanism (for review, see Hagerman and Hagerman, 2007Go). Alternatively, the protein may be involved. FMRP regulates translation of a subset of mRNAs using a suppression mechanism (Jin et al., 2004Go). Perhaps increased levels of FMRP at specific times during development could lead to haploinsufficiency of the proteins needed in oocyte or follicle development. Our preliminary data suggest that whatever the effect, this premutation plays a role early in a woman’s reproductive life, evidenced not by FSH fluctuations but by low AMH levels. One limitation of the current study is that we have few women in the younger age groups and we have not tested women less than 18 years of age. Additional studies of younger women are important to help identify when premutation carriers begin to differ from non-carriers with respect to their ovarian reserve. Such studies will also provide insight into the toxic effect of the premutation allele on ovarian function.

Not only is AMH a useful marker of ovarian aging since changes are evident earlier in the reproductive lifespan when compared with other ovarian hormone markers (e.g. Hale et al., 2007Go), but additionally it is not regulated by other hormones (e.g. van Rooji et al., 2002Go), it does not fluctuate during the menstrual cycle (e.g. Hehenkamp et al., 2006Go; La Marca et al., 2006Go; Tsepelidis et al., 2007Go), and it is not changed by pregnancy (La Marca et al., 2005Go). In conclusion, AMH appears to be an excellent marker for clinical studies of FXPOI. AMH may prove to be a non-invasive prognostic marker for premutation carriers to help provide them with additional information on their given risk of ovarian insufficiency beyond that offered by repeat size alone.

Our data and others indicate that women with the premutation, especially those with mid-size repeats, experience an earlier onset of FXPOI. Thus, all premutation carriers are at an increased risk for infertility and having earlier exposure to estrogen deficiency, the latter being a known risk factor for osteoporosis (Richelson et al., 1984Go; Kritz-Silverstein and Barrett-Connor, 1993Go), cardiac disease (van der Schouw et al., 1996Go; de Kleijn et al., 2002Go), colorectal cancer (van Wayenburg et al., 2000Go) and overall mortality (Jansen et al., 2002Go; Jacobsen et al., 2003Go). It is important to conduct a longitudinal study to describe the time course of FXPOI and the earliest age at which diminished ovarian reserve can be detected. This will lead to a better understanding of the natural history of ovarian function among premutation carriers and, potentially to provide insight into the underlying mechanism causing the associated ovarian insufficiency. Importantly, such studies will identify potential markers that predict the onset of subfertility and the possible need for earlier treatment.


    Funding
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
This work was supported by the National Institutes of Health grant HD29909.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
We would like to thank the women who took the time and effort to participate in this study. We also thank the members of the Fragile X Research Team for their help in conducting this project. We thank the Biomarkers Core Laboratory of the Yerkes National Primate Research Center, Emory University, for conducting the hormone assays as well Milburn Emery and Bob Bonsall who conducted the FSH assays in the original study.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Abrams L. From POF to POI: evolution of a Term. Natl Fragile X Found Q (2007) 29:22.

Allen EG, Sullivan AK, Marcus M, Small C, Dominguez C, Epstein MP, Charen K, He W, Taylor K, Sherman SL. Examination of reproductive aging milestones among women who carry the FMR1 premutation. Hum Reprod (2007) 22:2142–2152.[Abstract/Free Full Text]

Brown WT, Houck GEJ, Jeziorowska A, Levinson FN, Ding X, Dobkin C, Zhong N, Henderson J, Brooks SS, Jenkins EC. Rapid fragile X carrier screening and prenatal diagnosis using a nonradioactive PCR test [published erratum appears in JAMA 1994 Jan 5;271(1):28]. J Am Med Assoc (1993) 270:1569–1575.[Abstract/Free Full Text]

Bussani C, Papi L, Sestini R, Baldinotti F, Bucciantini S, Bruni V, Scarselli G. Premature ovarian failure and fragile X premutation: a study on 45 women. Eur J Obstet Gynecol Reprod Biol (2004) 112:189–191.[CrossRef][Web of Science][Medline]

de Kleijn MJ, van der Schouw YT, Verbeek AL, Peeters PH, Banga JD, van der GY. Endogenous estrogen exposure and cardiovascular mortality risk in postmenopausal women. Am J Epidemiol (2002) 155:339–345.[Abstract/Free Full Text]

Ennis S, Ward D, Murray A. Nonlinear association between CGG repeat number and age of menopause in FMR1 premutation carriers. Eur J Hum Genet (2006) 14:253–255.[CrossRef][Web of Science][Medline]

Fu YH, Kuhl DP, Pizzuti A, Pieretti M, Sutcliffe JS, Richards S, Verkerk AJ, Holden JJ, Fenwick RGJ, Warren ST. Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell (1991) 67:1047–1058.[CrossRef][Web of Science][Medline]

Hagerman PJ, Hagerman RJ. Fragile X-associated tremor/ataxia syndrome–an older face of the fragile X gene. Nat Clin Pract Neurol (2007) 3:107–112.[CrossRef][Web of Science][Medline]

Hale GE, Zhao X, Hughes CL, Burger HG, Robertson DM, Fraser IS. Endocrine features of menstrual cycles in middle and late reproductive age and the menopausal transition classified according to the Staging of Reproductive Aging Workshop (STRAW) staging system. J Clin Endocrinol Metab (2007) 92:3060–3067.[Abstract/Free Full Text]

Hehenkamp WJ, Looman CW, Themmen AP, de Jong FH, Te Velde ER, Broekmans FJ. Anti-Mullerian hormone levels in the spontaneous menstrual cycle do not show substantial fluctuation. J Clin Endocrinol Metab (2006) 91:4057–4063.[Abstract/Free Full Text]

Hundscheid RD, Braat DD, Kiemeney LA, Smits AP, Thomas CM. Increased serum FSH in female fragile X premutation carriers with either regular menstrual cycles or on oral contraceptives. Hum Reprod (2001) 16:457–462.[Abstract/Free Full Text]

Jacobsen BK, Heuch I, Kvale G. Age at natural menopause and all-cause mortality: a 37-year follow-up of 19,731 Norwegian women. Am J Epidemiol (2003) 157:923–929.[Abstract/Free Full Text]

Jansen SC, Temme EH, Schouten EG. Lifetime estrogen exposure versus age at menopause as mortality predictor. Maturitas (2002) 43:105–112.[CrossRef][Web of Science][Medline]

Jin P, Alisch RS, Warren ST. RNA and microRNAs in fragile X mental retardation. Nat Cell Biol (2004) 6:1048–1053.[CrossRef][Web of Science][Medline]

Kritz-Silverstein D, Barrett-Connor E. Early menopause, number of reproductive years, and bone mineral density in postmenopausal women. Am J Public Health (1993) 83:983–988.[Abstract/Free Full Text]

La Marca A, Giulini S, Orvieto R, De LV, Volpe A. Anti-Mullerian hormone concentrations in maternal serum during pregnancy. Hum Reprod (2005) 20:1569–1572.[Abstract/Free Full Text]

La Marca A, Stabile G, Artenisio AC, Volpe A. Serum anti-Mullerian hormone throughout the human menstrual cycle. Hum Reprod (2006) 21:3103–3107.[Abstract/Free Full Text]

Mallolas J, Duran M, Sanchez A, Jimenez D, Castellvi-Bel S, Rife M, Mila M. Implications of the FMR1 gene in menopause: study of 147 Spanish women. Menopause (2001) 8:106–110.[CrossRef][Web of Science][Medline]

Marozzi A, Vegetti W, Manfredini E, Tibiletti MG, Testa G, Crosignani PG, Ginelli E, Meneveri R, Dalpra L. Association between idiopathic premature ovarian failure and fragile X premutation. Hum Reprod (2000) 15:197–202.[Abstract/Free Full Text]

Meadows KL, Pettay D, Newman J, Hersey J, Ashley AE, Sherman SL. Survey of the fragile X syndrome and the fragile X E syndrome in a special education needs population. Am J Med Genet (1996) 64:428–433.[CrossRef][Web of Science][Medline]

Murray A, Webb J, Grimley S, Conway G, Jacobs P. Studies of FRAXA and FRAXE in women with premature ovarian failure. J Med Genet (1998) 35:637–640.[Abstract/Free Full Text]

Murray A, Webb J, MacSwiney F, Shipley EL, Morton NE, Conway GS. Serum concentrations of follicle stimulating hormone may predict premature ovarian failure in FRAXA premutation women. Hum Reprod (1999) 14:1217–1218.[Abstract/Free Full Text]

Murray A, Ennis S, MacSwiney F, Webb J, Morton NE. Reproductive and menstrual history of females with fragile X expansions. Eur J Hum Genet (2000) 8:247–252.[CrossRef][Web of Science][Medline]

Richelson LS, Wahner HW, Melton LJ III, Riggs BL. Relative contributions of aging and estrogen deficiency to postmenopausal bone loss. N Engl J Med (1984) 311:1273–1275.[Abstract]

Scheffer GJ, Broekmans FJ, Dorland M, Habbema JD, Looman CW, Te Velde ER. Antral follicle counts by transvaginal ultrasonography are related to age in women with proven natural fertility. Fertil Steril (1999) 72:845–851.[CrossRef][Web of Science][Medline]

Sherman S, Pletcher BA, Driscoll DA. Fragile X syndrome: diagnostic and carrier testing. Genet Med (2005) 7:584–587.[Web of Science][Medline]

Sherman SL, Taylor K, Allen EG. FMR1 premutation: a leading cause of inherited ovarian dysfunction. In: Fragile Sites: New Discoveries and Changing Perspectives—Arrieta I, Penagarikano O, et al, eds. (2007) Nova Science Publishers, Inc.

Sullivan AK, Marcus M, Epstein MP, Allen EG, Anido AE, Paquin JJ, Yadav-Shah M, Sherman SL. Association of FMR1 repeat size with ovarian dysfunction. Hum Reprod (2005) 20:402–412.[Abstract/Free Full Text]

Tsepelidis S, Devreker F, Demeestere I, Flahaut A, Gervy C, Englert Y. Stable serum levels of anti-Mullerian hormone during the menstrual cycle: a prospective study in normo-ovulatory women. Hum Reprod (2007) 22:1837–1840.[Abstract/Free Full Text]

van der Schouw YT, van der GY, Steyerberg EW, Eijkemans JC, Banga JD. Age at menopause as a risk factor for cardiovascular mortality. Lancet (1996) 347:714–718.[CrossRef][Web of Science][Medline]

van Rooij IA, Tonkelaar I, Broekmans FJ, Looman CW, Scheffer GJ, de Jong FH, Themmen AP, Te Velde ER. Anti-mullerian hormone is a promising predictor for the occurrence of the menopausal transition. Menopause (2004) 11:601–606.[CrossRef][Medline]

van Wayenburg CA, van der Schouw YT, van Noord PA, Peeters PH. Age at menopause, body mass index, and the risk of colorectal cancer mortality in the Dutch Diagnostisch Onderzoek Mammacarcinoom (DOM) cohort. Epidemiology (2000) 11:304–308.[CrossRef][Web of Science][Medline]

van Rooji IA, Broekmans FJ, Te Velde ER, Fauser BC, Bancsi LF, de Jong FH, Themmen AP. Serum anti-Mullerian hormone levels: a novel measure of ovarian reserve. Hum Reprod (2002) 17:3065–3071.[Abstract/Free Full Text]

Visser JA, Themmen AP. Anti-Mullerian hormone and folliculogenesis. Mol Cell Endocrinol (2005) 234:81–86.[CrossRef][Web of Science][Medline]

Visser JA, de Jong FH, Laven JS, Themmen AP. Anti-Mullerian hormone: a new marker for ovarian function. Reproduction (2006) 131:1–9.[Abstract/Free Full Text]

Visser JA, Durlinger AL, Peters IJ, van den Heuvel ER, Rose UM, Kramer P, de Jong FH, Themmen AP. Increased oocyte degeneration and follicular atresia during the estrous cycle in anti-Mullerian hormone null mice. Endocrinology (2007) 148:2301–2308.[Abstract/Free Full Text]

Weenen C, Laven JS, Von Bergh AR, Cranfield M, Groome NP, Visser JA, Kramer P, Fauser BC, Themmen AP. Anti-Mullerian hormone expression pattern in the human ovary: potential implications for initial and cyclic follicle recruitment. Mol Hum Reprod (2004) 10:77–83.[Abstract/Free Full Text]

Welt CK. Primary ovarian insufficiency: a more accurate term for premature ovarian failure. Clin Endocrinol (Oxf) (2007).

Welt CK, Smith PC, Taylor AE. Evidence of early ovarian aging in fragile X premutation carriers. J Clin Endocrinol Metab (2004) 89:4569–4574.[Abstract/Free Full Text]

Submitted on September 3, 2007; resubmitted on January 23, 2008; accepted on January 31, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
23/5/1220    most recent
den050v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rohr, J.
Right arrow Articles by Sherman, S.L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rohr, J.
Right arrow Articles by Sherman, S.L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?