Hum. Reprod. Advance Access published online on March 13, 2008
Human Reproduction, doi:10.1093/humrep/den084
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cloning and identification of a novel sperm binding protein, HEL-75, with antibacterial activity and expressed in the human epididymis


Shandong Research Center of Stem Cell Engineering, Yantai Yu-huang-ding Hospital, No. 20, Yu-huang-ding Dong Road, 264000 Yantai, Peoples Republic of China
1 Correspondence address. E-mail: sdscli{at}126.com
| Abstract |
|---|
|
|
|---|
BACKGROUND: The HEL-75 protein is a β-defensin that was identified by analyzing a human epididymis cDNA library. Studying its function may not only elucidate the mechanisms of host defense, but may also provide new alternatives for novel therapeutic drugs for reproductive tract infections.
METHODS: The HEL-75 gene was amplified by PCR, and its structure and function were predicted and analyzed with bioinformatics tools. Polyclonal serum was raised against recombinant HEL (rHEL)-75 protein. The gene expression pattern was analyzed with RT–PCR and immunofluorescent staining. Finally, the antimicrobial activity and function during fertilization of HEL-75 were analyzed using a colony-forming unit assay and IVF, respectively.
RESULTS: The human HEL-75 gene is located on chromosome 20p13 and encodes a 95 amino acid protein with a predicted N-terminal signal peptide of 22 amino acids. The protein has six conserved cysteine residues, characteristic of members of the β-defensin superfamily, as well as several potential post-translational modification sites. At the transcriptional level, HEL-75 was expressed in the epididymis and lung, but only in the epididymis at the translational level. Immunofluorescent staining showed that HEL-75 protein bound spermatozoa in the epididymis. RHEL-75 protein could kill Escherichia coli in vitro in a dose- and time-dependent fashion. However, no effect was observed on sperm motility nor fertilization when spermatozoa were blocked with anti-rHEL-75 polyclonal serum.
CONCLUSION: HEL-75 is a new β-defensin expressed in the epididymis and on sperm; it may play an important role in host defense.
Key words: epididymis/β-defensin/HEL-75/antibacterial activity/host defense
| Introduction |
|---|
|
|
|---|
According to the World Health Organization (WHO),
15% of couples around the world have difficulty conceiving a child, and in a third of infertility cases, it is male factor that accounts for the problem (http://www.who.int/research/en/). A large number of genetic and environmental factors can result in infertility (Ferlin et al., 2007
The mammalian defensins are innate immune effectors comprising a family of small cationic antimicrobial peptides divided into two subfamilies,
-defensins and β-defensins, which differ in their amino acid sequence, pairing of six conserved cysteines and number of exons (Hancock and Diamond, 2000
; Lehrer and Ganz, 2002
). Mammalian
-defensins are arginine-rich peptides of 29–35 amino acids in length. They have three disulfide bridges in a 1–6, 2–4, 3–5 alignment and are predominantly expressed in neutrophils and Paneth cells (Zimmermann et al., 1995
). Currently, a total of six different human
-defensin genes have been described (Selsted and Harwig, 1989
; Wilde et al., 1989
; Skalicky et al., 1994
; Mallow et al., 1996
). Mammalian β-defensins are also approximately 35 amino acid residues in length, including six cysteine residues with a distinct spacing pattern forming a disulfide array (1–5, 2–4, 3–6) (Tang and Selsted, 1993
) which differs from that of the
-defensins. Interestingly, unlike
-defensins that are found in multiple tissues and cell types, mammalian β-defensin genes are preferentially expressed in the epithelial cells of the male reproductive tract, particularly in epididymis and testis, thereby providing a first line of defense between an organism and the environment (Weinberg et al., 1998
).
Using computational methods, 42 β-defensin genes and pseudogenes were recently found in the rat genome, and 39 were found in the human genome (Patil et al., 2005
). All of the genes form four to five syntenic gene clusters in the respective chromosomes (Schutte et al., 2002
; Patil et al., 2005
). Moreover, it was found that most β-defensins expressed in the reproductive tract are developmentally regulated, with enhanced expression during sexual maturation (Patil et al., 2005
). These unique properties suggest that β-defensins may play a dual role in both fertility and host defense.
In the present study, we report the discovery of a novel human β-defensin, HEL-75, from a normal adult human epididymis cDNA library. To characterize the HEL-75 gene, we analyzed its sequence, expression pattern in tissues and localization on spermatozoa. We showed that HEL-75 expression is epididymis-specific, suggesting that it has a specialized role in this organ. We further analyzed its antimicrobial activity and its role in fertilization, and found that HEL-75 exhibited a potent dose- and time-dependent antibacterial activity, but had no effect on fertilization events. These results indicate that the main function of HEL-75 is likely to be in host defense mechanisms.
| Materials and Methods |
|---|
|
|
|---|
Human samples
All human tissue samples were obtained from a single adult male who died accidentally and were approved for use by his family members. Volunteers ranging from 25 to 30 years in age donated human oocyte and sperm. The quality of the semen used for immunofluorescence and IVF studies was verified by analyzing its density, mobility and morphology. Only semen samples that met the WHO standard (density >2.0 x 107/ml, mobility A + B >50%, normal sperm >15%) were used. All of the experimental procedures described above were approved and supervised by the Ethics Committee of Yantai Yu-huang-ding Hospital.
DNA and protein sequence analysis
We obtained an EST clone from an adult human epididymis cDNA library that was constructed as described (J. Liu, unpublished results). The sequence of the full-length gene corresponding to the EST clone was obtained by electronic PCR, and the gene was named HEL-75. GENSCAN (http://genes.mit.edu/GENSCAN.html) and Genome Browser (http://genome.ucsc.edu/cgi-bin/hgBlat) were used to analyze the structure and chromosomal location of the HEL-75 gene, respectively. The signal peptide cleavage sites were predicted using SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/). N-linked glycosylation sites and phosphorylation sites were predicted using Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan). Multiple sequence alignments were performed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw/index.html).
RNA isolation and RT–PCR
Total RNA was extracted using TRIzol reagent (Tiangen, Beijing, China) from the following human tissues: caput epididymidis, corpus epididymidis, cauda epididymidis, testis, heart, liver, lung, spleen, kidney and stomach. Total RNA (1 µg) was reverse-transcribed using 20 U AMV Reverse Transcriptase (Promega, Beijing, China) and 0.3 µg of oligo dT18 (Promega) according to the manufacturers instructions. Of the resultant cDNA, 2 µl was amplified by PCR using gene-specific primers in 20 µl reactions containing 2 µl 10 x PCR buffer (with MgCl2), 2 µl dNTP mix (10 mmol/l), 1 µl each primer (25 µmol/l), 1 µl Taq DNA polymerase (2.5 U/µl), 2 µl cDNA template and 11 µl ddH2O. β-actin expression was used as the internal control. The PCR was performed under the following conditions: 94°C for 10 min, followed by 35 cycles for HEL-75 or 30 cycles for β-actin at 94°C for 1 min, 54°C (for HEL-75) or 49°C (for β-actin) 30 s, and 72°C 1 min, with a final round of extension at 72°C for 7 min. All of the PCR-amplified gene products were analyzed by electrophoresis on a 1.5% agarose gel.
Construction of the expression vector
The gene encoding the mature HEL-75 protein was directly amplified by PCR from the cDNA library of human epididymis with the specific primers: forward HEL75-F: 5'- TTGGTACCGACGACGACGACAAGGGTGGGTCAAAATGTGTG –3, reverse HEL75-R: 5'- GGCGAATTCTCATGATGTTACGGTCGTTTGTTGC –3'. After the clones were sequenced and verified, the open reading frame was cloned into the pET32b(+) expression vector (Qiagen, Valencia, CA, USA) using the KpnI and EcoRI sites (italicized in the primer sequences above). Escherichia coli BL21(DE3) were transformed with the pET32b(+)-HEL75 vector according to the suppliers instructions. Transformed E. coli were grown to mid-log phase and fusion protein expression was induced with 1 mM isopropyl-1-thio-β-D-galactoside (IPTG) for 3 h at 32°C. Fractions were analyzed on 15% polyacrylamide gels and stained with Coomassie blue G-250. All of the experiments were performed according to standard procedures (Sambrook and Russell, 2001
).
Preparation of rHEL-75 by purification and cleavage of the fusion protein
Due to the histidine tag in the pET32b(+)-HEL-75 expression vector, the recombinant fusion protein thioredoxin (Trx)-HEL-75 was purified by a two-step nickel-chelating chromatography method using the Sepharose Fast Flow resin (GE Healthcare, Beijing, China) and an HPLC system (Pharmacia, Piscataway, USA). Briefly, in the primary nickel chromatography step, the recombinant Trx-HEL-75 was purified. Then, the fusion protein was digested with recombinant enterokinase (Biosea, Guangzhou, China) to release the fusion tags. Finally, the secondary nickel chromatography step was employed to recover the recombinant HEL (rHEL)-75 protein. After measuring the concentration with Bradfords method (Bradford, 1976
), the final purified rHEL-75 protein was preserved by freeze drying for activity assays.
Anti-rHEL-75 polyclonal serum production
Antiserum against rHEL-75 was raised in 6–8 weeks old BALB/C mice (Yantai Luye Pharmaceutical Co., Ltd, Yantai, China). Briefly, 50 µg of recombinant antigen mixed with complete Freunds adjuvant and injected into four mice on Day 1. Then, on Days 15, 30 and 45, 25 µg antigen mixed with incomplete Freunds adjuvant was injected into these mice. On Day 60, the antiserum was harvested via eye bleed. The potency and specificity of the polyclonal antiserum were measured by enzyme-linked immunosorbent assay and western blot, respectively.
Protein extracts and western blot
Total protein extracts of human epididymis were prepared as described previously (Xiao et al., 2004
). Total protein extracts for each sample (20 µg) were separated on 15% SDS–PAGE gels and humectate-blotted to polyvinylidene difluoride membranes (GE Healthcare, Piscataway, NJ, USA). The mouse polyclonal antiserum against rHEL-75 protein was used as a primary antibody (1:5000 dilution). The secondary antibody was a goat horse-radish peroxidase-conjugated anti-mouse immunoglobulin G (1:16 000 dilution, Calbiochem, Germany). The peroxidase activity was visualized using a western blot, with ECL Plus reagent (GE Healthcare).
Immunofluorescent staining of tissues
All fresh tissues were frozen in liquid nitrogen following their isolation from the donor, and then were embedded with Tissue OCT-Freeze Medium (Leica, Germany). Sections of 8 µm thickness were cut and placed on gelatin-coated slides, air-dried and fixed with 4% paraformaldehyde for 20 min, then permeabilized for 30 min with 0.5% Triton X-100 in phosphate-buffered saline (PBS). For immunofluorescent staining, the method was the same as described previously (Hu et al., 2003
). The primary antibody was mouse anti-rHEL-75 antiserum (1:400 dilution). The secondary antibody was fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (1:200 dilution, Sigma-Aldrich, St. Louis, MO, USA), and the propidium iodide counterstaining was performed to indicate the nuclei.
After staining, all sections were mounted in 80% glycerol and examined with a Meta 510 laser scaning microscope (Zeiss, Germany). As a negative control, serial sections were subjected to the same procedure except with normal mouse serum replacing the primary antibody.
Indirect immunofluorescent detection of protein associated with spermatozoa
Human spermatozoa were collected and washed with PBS, placed on 1% gelatin-coated slides, air-dried and then fixed with cold methanol for 10 min. The slides were then blocked for 1 h at room temperature with 3% bovine serum albumin (BSA) in PBS, and incubated overnight at 4°C with mouse anti-rHEL-75 polyclonal serum (diluted 1:200 in PBS containing 3% BSA). Pre-immune mouse serum was used as a negative control. After three washes with PBS containing 0.1% Tween-20 (PBST), the corresponding secondary antibody was applied (FITC-labeled goat anti-mouse IgG, 1:200 dilution in PBS containing 3% BSA). The slides were washed three times with PBST and mounted in 80% glycerol, and examined with a Meta 510 laser scaning microscope (Zeiss).
Bacterial growth assay
We examined whether induction of recombinant proteins in E. coli inhibits growth of the host bacteria by using the method described by Rosenberg (1995
). Briefly, overnight cultures of bacteria transformed with a plasmid harboring the HEL-75 gene or the pET32b(+) vector alone (negative control) were diluted 1 : 40 in Luria–Bertani (LB) broth containing 50 µg/ml ampicillin. Optical densities (600 nm) were recorded at t = 0 and hourly thereafter. When the exponential phase growth was achieved, 0.1 mM IPTG was added to half of the culture to induce the production of recombinant protein. All optical densities were recorded hourly thereafter, and each experiment was repeated in triplicate. As a negative control, untransformed host strain BL21(DE3) was used to test the toxicity of the inducer IPTG.
Antibacterial activity assay
A colony-forming unit (CFU) assay was employed to test the antibacterial activity of rHEL-75 as described previously (Yenugu et al., 2003
). Briefly, overnight cultures of E. coli XL 1-Blue (Stratagene, La Jolla, CA, USA) were grown to mid-log phase (OD600 = 0.4–0.5) and diluted with 10 mM PBS (pH 7.4). Approximately 2 x 106 CFU/ml of bacteria were incubated at 37°C with 12.5–100 µg/ml rHEL-75, and samples of the assay mixture were taken at 15, 30, 60 and 120 min after the start of incubation. The samples were serially diluted with 10 mM PBS (pH 7.4) and 100 µl of each was spread on a LB agar plate and incubated at 37°C overnight to allow colonies to form. The resulting colonies were counted, and the antibacterial activity was expressed as percentage of survival using the following formula: % survival = (number of colonies surviving after treatment with the antibacterial peptide/number of colonies surviving without the antibacterial peptide) x 100.
Sperm motility and IVF assay
Spermatozoa were capacitated by SPERMRINSE-30 (Vitrolife, Edinburgh, UK) at 37°C, 5% CO2 for 1 h. The sperm concentration was adjusted to 1.0 x 107 cells/ml with G-FERT (Vitrolife). The prepared spermatozoa were co-incubated with anti-rHEL-75 polyclonal serum (1:200 dilution) at 37°C, 6% CO2 for 2 h. An equal amount of G-FERT in place of the antiserum was used as a negative control. After incubation, spermatozoa were divided into two parts. One was directly used to analyze the sperm motility with a computer-assisted analysis system, and the other was washed twice with G-FERT and the final concentration was adjusted to 1.0 x 107 cells/ml with G-FERT. A total of 100 µl semen drops were added to 35 mm diameter Petri dishes, covered with mineral oil and kept in the incubator at 37°C, 6% CO2. Mature oocytes were transferred to each semen drop already prepared and incubated at 37°C, 6% CO2 overnight. After incubation, oocytes were examined for fertilization and fertilized oocytes were continuously cultured. The development of embryos was checked and recorded daily.
| Results |
|---|
|
|
|---|
Cloning and analysis of human HEL-75 cDNA
An EST sequence was obtained from an adult human epididymis cDNA library, and the corresponding full-length sequence, which we named HEL-75, was obtained by electronic PCR technology. The HEL-75 gene has a 100% homology to the gene DEFB32 (NM_207469 [GenBank] ) as indicated in a BLAST search of the NCBI database. As shown in Fig. 1, the open reading frame of HEL-75 encodes a predicted protein that contains 95 amino acids with an estimated size of 10.6 kDa. The N-terminal 22 amino acids likely form a signal peptide. Cleavage of this peptide would lead to a mature protein of 73 amino acids and a calculated isoelectric point of 9.62. The gene of human HEL-75 is located on chromosome 20p13, which is closely linked to another six β-defensins, including BD125, BD126, BD127, BD128, BD129 and BD132. Human HEL-75 has six conserved cysteine residues characteristic of the β-defensins super-family. Potential N-myristoylation and N-linked glycosylation sites were predicted at G23GSKCV and N50 ASR, respectively. Four additional potential phosphorylation sites are also present in this sequence, including a cAMP- and cGMP-dependent protein kinase phosphorylation site R79 RNT, and three protein kinase C phosphorylation sites S52RK, S77RR and T82QR. The sequence also contains a predicted potential coagulation factor V LSPD repeat sequence (L62PKPDLPQL).
|
Preparation of rHEL-75 protein and polyclonal antiserum
The mature HEL-75 protein contains only 95 amino acids, so we prepared the recombinant protein through a fusion expression strategy (Fig. 2A). The fusion tag can be released easily at the enterokinase site between the tag and target protein. SDS–PAGE analysis indicated that the fusion protein Trx-HEL-75 was expressed mainly in a soluble form (Fig. 2B). Following purification with nickel-chelating chromatography, the rHEL-75 protein was used to produce polyclonal antiserum. The resultant polyclonal antiserum showed a good specificity to both recombinant protein and natural HEL-75 extracted from human epididymal fluid (Fig. 2C). The western blot analysis also indicated that the size of the natural HEL-75 protein was slightly larger than the rHEL-75 protein, which is consistent with the sequence analysis results which suggested that the protein may undergo some post-translational processing such as phosphorylation and glycosylation.
|
Expression pattern of hel-75 mRNA in tissues
To determine whether HEL-75 is predominantly expressed in the human epididymis, total RNAs from three regions (caput, corpus and cauda) of the epididymis and other tissues of an adult male were analyzed by RT–PCR (Fig. 3A). An identical signal was detected in the three different regions of epididymis. Unexpectedly, the signal was also observed in lung. No signal was observed in the testis, heart, liver, spleen, kidney or stomach. Expression in the epididymis implies that HEL-75 must have some special roles in this organ, e.g. in sperm maturation. However, the reason why HEL-75 is also expressed in lung is unknown.
|
HEL-75 protein expression in the epididymis and lung
Using immunofluorescence with anti-rHEL-75 antisera, expression of human HEL-75 protein was detected in the caput, corpus and cauda regions of the adult human epididymis. However, inconsistent with the mRNA expression, the protein signal in these regions was tapered, with highest expression in the caput epididymidis. No expression was detected in the lung (Fig. 3B).
Immunolocalization of HEL-75 in sperm
HEL-75 expression in the epididymis indicated that it might interact with spermatozoa. Indirect immunofluorescencent staining analysis showed that HEL-75 bound the entire spermatozoa (Fig. 4). The testis is not a likely origin of the protein associated with the spermatozoa, since the HEL-75 was not detected in testis (Fig. 3). The negative control (normal mouse serum) showed no signal (data not shown).
|
Antibacterial activity
β-defensins have been characterized as membrane-lytic and cytotoxic to bacteria. As HEL-75 is a member of the β-defensin family, we examined its antibacterial activity in two separate assay systems. As shown in Fig. 5, induction of the expression of the HEL-75 protein from the pET32b(+) plasmid inhibited the growth of the host bacteria, whereas no inhibitory effect was observed with the vector only.
|
To confirm the above result, we also tested the antibacterial function of rHEL-75 protein in vitro using a strain of pathogenic E. coli. We found that rHEL-75 protein inhibited the growth of the bacteria in a dose- and time-dependent fashion (Fig. 6). These results indicate that the two assays we used yielded consistent results on the antibacterial activity of rHEL-75 protein.
|
Effects of HEL-75 on sperm motility and fertilization
In order to test the function of HEL-75 on sperm, we first blocked the sperm using anti-rHEL-75 polyclonal serum, and then analyzed the effect on sperm motility and fertilization. We found that the anti-rHEL-75 polyclonal serum did not affect sperm motility (data not shown). Addtionally, an IVF assay also showed that anti-rHEL-75 polyclonal serum had no effect on fertilization. The fertilization rate of the sperm blocked with antibody was identical to that of the control (data not shown), and the zygotes developed normally (Fig. 7).
|
| Discussion |
|---|
|
|
|---|
Cloning of epididymis-specific genes
The epididymis, a male accessory sex organ that consists of the caput (head), corpus (body) and cauda (tail), is able to change the composition of luminal fluid throughout its length, and is responsible for sperm mobility, storage and protection (Moore and Smith, 1988
Studying the function of secretory proteins in the epididymis can not only help elucidate the mechanisms of sperm maturation, but also aid in finding new candidate molecules for diagnosing and treating male infertility as well as aid in developing novel contraception alternatives. Although a large number of genes have been identified with the advance of technology, studies of the human epididymis are constrained by the impracticality of experimentation and by the advanced age of available tissue donors. To overcome these difficulties and to identify and investigate unknown epididymal proteins involved in sperm function, we cloned and characterized a novel human epididymal protein, designated HEL-75, from a normal adult human epididymis cDNA library. According to sequence analyses, the HEL-75 protein has six conserved cysteine residues, which is characteristic of members of the β-defensin superfamily. Therefore, we analyzed its expression patterns as well as its function in antibiosis and fertility.
Expression pattern of HEL-75 gene
Bioinformatics methods were used to identify novel β-defensins in human, chimpanzee, mouse, rat and dog following systemic, genome-wide computational searches, which have led two important findings: (i) all β-defensin genes are densely clustered in four to five syntenic chromosomal regions across the five species; and (ii) most β-defensins are preferentially expressed in the reproductive tract and are developmentally regulated (Schutte et al., 2002
; Patil et al., 2005
). However, in addition to expression in the epididymis and testis, some β-defensins are also secreted in the pancreas, skeletal muscle and kidney (DEFB118, DEFB125–127) (Kao et al., 2003
; Rodriguez-Jimenez et al., 2003
). The expression of another β-defensin, HBD4, which is primarily found in the testis and epididymis, can also be induced in primary keratinocytes in response to bacterial infection or proinflammatory stimuli (Harder et al., 1997
, 2004
; Garcia et al., 2001b
). Other studies on hBD1 and hBD2, which are primarily expressed in the respiratory tract, indicate that they can be induced by some stimulators, including interleukin (Harder et al., 2000
; ONeil et al., 2000
), immune cells (Duits et al., 2002
), lipopolysaccharide (Tsutsumi-Ishii and Nagaoka, 2003
) and microbial stimuli (Sorensen et al., 2005
).
HEL-75 showed a unique expression pattern which was different from other β-defensins. At the transcriptional level, HEL-75 was detected not only in the epididymis, but also in the lung. However, there was no expression at the translational level in the lung. The reason for the unique HEL-75 gene expression pattern is unknown. It is possible that HEL-75 expression may be induced in other tissues at the translational level in response to some acute infections, which would provide a mechanism for protecting the host from pathogen invasion. Understanding the details of the expression pattern of HEL-75 as well as the factors that induce expression and the signaling pathways involved requires further investigation.
Antibacterial activity of HEL-75 protein
Each of the β-defensins characterized to date has the capacity to kill or inhibit a wide variety of yeast (Schneider et al., 2005
), fungi, Gram-negative and Gram-positive bacteria, including such pathogens as Burkholderia cepacia (Garcia et al., 2001a
). Additionally, β-defensins are also effective against bacteria which are resistant to other antibacterial agents and antibiotics (Garcia et al., 2001b
), particularly at low concentrations of salt and plasma proteins in vitro (Ganz et al., 1992
; Zasloff, 2002
; Dale and Fredericks, 2005
).
A recent report demonstrated that HIV-1 induced expression of hBD2 and hBD3 in human oral epithelial cells, and that there was a dose-dependent inhibition of HIV-1 replication by recombinant hBD2 and hBD3 in vitro (Quinones-Mateu et al., 2003
). Another study reported that hBD3 can also inhibit the influenza virus fusion into host cells (Leikina et al., 2005
). These reports demonstrate that β-defensins may also contribute to controlling virus spread in vivo. Several reports also indicate additional physiological functions of β-defensins that include playing an immunoprotective role during cell differentiation (Abiko et al., 2003
; Shiba et al., 2003
), tumor development (Donald et al., 2003
; Markeeva et al., 2005
; Sun et al., 2006
) and tissue remodeling processes in osteoarthritic cartilages (Varoga et al., 2005
).
In this study, we showed that HEL-75 can kill E. coli in vitro in a dose- and time-dependent fashion. Considering that E. coli is the most common causative agent of infection in the male reproductive tract, our results may provide some important data to aid in the development of therapeutic drugs for ascending reproductive infection. On the other hand, although an antimicrobial activity of this protein has been demonstrated in vitro, the mechanism of this activity or the nature of the primary activity of HEL-75 in vivo is still not fully understood.
Reproductive function of HEL-75 protein
Host defense proteins in the male reproductive tract have become a subject of investigation, in part because of their potential importance in fighting infectious diseases (Hall et al., 2002
). However, evidence is accumulating that male reproductive tract β-defensins not only contribute to innate immunity, but also play important roles in sperm maturation in the epididymis (Dacheux et al., 2003
; Yudin et al., 2003
; Zhou et al., 2004
). Surprisingly, almost all of the mammalian β-defensins are preferentially expressed in the male reproductive tract. As discussed above, their expression is developmentally regulated and androgen-dependent, with enhanced expression during sexual maturation (Patil et al., 2005
). Such a region- and development-specific expression pattern of β-defensins suggests their importance in epididymis function and fertility.
The HEL-75 protein was expressed in the caput of epididymis and coated the whole sperm, but sperm motility and fertilization were unaffected when the spermatozoa were blocked with polyclonal anti-HEL-75 serum. The reason why HEL-75 binds to the sperm surface but has no direct effect on fertilization is unknown. An intriguing speculation is that this binding event mainly protects the sperm from bacterial infection during fertilization, but does not directly affect sperm maturation or function. The question of whether the uniform distribution of HEL-75 on the human sperm surface can serve as an immunoprotective shield requires further investigation.
| Authors contributions |
|---|
|
|
|---|
Y.Q.L. was responsible for gene cloning, recombinant protein expression, antibody preparation, antibacterial assays and wrote the manuscript. J.Y.L and H.Y.W supervised and coordinated the work. J.L. performed the bioinformatics analysis. C.L.Z. conducted the recombinant protein purification. W.T.W. performed the sperm motility and IVF assays. N.L. performed the RT–PCR. J.L. and S.H.J. contributed to the immunofluorescent staining. All authors read, commented upon and approved the final manuscript.
| Funding |
|---|
|
|
|---|
This work was supported by Shandong Province Science & Technology Key Program (032050102).
| Acknowledgements |
|---|
|
|
|---|
We thank Dr Q.Y. Sun (Institute of Zoology, Chinese Academy of Sciences, China) for reviewing the manuscript.
| Footnotes |
|---|
These authors contributed equally to this work. | References |
|---|
|
|
|---|
Abiko Y, Nishimura M, Kusano K, Yamazaki M, Arakawa T, Takuma T, Kaku T. Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci (2003) 31:225–228.[CrossRef][Web of Science][Medline]
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248–254.[CrossRef][Web of Science][Medline]
Brooks DE. Androgen-regulated epididymal secretory proteins associated with post-testicular sperm development. Ann N Y Acad Sci (1987) 513:179–194.[Medline]
Cornwall GA, Hsia N. ADAM7, a member of the ADAM (a disintegrin and metalloprotease) gene family is specifically expressed in the mouse anterior pituitary and epididymis. Endocrinology (1997) 138:4262–4272.
Dacheux JL, Gatti JL, Dacheux F. Contribution of epididymal secretory proteins for spermatozoa maturation. Microsc Res Tech (2003) 61:7–17.[CrossRef][Web of Science][Medline]
Dale BA, Fredericks LP. Antimicrobial peptides in the oral environment: expression and function in health and disease. Curr Issues Mol Biol (2005) 7:119–133.[Web of Science][Medline]
Donald CD, Sun CQ, Lim SD, Macoska J, Cohen C, Amin MB, Young AN, Ganz TA, Marshall FF, Petros JA. Cancer-specific loss of beta-defensin 1 in renal and prostatic carcinomas. Lab Invest (2003) 83:501–505.[Web of Science][Medline]
Duits LA, Ravensbergen B, Rademaker M, Hiemstra PS, Nibbering PH. Expression of beta-defensin 1 and 2 mRNA by human monocytes, macrophages and dendritic cells. Immunology (2002) 106:517–525.[CrossRef][Web of Science][Medline]
Ferlin A, Raicu F, Gatta V, Zuccarello D, Palka G, Foresta C. Male infertility: role of genetic background. Reprod Biomed Online (2007) 14:734–745.[Web of Science][Medline]
Fouchecourt S, Metayer S, Locatelli A, Dacheux F, Dacheux JL. Stallion epididymal fluid proteome: qualitative and quantitative characterization; secretion and dynamic changes of major proteins. Biol Reprod (2000) 62:1790–1803.
Ganz T, Oren A, Lehrer RI. Defensins: microbicidal and cytotoxic peptides of mammalian host defense cells. Med Microbiol Immunol (1992) 181:99–105.[Medline]
Garcia JR, Jaumann F, Schulz S, Krause A, Rodriguez-Jimenez J, Forssmann U, Adermann K, Kluver E, Vogelmeier C, Becker D, et al. Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res (2001) a306:257–264.[CrossRef][Web of Science][Medline]
Garcia JR, Krause A, Schulz S, Rodriguez-Jimenez FJ, Kluver E, Adermann K, Forssmann U, Frimpong-Boateng A, Bals R, Forssmann WG. Human beta-defensin 4: a novel inducible peptide with a specific salt-sensitive spectrum of antimicrobial activity. Faseb J (2001) b15:1819–1821.
Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L, Rebai T, Hammami A. Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis and Mycoplasma genitalium infections and semen quality of infertile men. BMC Infect Dis (2007) 7:129.[CrossRef][Medline]
Hall SH, Hamil KG, French FS. Host defense proteins of the male reproductive tract. J Androl (2002) 23:585–597.
Hancock RE, Diamond G. The role of cationic antimicrobial peptides in innate host defences. Trends Microbiol (2000) 8:402–410.[CrossRef][Web of Science][Medline]
Harder J, Bartels J, Christophers E, Schroder JM. A peptide antibiotic from human skin. Nature (1997) 387:861.[CrossRef][Medline]
Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S, Schroder JM. Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol (2000) 22:714–721.
Harder J, Meyer-Hoffert U, Wehkamp K, Schwichtenberg L, Schroder JM. Differential gene induction of human beta-defensins (hBD-1, -2, -3, and -4) in keratinocytes is inhibited by retinoic acid. J Invest Dermatol (2004) 123:522–529.[CrossRef][Web of Science][Medline]
Hu Y, Zhou Z, Xu C, Shang Q, Zhang YD, Zhang YL. Androgen down-regulated and region-specific expression of germ cell nuclear factor in mouse epididymis. Endocrinology (2003) 144:1612–1619.
Jelinsky SA, Turner TT, Bang HJ, Finger JN, Solarz MK, Wilson E, Brown EL, Kopf GS, Johnston DS. The rat epididymal transcriptome: comparison of segmental gene expression in the rat and mouse epididymides. Biol Reprod (2007) 76:561–570.
Johnston DS, Jelinsky SA, Bang HJ, DiCandeloro P, Wilson E, Kopf GS, Turner TT. The mouse epididymal transcriptome: transcriptional profiling of segmental gene expression in the epididymis. Biol Reprod (2005) 73:404–413.
Kao CY, Chen Y, Zhao YH, Wu R. ORFeome-based search of airway epithelial cell-specific novel human [beta]-defensin genes. Am J Respir Cell Mol Biol (2003) 29:71–80.
Kirchhoff C, Osterhoff C, Pera I, Schroter S. Function of human epididymal proteins in sperm maturation. Andrologia (1998) 30:225–232.[Web of Science][Medline]
Lehrer RI, Ganz T. Defensins of vertebrate animals. Curr Opin Immunol (2002) 14:96–102.[CrossRef][Web of Science][Medline]
Leikina E, Delanoe-Ayari H, Melikov K, Cho MS, Chen A, Waring AJ, Wang W, Xie Y, Loo JA, Lehrer RI, et al. Carbohydrate-binding molecules inhibit viral fusion and entry by crosslinking membrane glycoproteins. Nat Immunol (2005) 6:995–1001.[CrossRef][Web of Science][Medline]
Mallow EB, Harris A, Salzman N, Russell JP, DeBerardinis RJ, Ruchelli E, Bevins CL. Human enteric defensins. Gene structure and developmental expression. J Biol Chem (1996) 271:4038–4045.
Markeeva N, Lisovskiy I, Lyzogubov V, Usenko V, Soldatkina M, Merentsev S, Zaitsev S, Kondratskii Y, Tofan A, Osinskiy S, et al. Expression of beta-defensin-2 in human gastric tumors: a pilot study. Exp Oncol (2005) 27:130–135.[Web of Science][Medline]
Moore HD, Smith CA. The role of the epididymis during maturation of mammalian spermatozoa in vivo and in vitro. Reprod Nutr Dev (1988) 28:1217–1224.[Medline]
ONeil DA, Cole SP, Martin-Porter E, Housley MP, Liu L, Ganz T, Kagnoff MF. Regulation of human beta-defensins by gastric epithelial cells in response to infection with Helicobacter pylori or stimulation with interleukin-1. Infect Immun (2000) 68:5412–5415.
Okamura N, Tamba M, Liao HJ, Onoe S, Sugita Y, Dacheux F, Dacheux JL. Cloning of complementary DNA encoding a 135-kilodalton protein secreted from porcine corpus epididymis and its identification as an epididymis-specific alpha-mannosidase. Mol Reprod Dev (1995) 42:141–148.[CrossRef][Web of Science][Medline]
Olea N, Fernandez MF. Chemicals in the environment and human male fertility. Occup Environ Med (2007) 64:430–431.
Patil AA, Cai Y, Sang Y, Blecha F, Zhang G. Cross-species analysis of the mammalian beta-defensin gene family: presence of syntenic gene clusters and preferential expression in the male reproductive tract. Physiol Genomics (2005) 23:5–17.
Quinones-Mateu ME, Lederman MM, Feng Z, Chakraborty B, Weber J, Rangel HR, Marotta ML, Mirza M, Jiang B, Kiser P, et al. Human epithelial beta-defensins 2 and 3 inhibit HIV-1 replication. Aids (2003) 17:F39–F48.[CrossRef][Web of Science][Medline]
Rodriguez-Jimenez FJ, Krause A, Schulz S, Forssmann WG, Conejo-Garcia JR, Schreeb R, Motzkus D. Distribution of new human beta-defensin genes clustered on chromosome 20 in functionally different segments of epididymis. Genomics (2003) 81:175–183.[CrossRef][Web of Science][Medline]
Rosenberg HF. Recombinant human eosinophil cationic protein. Ribonuclease activity is not essential for cytotoxicity. J Biol Chem (1995) 270:7876–7881.
Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual (2001) 3rd edn. Cold Spring Harbor Laboratory.
Schneider JJ, Unholzer A, Schaller M, Schafer-Korting M, Korting HC. Human defensins. J Mol Med (2005) 83:587–595.[CrossRef][Web of Science][Medline]
Schutte BC, Mitros JP, Bartlett JA, Walters JD, Jia HP, Welsh MJ, Casavant TL, McCray PB Jr. Discovery of five conserved beta -defensin gene clusters using a computational search strategy. Proc Natl Acad Sci USA (2002) 99:2129–2133.
Selsted ME, Harwig SS. Determination of the disulfide array in the human defensin HNP-2. A covalently cyclized peptide. J Biol Chem (1989) 264:4003–4007.
Shiba H, Mouri Y, Komatsuzawa H, Ouhara K, Takeda K, Sugai M, Kinane DF, Kurihara H. Macrophage inflammatory protein-3alpha and beta-defensin-2 stimulate dentin sialophosphoprotein gene expression in human pulp cells. Biochem Biophys Res Commun (2003) 306:867–871.[CrossRef][Web of Science][Medline]
Skalicky JJ, Selsted ME, Pardi A. Structure and dynamics of the neutrophil defensins NP-2, NP-5, and HNP-1: NMR studies of amide hydrogen exchange kinetics. Proteins (1994) 20:52–67.[CrossRef][Web of Science][Medline]
Sorensen OE, Thapa DR, Rosenthal A, Liu L, Roberts AA, Ganz T. Differential regulation of beta-defensin expression in human skin by microbial stimuli. J Immunol (2005) 174:4870–4879.
Sun CQ, Arnold R, Fernandez-Golarz C, Parrish AB, Almekinder T, He J, Ho SM, Svoboda P, Pohl J, Marshall FF, et al. Human beta-defensin-1, a potential chromosome 8p tumor suppressor: control of transcription and induction of apoptosis in renal cell carcinoma. Cancer Res (2006) 66:8542–8549.
Syntin P, Dacheux F, Druart X, Gatti JL, Okamura N, Dacheux JL. Characterization and identification of proteins secreted in the various regions of the adult boar epididymis. Biol Reprod (1996) 55:956–974.[Abstract]
Tang YQ, Selsted ME. Characterization of the disulfide motif in BNBD-12, an antimicrobial beta-defensin peptide from bovine neutrophils. J Biol Chem (1993) 268:6649–6653.
Tsutsumi-Ishii Y, Nagaoka I. Modulation of human beta-defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J Immunol (2003) 170:4226–4236.
Varoga D, Pufe T, Harder J, Schroder JM, Mentlein R, Meyer-Hoffert U, Goldring MB, Tillmann B, Hassenpflug J, Paulsen F. Human beta-defensin 3 mediates tissue remodeling processes in articular cartilage by increasing levels of metalloproteinases and reducing levels of their endogenous inhibitors. Arthritis Rheum (2005) 52:1736–1745.[CrossRef][Web of Science][Medline]
Weinberg A, Krisanaprakornkit S, Dale BA. Epithelial antimicrobial peptides: review and significance for oral applications. Crit Rev Oral Biol Med (1998) 9:399–414.
Wilde CG, Griffith JE, Marra MN, Snable JL, Scott RW. Purification and characterization of human neutrophil peptide 4, a novel member of the defensin family. J Biol Chem (1989) 264:11200–11203.
Xiao LQ, Liu AH, Zhang YL. An effective method for raising antisera against beta-defensins: double-copy protein expression of mBin1b in E. coli. Acta Biochim Biophys Sin (Shanghai) (2004) 36:571–576.[Medline]
Yenugu S, Hamil KG, Birse CE, Ruben SM, French FS, Hall SH. Antibacterial properties of the sperm-binding proteins and peptides of human epididymis 2 (HE2) family; salt sensitivity, structural dependence and their interaction with outer and cytoplasmic membranes of Escherichia coli. Biochem J (2003) 372:473–483.[CrossRef][Web of Science][Medline]
Yudin AI, Tollner TL, Li MW, Treece CA, Overstreet JW, Cherr GN. ESP13.2, a member of the beta-defensin family, is a macaque sperm surface-coating protein involved in the capacitation process. Biol Reprod (2003) 69:1118–1128.
Zasloff M. Antimicrobial peptides in health and disease. N Engl J Med (2002) 347:1199–1200.
Zhou CX, Zhang YL, Xiao L, Zheng M, Leung KM, Chan MY, Lo PS, Tsang LL, Wong HY, Ho LS, et al. An epididymis-specific beta-defensin is important for the initiation of sperm maturation. Nat Cell Biol (2004) 6:458–464.[CrossRef][Web of Science][Medline]
Zimmermann GR, Legault P, Selsted ME, Pardi A. Solution structure of bovine neutrophil beta-defensin-12: the peptide fold of the beta-defensins is identical to that of the classical defensins. Biochemistry (1995) 34:13663–13671.[CrossRef][Web of Science][Medline]
Submitted on December 21, 2007; resubmitted on February 5, 2008; accepted on February 22, 2008.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
G. A. Cornwall New insights into epididymal biology and function Hum. Reprod. Update, March 1, 2009; 15(2): 213 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I Yudin, T. L Tollner, C. A Treece, R. Kays, G. N Cherr, J. W Overstreet, and C. L Bevins {beta}-Defensin 22 is a major component of the mouse sperm glycocalyx Reproduction, December 1, 2008; 136(6): 753 - 765. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








