Hum. Reprod. Advance Access published online on March 13, 2008
Human Reproduction, doi:10.1093/humrep/den083
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Retinoids regulate genes involved in retinoic acid synthesis and transport in human myometrial and fibroid smooth muscle cells
1 Centre for Womens Health Research, Monash University Department of Obstetrics and Gynaecology, Monash Institute of Medical Research, 246 Clayton Road, 3168 Clayton, Victoria, Australia 2 Womens and Childrens Program, Southern Health, Melbourne, Victoria, Australia
3Correspondence address. Tel: +61-3-9594-5370; Fax: +61-3-9594-6389; E-mail: peter.rogers{at}med.monash.edu.au
| Abstract |
|---|
|
|
|---|
BACKGROUND: Despite the fact that uterine fibroids are the most common benign tumors in women, their etiology is poorly understood. We have previously shown that multiple members of the retinoic acid (RA) pathway have altered expression in fibroids compared with normal myometrium. The aims of the present study were: to investigate regulation of genes involved in the RA pathway in vitro; and to identify genes that can be used as markers to distinguish myometrial and fibroid smooth muscle cells in culture.
METHODS and RESULTS: We demonstrate here for the first time that differential expression of aldehyde dehydrogenase 1 (ALDH1) between fibroids and myometrium is maintained in cell culture (without endothelial cells), and that this gene is differentially regulated by retinoids in myometrial compared with fibroid cells. RA and retinol also regulate expression of ADH1, cellular retinol binding protein 1 and cellular RA binding protein 2 in fibroid and myometrial cells. We show that many of the RA pathway genes tested maintain expression levels and differences in vitro. We also identify nine genes that are differentially expressed between myometrium and fibroids and maintain these differences and expression levels in cultured cells isolated from the same tissues. These genes can be used as markers to distinguish myometrial and fibroid cells in culture.
CONCLUSIONS: Based on these findings, we propose that the RA pathway has an important and possible causative role in fibroid growth, as evidenced by the large number of genes with significantly altered expression in uterine fibroids that can be regulated by RA.
Key words: fibroids/retinoic acid/aldehyde dehydrogenase 1/gene expression/markers
| Introduction |
|---|
|
|
|---|
Uterine fibroids (leiomyomas, myomas) are benign tumors of myometrial smooth muscle cells (MSMC) occurring in up to 80% of women by the age of 50 years (Day Baird et al., 2003
The etiology of fibroid growth is still poorly understood, but it has been recognized for decades that they are estrogen and progesterone responsive as they appear during the reproductive years and usually regress after the menopause (Maruo et al., 2004
; Marsh and Bulun, 2006
). To better understand factors influencing fibroid development, we and others have used microarray platforms to screen for genes that may play a role in fibroid growth (Tsibris et al., 2002
; Weston et al., 2002
; Ahn et al., 2003
; Quade et al., 2004
; Arslan et al., 2005
; Lee et al., 2005
; Vanharanta et al., 2005
). Several hundred genes have now been identified as differentially expressed between myometrium and fibroids. Some of these genes had previously been identified as potential factors in fibroid growth, while most have not yet been investigated in the context of fibroid etiology.
Many published studies have used in vitro culture models of isolated fibroid and MSMC to elucidate possible mechanisms of fibroid growth or test therapeutic agents. Although multiple studies have demonstrated that fibroid SMC can show differential responses compared with MSMC (Andersen et al., 1995
; Mangioni et al., 2005
; Luo et al., 2006
; Xu et al., 2006
), other studies have failed to show such differences (Zhao et al., 1996
; Horiuchi et al., 1999
). Recently we demonstrated that in vitro culture of FSMC and MSMC significantly alters gene expression profiles and reduces differences between the two cell types compared with the whole tissue (Zaitseva et al., 2006
). These results reinforce that in vitro studies should be carefully planned, and then interpreted with caution due to changes in expression levels of genes involved in pathways of interest. Based on this study, we also hypothesized that much of the difference in gene expression between MSMC and FSMC in vivo is the result of the different microenvironment these cells normally exist in. Thus, when FSMC and MSMC are placed in identical in vitro microenvironments, much of the differential expression is lost. However, a small number of genes that retain differential expression in vitro may represent fundamental differences between MSMC and FSMC. We report here for the first time that two of the nine genes that retain similar in vitro and in vivo differential expression are members of the retinoic acid (RA) pathway.
Aberrant expression of genes involved in the RA pathway in fibroids compared with normal myometrium is one of the most consistent observations reported by multiple microarray studies (Arslan et al., 2005
). RA signaling controls a wide selection of biological processes including differentiation, proliferation and apoptosis (Napoli, 1996
; Blomhoff and Blomhoff, 2006
). Conversion of dietary retinol to RA is controlled by complex interactions and bioavailability of binding proteins, and several families of metabolic enzymes (Duester, 2000
; Duester et al., 2003
; Shaw et al., 2003
; Schug et al., 2007
). RA signals through six retinoid receptors [retinoic acid receptors (RAR) -
, -β, -
and retinoid X receptors (RXR) -
, -β, -
], which act as ligand-inducible transcription factors (Altucci and Gronemeyer, 2001
; Bastien and Rochette-Egly, 2004
). Two recent studies have reported that multiple members of the RA pathway, including cellular retinol binding protein 1 (CRBP1) and cellular RA binding protein 2 (CRABP2), plus enzymes involved in retinol—RA conversion such as alcohol dehydrogenase 1 (ADH1), aldehyde dehydrogenase 1 (ALDH1) and retinol dehydrogenase (RODH), and some of the receptors have altered expression in fibroids compared with normal myometrium, and these alterations result in decreased concentrations of all-trans RA (atRA) and 9-cis RA in fibroid tissue (Catherino and Malik, 2007
; Zaitseva et al., 2007
).
The aims of the present study were: (i) to report genes that are differentially expressed between myometrium and fibroids and maintain this differential expression in vitro; (ii) to investigate in vitro expression of genes involved in the RA pathway; (iii) to investigate functional differences in regulation of members of the RA pathway between myometrial and fibroid cells in vitro; (iv) to use a simple bioinformatics approach to identify genes differentially expressed between myometrium and fibroids that also show evidence of being regulated by RA.
| Materials and Methods |
|---|
|
|
|---|
Tissue collection
Human myometrial and fibroid tissue was obtained from 14 regular cycling women (mean age 45 years, range 37–53) undergoing hysterectomy for fibroids. Informed consent was obtained from each patient and ethical approval was obtained from Southern Health Human Research and Ethics Committee B. Some tissue was snap frozen on dry ice immediately after excision and stored at –80°C until RNA extraction, other tissue was collected in HEPES-buffered M199 culture medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal calf serum (FCS) (CSL, Melbourne, Australia) and 10x antibiotic-antimycotic solution (Invitrogen) with final concentrations: penicillin 1000 U/ml, streptomycin 1000 U/ml and fungizone 2.5 µg/ml, stored overnight at 4°C and then processed for cell culture. Fibroid samples were stored and processed separately from adjacent normal (host) myometrium.
Isolation and culture of MSMC and FSMCS
Myometrial and fibroid tissue was finely chopped and dissociated with collagenase type 2 and deoxyribonuclease type I, followed by a short trypsin digestion to produce single cell suspensions, as described previously (Gargett et al., 2000
, 2002a
). Endothelial cells (EC) were removed by negative selection using UEA-1 coated Dynabeads (Dynal, Oslo, Norway). Since EC constitute a significant proportion (approximately 10%) of isolated cells and have a different gene expression profile to SMC (Gargett et al., 2002a
), these were removed from our cultures to achieve purified SMC cultures. For in vivo/in vitro comparison, MSMC and FSMC were grown on uncoated plastic flasks in M199 medium containing 10% FCS, antibiotic-antimycotic solution, 10 nM 17β-estradiol (E2) and 100 nM progesterone (both from Sigma, St Louis, MO, USA). Cells were routinely cultured, passaged and collected for RNA after passage 0 (P0) (2 weeks in culture) and passage 3 (P3) (approximately 5 weeks in culture). At the time of the collection SMC cultures were checked for contaminating EC using CD31 staining and flow cytometry (Gargett et al., 2002b
). RNA samples collected from each patient were: myometrial and fibroid tissue, MSMC and FSMC at P0, MSMC and FSMC at P3. For cells stimulated with atRA and retinol (Re), primary MSMC and FSMC were grown in 6-well plates until confluence in M199 media containing 10% FCS. The media was then changed to phenol red-free M199 supplemented by 0.1% charcoal-stripped FCS (Ch-FCS), cells were left for 24 h and then grown in phenol red-free M199 supplemented by 10% Ch-FCS with atRA (10–6-10–9M), retinol (10–6–10–9M) or vehicle (dimethylsulphoxide or ethanol). We chose these two compounds for our experiments for the following reasons: (i) atRA is more abundant than 9-cis RA in both myometrium and fibroids (Tsibris et al., 1999
; Catherino and Malik, 2007
) and signals through both RARs and RXRs; (ii) Retinol is the natural retinoid that cells receive from the circulation and is converted to RA to stimulate transcription; alterations in the levels of RA synthesis enzymes and binding proteins can lead to different rates of RA synthesis and thus a differential transcriptional response. E2 at 10 nM was also added to some wells in the presence of atRA and retinol. Cells were collected after 24 or 72 h for RNA analysis.
RNA extraction
Total RNA was extracted from cells and tissue samples using TrizolTM reagent (Invitrogen) as previously described (Weston et al., 2002
; Zaitseva et al., 2006
). For the retinoid in vitro study, RNA was treated with DNase I (Promega, Madison, WI, USA) without on-column purification. For in vivo/in vitro comparison, RNA was further purified using Rneasy columns with on-column DNase I treatment (Qiagen, Germany) according to manufacturers protocol. Resulting RNA was further purified by ethanol precipitation, re-suspended in RNase-free water and stored at –80°C. Concentration and quality of the resulting RNA was assessed using a UV spectrophotometer absorbance ratio of 260 to 280 nM (A260/280).
Microarray experiment
The microarray experiment was performed as previously described (Zaitseva et al., 2006
). In brief, glass microarray slides spotted with
8000 human complementary DNA (cDNA) sequences were purchased from the Australian Genome Research Facility, Melbourne, Australia (www.agrf.org.au). An indirect labeling procedure was used to create fluorescently labeled cDNA. First-strand cDNA synthesis was performed using SuperScriptTM Indirect cDNA Labeling System (Invitrogen). Resulting cDNA was purified and labeled with Cy3 (experimental samples) and Cy5 (reference samples) dyes from the Cyscribe post-labeling reactive dye kit (Amersham, UK). Hybridization was performed at 42°C for 18 h in a humidified chamber. The microarray slides were scanned using GenePix 4000B scanner and the data were quantified and extracted using GenePix Pro 5.0 software (Axon Instruments, Union City, CA, USA).
Reverse transcription and real-time quantitative RT–PCR
For reverse transcription, 1 µg of RNA was mixed with 1 µl Random Primers (3 µg/µl, Invitrogen), 2 µl 10 mM dNTPs (Roche, Australia), 4 µl 5x times RT buffer (Roche), 0.5 µl RNAsin (Promega), 2 µl 0.1 M dithiothreitol (Invitrogen) and 0.2 µl avian myeloblastosis reverse transcriptase (Roche) in 20 µl final volume and incubated at 42°C for 1 h. All real-time PCR experiments were performed on a Corbett real-time PCR machine with Light Cycler fast start DNA master SYBR green kit (Roche) using specific primers. All primer sequences except for RARRES2 were from Zaitseva et al. (2007)
. Primers for RARRES2 were: (F) 5'GGTTGGTCCACTGCCCCATAGA3'; and (R) 5'GCGAACTGTCCAGGGAAGTAGAA3'. Relative mRNA levels for each of the genes were determined using specific cDNA standards. All results were normalized using 18S RNA as a housekeeping gene to correct for differences in concentration of the starting template.
Statistical analysis
Microarray and real-time quantitative RT–PCR (RT–qPCR) data were log transformed and analyzed by analysis of variance followed by Tukey post hoc test as previously described (Zaitseva et al., 2006
). Pearson correlation and linear regression were used to correlate RT–qPCR and microarray results. All RT–qPCR data were normalized using loading control (18S RNA). A list of genes that are differentially expressed between myometrium and fibroids was compiled using published microarray studies (Ahn et al., 2003
; Quade et al., 2004
; Arslan et al., 2005
; Lee et al., 2005
; Vanharanta et al., 2005
; Zaitseva et al., 2006
) and compared with a list of genes with evidence of being regulated by RA (Balmer and Blomhoff, 2002
) using Excel and Gene SpringTM software (Silicon Genetics, USA) version 7.0. Generated gene lists were also analyzed according to the Gene-Ontology database (GO: http://www.geneontology.org) and other gene-related information collected using Gene Spring, Gene Tools (http://www.genetools.no), Go Stat (http://gostat.wehi.e.du.au) (Beissbarth and Speed, 2004
) and The National Center for Biotechnology Information (NCBI) databases. Results of the in vitro retinoid study were presented as % control and analyzed using Wilcoxon signed rank matched pairs test or Kruskal–Wallis test followed by Dunns multiple comparison test. All data were analyzed using Graph Pad PrismTM software. A value of P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Genes that retain their expression pattern in vitro
In a previous study (Zaitseva et al., 2006
|
Comparison of CRBP1 and RARRES2 mRNA expression between myometrium, fibroids and cultured cells
Before undertaking these in vitro studies, an extended validation of microarray data was undertaken to ensure that results of our previous studies (Zaitseva et al., 2006
|
Expression of genes involved in the RA pathway and retinoid receptors in vivo versus in vitro
We compared in vivo and in vitro expression profiles of four genes involved in RA synthesis and transport (ADH1, ALDH1, CRABP2 and RODH) and six retinoid receptors: RAR
, -β, -
, and RXR
, -β, -
. mRNA expression was detected in all tissues and cultured cells for all 10 genes tested except 1 sample of MSMC at P3 for RXR
. ADH1 (Fig. 2A), ALDH1 (Fig. 2B), CRABP2 (Fig. 2C), RODH (Fig. 2D), as well as RXR
(Fig. 2E), were differentially expressed between myometrial and fibroid tissue as previously described (Zaitseva et al., 2007
mRNAs were significantly down-regulated in MSMC and FSMC at both passages (Fig. 2A and D), while for CRABP2 and RODH this was observed for FSMC but not MSMC, and only at P3 for RODH (Fig. 2D). The majority of the genes maintained mRNA expression levels similar to that in myometrium and fibroids at least at P0 (data not shown), but the differences in expression levels observed in vivo disappeared in culture for three out five genes tested (ADH1, CRABP2 and RXR
).
|
|
To further investigate how consistent the observed differences between MSMC and FSMC are, we examined mRNA expression of ALDH1, CRBP1, RARRES2, ADH1 and CRABP2 in another set of 6 paired MSMC and FSMC at P0. Results were generally consistent between the two studies (Fig. 3), with higher expression levels of ALDH1 (Fig. 3A), CRBP1 (Fig. 3B) and RARRES2 (Fig. 3C) in MSMC compared with FSMC. The difference for RARRES2 did not reach significance in study 2. Consistently, there were no significant differences for ADH1 and CRABP2 expression between two cell types (Fig. 3D and E). A trend for higher mRNA expression for ADH1 in MSMC was seen for 7/8 samples in study 1 and 5/6 samples in study 2 despite significantly reduced expression levels in vitro compared with in vivo.
|
Regulation of expression of members of the RA pathway by atRA
As ADH1, ALDH1, CRBP1, CRABP2 and RARRES2 expression is under direct or indirect control of RA in other tissues, we investigated how these genes were regulated by retinoids in myometrial and fibroid cells in vitro. Our results demonstrate that in MSMC and FSMC these genes respond to atRA at a transcriptional level (Fig 4). Stimulation with atRA did not have a significant effect on ADH1 and ALDH1 expression at 24 h, except ALDH1 in MSMC grown with 1 µM atRA (Fig. 4A and C). Both ADH1 and ALDH1 gene expression was significantly up-regulated at 72 h. There was a significant difference in response between myometrial and fibroid cells for ALDH1, with FSMC exhibiting a significant increase in ALDH1 expression compared with myometrial cells (Fig. 4D). No differences in response between the two cell types were seen for ADH1 (Fig. 4A). We observed up-regulation of CRBP1 and CRABP2 expression at 24 and 72 h by atRA in myometrial and fibroid cells (Fig. 4E–H) with a larger effect seen in myometrial cells at 24 h. RARRES2 expression was not affected by atRA (data not shown). We also tested if E2 had an effect on expression of atRA or retinol-induced target genes. Our results demonstrate that E2 (10 nM) had no effect on atRA or retinol (both at 100 nM)—stimulated expression of target genes at 24 or 72 h (data not shown).
|
Regulation of expression of members of the RA pathway by retinol
Retinol was less effective than atRA in inducing a transcriptional response, with up-regulation of responder genes typically requiring higher concentrations of retinol than atRA (Fig. 5). The only significant increase in gene expression at 24 h after retinol treatment was seen for CRABP2 (data not shown), and this remained significant at 72 h for both MSMC and FSMC (Fig. 5D). CRBP1 gene expression was also up-regulated by retinol in both cell types at 72 h (Fig. 5C). ADH1 and ALDH1 expression was significantly increased only in myometrial cells at 72 h, with no differences seen in FSMC (Fig. 5A and B). There were no differences seen in RARRES2 (data not shown).
|
RA responsive genes that differ between myometrium and fibroids
If alterations in the RA pathway observed in fibroids compared with myometrium are important in fibroid development and growth, then the number of RA responsive genes differentially expressed in fibroids should be higher than predicted by chance alone. To test this hypothesis, we compiled a list of all genes significantly altered in fibroids compared with normal myometrium based on previously published microarray studies (Tsibris et al., 2002
|
|
| Discussion |
|---|
|
|
|---|
In the present study, we report for the first time that differential expression of ALDH1 between fibroids and myometrium is maintained in cell culture, and that this gene is differentially regulated by RA between myometrial and fibroid cells. RA and retinol also regulate expression of ADH1, CRBP1 and CRABP2 in these cells. We identify a number of genes that are differentially expressed between myometrium and fibroids and maintain these differences and expression levels in cultured cells isolated from the same tissues. We show that many of the RA pathway genes tested maintain expression levels and differences in vitro. Based on these findings, we propose that the RA pathway has a fundamental and possible causative role in fibroid growth, as evidenced by the large number of genes significantly altered in uterine fibroids that are regulated by RA.
The current study shows for the first time that ALDH1 expression is positively regulated by RA in both myometrial and fibroids cells, with FSMC showing significantly greater up-regulation compared with MSMC. Retinol only up-regulates ALDH1 expression in myometrial, but not fibroid cells. It also demonstrates that ALDH1 is among a small number of genes that maintain differential expression in vitro. ALDH1 is a rate-limiting irreversible step in RA biosynthesis (Duester, 1996
, 2000
), and has consistently been identified as being differentially expressed between myometrium and fibroids in several studies (Arslan et al., 2005
; Catherino and Malik, 2007
; Zaitseva et al., 2007
). Our previous study reported striking differences in immunolocalization of this key enzyme between myometrium and fibroids (Zaitseva et al., 2007
). Contrary to our results, studies in other cell culture systems reported that atRA down-regulates ALDH1 mRNA expression (Elizondo et al., 2000
) or ALDH1 activity (Moreb et al., 2005
), indicating differential regulation of ALDH1 gene present in myometrium and fibroids. All these data point to ALDH1 as an important gene in fibroid development. Further investigations are justified to better elucidate role of ALDH1 in fibroid pathophysiology.
The present study also shows that retinoids up-regulate gene expression of ADH1, CRBP1 and CRABP2. In support of our data, a recent study has demonstrated that 9-cis RA up-regulates CRABP2 expression in these cells (Lattuada et al., 2007
). RA has been shown to regulate expression of genes involved in its own synthesis and transport in other systems (Duester et al., 1991
; Si et al., 1995
; Nagpal et al., 1997
). We observed increased expression of target genes in both myometrial and fibroid cells, but the degree of up-regulation and time frame of the response varied for different genes and between the two cell types. Gene expression of binding proteins peaked at 24 h, especially for MSMC, while at 72 h the increase was significant but more moderate for both cell types. Up-regulation of ADH1 and ALDH1 expression peaked at 72 h. These differences indicate that different mechanisms are involved in regulation of gene transcription of binding proteins and enzymes in both myometrial and fibroid cells. CRBP1 and CRABP2 are direct targets of a liganded RAR–RXR heterodimer bound to the RA response element, while ADH1 and ALDH1 appear to be regulated by indirect mechanisms (Balmer and Blomhoff, 2002
; Blomhoff and Blomhoff, 2006
). Retinol altered gene expression of target genes in both MSMC and FSMC, but was less effective compared with atRA. Higher concentrations and longer exposures were needed to stimulate up-regulation of gene expression. The only significant increase after 24 h was observed for CRABP2. ADH1 and ALDH1 were significantly altered only in myometrial cells, which is in contrast to the data for atRA. These results point to possible inadequate retinol-RA conversion in fibroid cells, which may reflect the in vivo situation. To stimulate gene transcription inside the cell, retinol first has to be converted to RA, which requires functioning enzymes capable of this conversion, as well as binding proteins for transport. Down-regulation of key enzymes, especially ALDH1, as well as CRBP1 in uterine fibroids may therefore lead to aberrant RA synthesis (Zaitseva et al., 2007
). In support of this hypothesis, it has been shown that fibroids have lower levels of atRA and 9-cis RA compared with normal myometrium (Catherino and Malik, 2007
). Another possible explanation of the reduced up-regulation observed with retinol is in vitro artifacts for retinol stability or retinol-RA conversion. Standard cell culture conditions can reduce bioavailability of retinol due to exposure to light and free oxygen, as retinol is easily oxidized in the presence of oxygen, and is light sensitive. It has previously been demonstrated that in human breast cell lines RA is
1000 times more potent in inhibiting cell growth than retinol (Mira et al., 2000
). Conversion of retinol to RA may also be compromised in vitro in both cell types, possibly due to a significant decrease in ADH1 expression or other unknown alterations, and result in lower levels of atRA production. As in vitro culture reduces differences between the two cell types (Zaitseva et al., 2006
), larger differences could be expected in vivo. Altered expression of the RA synthesis enzymes, binding proteins and retinoid receptors in uterine fibroids that has been demonstrated by several studies (Tsibris et al., 1999
; Catherino and Malik, 2007
; Zaitseva et al., 2007
) could be, in part, a result of these differences.
Estrogen did not alter atRA or retinol-induced gene expression. Previous reports indicate that estrogen increases expression of ALDH1 and ALDH2 in human endometrium (Deng et al., 2003
) and mouse uterus (Vermot et al., 2000
), and that there is transcriptional cross-talk between estrogen receptor
(ER
) and retinoic receptors (Rousseau et al., 2003
; Lu et al., 2005
). A microarray study that investigated estrogen responsive genes in myometrial and fibroid cells in vitro did not identify any of the genes we examined as E2 targets (Swartz et al., 2005
), supporting our data. Lack of estrogen regulation could also be a culture artifact as our previous study demonstrated that ER
expression is significantly reduced, but not absent, in cultured cells compared with the whole tissue (Zaitseva et al., 2006
).
In the present study we report nine genes that are differentially expressed in vivo and maintain these differences in vitro, at least at P0 (after 2 weeks in culture) based on the analysis of microarray data. These genes can be used as myometrial/fibroid cell signatures to distinguish each cell type in culture. In vitro culture is widely used by many researchers as a model to study mechanisms of fibroid pathogenesis. Despite the obvious differences between normal myometrium and fibroids at a macroscopic level, it is difficult to distinguish these two tissues by histology or immunohistochemistry, or distinguish between MSMC and FSMC in culture. Validation of in vitro cell culture systems is important to ensure that the results produced using this research model are meaningful and reflect the in vivo situation. The transcriptional response of cultured MSMC and FSMC to retinoids, as well as maintenance of expression levels of genes involved in this pathway in vitro provide evidence that the RA pathway is functional in cultured MSMC and FSMC.
A recent study (Malik and Catherino, 2007
) reported four genes, dermatopontin, versican, TGFβ3 and CYP26A1, as possible biomarkers for MSMC and FSMC in culture. The authors provided evidence that these genes have differential expression in myometrial/fibroid tissues and that these differences are maintained in cultured cells. In our studies we did not find significant differences for these four genes, and expression of one of the genes, versican, was significantly up-regulated in MSMC and FSMC at both passages tested by microarray (Zaitseva et al., 2006
). Different experimental platforms, as well as patient selection criteria may be contributing factors for the differences observed.
In our study we also examined if genes differentially expressed between myometrium and fibroids are regulated by the RA pathway. Our bioinformatics analysis has shown that 15.4% of the genes differentially expressed between myometrium and fibroids have evidence of being regulated by RA. RA signaling controls a wide selection of biological processes including differentiation, proliferation and apoptosis (Napoli, 1996
; Blomhoff and Blomhoff, 2006
). Retinoids have been shown to inhibit proliferation and induce apoptosis in FSMC, but not MSMC (Broaddus et al., 2004
), further supporting differential signaling between myometrium and fibroids. The unexpectedly large number of genes with altered expression in uterine fibroids that are potentially regulated by RA support the hypothesis that perturbations in the RA pathway are an important component of fibroid pathophysiology. Several genes on this list, especially IGFs, TGFβs and genes associated with extracellular matrix, have been implicated in fibroid development by multiple studies (Sozen and Arici, 2002
; Arslan et al., 2005
; Walker and Stewart, 2005
). Genes associated with regulation of biological and cellular processes, as well as transcription and transcription factor activity were among genes down-regulated in fibroids, indicating that dysregulation of some of these processes may occur during tumor development.
In conclusion, the present study demonstrates that retinoids up-regulate expression of CRBP1, CRABP2, ADH1 and ALDH1, but not of RARRES2, in both MSMC and FSMC. ALDH1 expression is regulated differently in myometrial and fibroid cells by atRA and retinol, providing further evidence that this gene is important in fibroid pathophysiology. We also identify a list of nine genes that can be used as markers to distinguish MSMC and FSMC in culture. We confirm that genes involved in the RA pathway are expressed in vitro at similar levels to that observed in vivo and demonstrate that a large number of RA target genes are differentially expressed between myometrium and fibroids. Research into the role of the RA pathway in the pathophysiology of fibroids may identify potential therapeutic targets for fibroid treatments and possibly provide new opportunities for fibroid treatment.
| Funding |
|---|
|
|
|---|
This work was supported by a Royal Australian and New Zealand College of Obstetricians and Gynecologists Members Research Foundation Scholarship to B.J.V. P.A.W.R. is a Principal Research Fellow of the National Health & Medical Research Council of Australia (NH&MRC Fellowship grant # 134063).
| Acknowledgements |
|---|
|
|
|---|
Thanks are due to nurses Nancy Taylor and Nicky Sam for the collection of tissue samples and to various gynecological surgeons affiliated with Monash Medical Centre who provided subjects for the study. Thanks are also due to Jane Girling for critical review of the manuscript.
| References |
|---|
|
|
|---|
Ahn WS, Kim KW, Bae SM, Yoon JH, Lee JM, Namkoong SE, Kim JH, Kim CK, Lee YJ, Kim YW. Targeted cellular process profiling approach for uterine leiomyoma using cDNA microarray, proteomics and gene ontology analysis. Int J Exp Pathol (2003) 84:267–279.[CrossRef][Web of Science][Medline]
Altucci L, Gronemeyer H. Nuclear receptors in cell life and death. Trends Endocrinol Metab (2001) 12:460–468.[CrossRef][Web of Science][Medline]
Andersen J, DyReyes VM, Barbieri RL, Coachman DM, Miksicek RJ. Leiomyoma primary cultures have elevated transcriptional response to estrogen compared with autologous myometrial cultures. J Soc Gynecol Investig (1995) 2:542–551.[CrossRef][Web of Science][Medline]
Arslan AA, Gold LI, Mittal K, Suen TC, Belitskaya-Levy I, Tang MS, Toniolo P. Gene expression studies provide clues to the pathogenesis of uterine leiomyoma: new evidence and a systematic review. Hum Reprod (2005) 20:852–863.
Balmer JE, Blomhoff R. Gene expression regulation by retinoic acid. J Lipid Res (2002) 43:1773–1808.
Bastien J, Rochette-Egly C. Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene (2004) 328:1–16.[CrossRef][Web of Science][Medline]
Beissbarth T, Speed TP. GOstat: find statistically overrepresented Gene Ontologies within a group of genes. Bioinformatics (2004) 20:1464–1465.
Blomhoff R, Blomhoff HK. Overview of retinoid metabolism and function. J Neurobiol (2006) 66:606–630.[CrossRef][Web of Science][Medline]
Broaddus RR, Xie S, Hsu CJ, Wang J, Zhang S, Zou C. The chemopreventive agents 4-HPR and DFMO inhibit growth and induce apoptosis in uterine leiomyomas. Am J Obstet Gynecol (2004) 190:686–692.[CrossRef][Web of Science][Medline]
Catherino WH, Malik M. Uterine leiomyomas express a molecular pattern that lowers retinoic acid exposure. Fertil Steril (2007) 87:1388–1398.[CrossRef][Web of Science][Medline]
Day Baird D, Dunson DB, Hill MC, Cousins D, Schectman JM. High cumulative incidence of uterine leiomyoma in black and white women: ultrasound evidence. Am J Obstet Gynecol (2003) 188:100–107.[CrossRef][Web of Science][Medline]
Deng L, Shipley GL, Loose-Mitchell DS, Stancel GM, Broaddus R, Pickar JH, Davies PJ. Coordinate regulation of the production and signaling of retinoic acid by estrogen in the human endometrium. J Clin Endocrinol Metab (2003) 88:2157–2163.
Duester G. Involvement of alcohol dehydrogenase, short-chain dehydrogenase/reductase, aldehyde dehydrogenase, and cytochrome P450 in the control of retinoid signaling by activation of retinoic acid synthesis. Biochemistry (1996) 35:12221–12227.[CrossRef][Web of Science][Medline]
Duester G. Families of retinoid dehydrogenases regulating vitamin A function: production of visual pigment and retinoic acid. Eur J Biochem (2000) 267:4315–4324.[Web of Science][Medline]
Duester G, Shean ML, McBride MS, Stewart MJ. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis. Mol Cell Biol (1991) 11:1638–1646.
Duester G, Mic FA, Molotkov A. Cytosolic retinoid dehydrogenases govern ubiquitous metabolism of retinol to retinaldehyde followed by tissue-specific metabolism to retinoic acid. Chem Biol Interact (2003) 143–144:201–210.
Elizondo G, Corchero J, Sterneck E, Gonzalez FJ. Feedback Inhibition of the retinaldehyde dehydrogenase gene ALDH1 by retinoic acid through retinoic acid receptor alpha and CCAAT/enhancer-binding protein beta. J Biol Chem (2000) 275:39747–39753.
Farquhar CM, Steiner CA. Hysterectomy rates in the United States 1990–1997. Obstet Gynecol (2002) 99:229–234.[CrossRef][Web of Science][Medline]
Gargett CE, Bucak K, Rogers PA. Isolation, characterization and long-term culture of human myometrial microvascular endothelial cells. Hum Reprod (2000) 15:293–301.
Gargett CE, Bucak K, Zaitseva M, Chu S, Taylor N, Fuller PJ, Rogers PA. Estrogen receptor-alpha and -beta expression in microvascular endothelial cells and smooth muscle cells of myometrium and leiomyoma. Mol Hum Reprod (2002) a8:770–775.
Gargett CE, Zaitseva M, Bucak K, Chu S, Fuller PJ, Rogers PA. 17Beta-estradiol up-regulates vascular endothelial growth factor receptor-2 expression in human myometrial microvascular endothelial cells: role of estrogen receptor-alpha and -beta. J Clin Endocrinol Metab (2002) a87:4341–4349.
Horiuchi A, Nikaido T, Ya-Li Z, Ito K, Orii A, Fujii S. Heparin inhibits proliferation of myometrial and leiomyomal smooth muscle cells through the induction of alpha-smooth muscle actin, calponin h1 and p27. Mol Hum Reprod (1999) 5:139–145.
Lattuada D, Vigano P, Mangioni S, Sassone J, Di Francesco S, Vignali M, Di Blasio AM. Accumulation of retinoid X receptor-alpha in uterine leiomyomas is associated with a delayed ligand-dependent proteasome-mediated degradation and an alteration of its transcriptional activity. Mol Endocrinol (2007) 21:602–612.
Lee EJ, Kong G, Lee SH, Rho SB, Park CS, Kim BG, Bae DS, Kavanagh JJ, Lee JH. Profiling of differentially expressed genes in human uterine leiomyomas. Int J Gynecol Cancer (2005) 15:146–154.[CrossRef][Web of Science][Medline]
Lu M, Mira-y-Lopez R, Nakajo S, Nakaya K, Jing Y. Expression of estrogen receptor alpha, retinoic acid receptor alpha and cellular retinoic acid binding protein II genes is coordinately regulated in human breast cancer cells. Oncogene (2005) 24:4362–4369.[CrossRef][Web of Science][Medline]
Luo X, Ding L, Chegini N. CCNs, fibulin-1C and S100A4 expression in leiomyoma and myometrium: inverse association with TGF-beta and regulation by TGF-beta in leiomyoma and myometrial smooth muscle cells. Mol Hum Reprod (2006) 12:245–256.
Malik M, Catherino WH. Novel method to characterize primary cultures of leiomyoma and myometrium with the use of confirmatory biomarker gene arrays. Fertil Steril (2007) 87:1162–1172.
Mangioni S, Vigano P, Lattuada D, Abbiati A, Vignali M, Di Blasio AM. Overexpression of the Wnt5b gene in leiomyoma cells: implications for a role of the Wnt signaling pathway in the uterine benign tumor. J Clin Endocrinol Metab (2005) 90:5349–5355.
Marsh EE, Bulun SE. Steroid hormones and leiomyomas. Obstet Gynecol Clin North Am (2006) 33:59–67.[CrossRef][Web of Science][Medline]
Maruo T, Ohara N, Wang J, Matsuo H. Sex steroidal regulation of uterine leiomyoma growth and apoptosis. Hum Reprod Update (2004) 10:207–220.
Mira YLR, Zheng WL, Kuppumbatti YS, Rexer B, Jing Y, Ong DE. Retinol conversion to retinoic acid is impaired in breast cancer cell lines relative to normal cells. J Cell Physiol (2000) 185:302–309.[CrossRef][Web of Science][Medline]
Moreb JS, Gabr A, Vartikar GR, Gowda S, Zucali JR, Mohuczy D. Retinoic acid down-regulates aldehyde dehydrogenase and increases cytotoxicity of 4-hydroperoxycyclophosphamide and acetaldehyde. J Pharmacol Exp Ther (2005) 312:339–345.
Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C, Malhotra M, Teng M, Duvic M, Chandraratna RA. Tazarotene-induced gene 2 (TIG2), a novel retinoid-responsive gene in skin. J Invest Dermatol (1997) 109:91–95.[CrossRef][Web of Science][Medline]
Napoli JL. Biochemical pathways of retinoid transport, metabolism, and signal transduction. Clin Immunol Immunopathol (1996) 80:S52–S62.[CrossRef][Web of Science][Medline]
Olufowobi O, Sharif K, Papaionnou S, Neelakantan D, Mohammed H, Afnan M. Are the anticipated benefits of myomectomy achieved in women of reproductive age? A 5-year review of the results at a UK tertiary hospital. J Obstet Gynaecol (2004) 24:434–440.[CrossRef][Medline]
Quade BJ, Wang TY, Sornberger K, Dal Cin P, Mutter GL, Morton CC. Molecular pathogenesis of uterine smooth muscle tumors from transcriptional profiling. Genes Chromosomes Cancer (2004) 40:97–108.[CrossRef][Web of Science][Medline]
Rousseau C, Pettersson F, Couture MC, Paquin A, Galipeau J, Mader S, Miller WH Jr. The N-terminal of the estrogen receptor (ERalpha) mediates transcriptional cross-talk with the retinoic acid receptor in human breast cancer cells. J Steroid Biochem Mol Biol (2003) 86:1–14.[CrossRef][Web of Science][Medline]
Schug TT, Berry DC, Shaw NS, Travis SN, Noy N. Opposing effects of retinoic acid on cell growth result from alternate activation of two different nuclear receptors. Cell (2007) 129:723–733.[CrossRef][Medline]
Shaw N, Elholm M, Noy N. Retinoic acid is a high affinity selective ligand for the peroxisome proliferator-activated receptor beta/delta. J Biol Chem (2003) 278:41589–41592.
Si SP, Tsou HC, Lee X, Peacocke M. Effect of cellular senescence and retinoic acid on the expression of cellular retinoic acid binding proteins in skin fibroblasts. Exp Cell Res (1995) 219:243–248.[CrossRef][Web of Science][Medline]
Sozen I, Arici A. Interactions of cytokines, growth factors, and the extracellular matrix in the cellular biology of uterine leiomyomata. Fertil Steril (2002) 78:1–12.[CrossRef][Web of Science][Medline]
Swartz CD, Afshari CA, Yu L, Hall KE, Dixon D. Estrogen-induced changes in IGF-I, Myb family and MAP kinase pathway genes in human uterine leiomyoma and normal uterine smooth muscle cell lines. Mol Hum Reprod (2005) 11:441–450.
Tsibris JC, Porter KB, Jazayeri A, Tzimas G, Nau H, Huang H, Kuparadze K, Porter GW, OBrien WF, Spellacy WN. Human uterine leiomyomata express higher levels of peroxisome proliferator-activated receptor gamma, retinoid X receptor alpha, and all-trans retinoic acid than myometrium. Cancer Res (1999) 59:5737–5744.
Tsibris JC, Segars J, Coppola D, Mane S, Wilbanks GD, OBrien WF, Spellacy WN. Insights from gene arrays on the development and growth regulation of uterine leiomyomata. Fertil Steril (2002) 78:114–121.[CrossRef][Web of Science][Medline]
Vanharanta S, Wortham NC, Laiho P, Sjoberg J, Aittomaki K, Arola J, Tomlinson IP, Karhu A, Arango D, Aaltonen LA. 7q deletion mapping and expression profiling in uterine fibroids. Oncogene (2005) 24:6545–6554.[Web of Science][Medline]
Vermot J, Fraulob V, Dolle P, Niederreither K. Expression of enzymes synthesizing (aldehyde dehydrogenase 1 and reinaldehyde dehydrogenase 2) and metabolizaing (Cyp26) retinoic acid in the mouse female reproductive system. Endocrinology (2000) 141:3638–3645.
Walker CL, Stewart EA. Uterine fibroids: the elephant in the room. Science (2005) 308:1589–1592.
Weston GC, Haviv I, Rogers PA. Microarray analysis of VEGF-responsive genes in myometrial endothelial cells. Mol Hum Reprod (2002) 8:855–863.
Xu Q, Ohara N, Chen W, Liu J, Sasaki H, Morikawa A, Sitruk-Ware R, Johansson ED, Maruo T. Progesterone receptor modulator CDB-2914 down-regulates vascular endothelial growth factor, adrenomedullin and their receptors and modulates progesterone receptor content in cultured human uterine leiomyoma cells. Hum Reprod (2006) 21:2408–2416.
Zaitseva M, Vollenhoven BJ, Rogers PA. In vitro culture significantly alters gene expression profiles and reduces differences between myometrial and fibroid smooth muscle cells. Mol Hum Reprod (2006) 12:187–207.
Zaitseva M, Vollenhoven BJ, Rogers PA. Retinoic acid pathway genes show significantly altered expression in uterine fibroids when compared with normal myometrium. Mol Hum Reprod (2007) 13:577–585.
Zhao K, Kuperman L, Geimonen E, Andersen J. Progestin represses human connexin43 gene expression similarly in primary cultures of myometrial and uterine leiomyoma cells. Biol Reprod (1996) 54:607–615.[Abstract]
Submitted on November 18, 2007; resubmitted on February 4, 2008; accepted on February 22, 2008.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




