Skip Navigation



Hum. Reprod. Advance Access published online on June 9, 2008

Human Reproduction, doi:10.1093/humrep/den202
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
23/8/1760    most recent
den202v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Moon, J. H.
Right arrow Articles by Kim, H. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, J. H.
Right arrow Articles by Kim, H. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Successful vitrification of human amnion-derived mesenchymal stem cells

Jeong Hee Moon1, Jung Ryeol Lee1, Byung Chul Jee1, Chang Suk Suh1,2,3,6, Seok Hyun Kim2,3, Hyun Jung Lim4 and Hae Kwon Kim5

1 Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital, 300 Gumi, Bundang, Seongnam, Gyeonggi 463-707, Korea 2 Department of Obstetrics and Gynecology, College of Medicine, Seoul National University, 28 Yeongeon, Jongno, Seoul 110-744, Korea 3 Institute of Reproductive Medicine and Population, Seoul National University, 28 Yeongeon, Jongno, Seoul 110-744, Korea 4 Department of Biomedical Science and Technology, IBST, Konkuk University, Seoul 143-701, Korea 5 Department of Biotechnology, College of Natural Science, Seoul Women's University, Nowon, Seoul 139-774, Korea

6 Correspondence address. Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital, 300 Gumi, Bundang, Seongnam, Gyeonggi 463-707, Korea. Tel: +82-31-787-7251; Fax: +82-31-787-4054; E-mail: suhcs{at}snu.ac.kr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
BACKGROUND: A cryopreservation protocol for human amnion-derived mesenchymal stem cells (HAMs) is required because these cells cannot survive for long periods in culture. The aim of this study was to determine whether vitrification is a useful freezing method for storage of HAMs.

METHODS: HAMs were cryopreserved using vitrification method. The morphology and viability of thawed HAMs was evaluated by Trypan Blue staining. The expression of several embryonic stem cell (ESC) markers was evaluated using flow cytometry, RT–PCR and immunocytochemistry. Von Kossa, Oil Red O and Alcian Blue staining were used to asses the differentiation potential of thawed HAMs.

RESULTS: The post-thawing viability of HAMs was 84.3 ± 3.2% (Mean ± SD, n = 10). The thawed HAMs showed morphological characteristics indistinguishable from the non-vitrified fresh HAMs. The expression of surface antigens (strong positive for CD44, CD49d, CD59, CD90, CD105 and HLA-ABC; weak positive for HLA-G; negative for CD31, CD34, CD45, CD106, CD117 and HLA-DR) and the expression of ESC markers [CK18, fibroblast growth factor-5, GATA-4, neural cell adhesion molecule, Nestin, Oct-4, stem cell factor, HLA-ABC, Vimentin, bone morphogenetic protein (BMP) 4, hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), Pax-6, alpha-fetoprotein, Brachyury, BMP-2, TRA-1-60, stage-specific embryonic antigen (SSEA-3, SSEA-4)] were maintained in the vitrified-thawed HAMs. The thawed HAMs retained ability to differentiate into osteoblasts, adipocytes and chondrocytes under appropriate culture conditions.

CONCLUSIONS: Our results suggest that vitrification is a reliable and effective method for cryopreservation of HAMs.

Key words: vitrification/amnion/mesenchymal stem cells/cryopreservation/stem cell markers


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
Mesenchymal stem cells (MSCs) isolated from bone marrow are known to have the capacity for self-renewal in their undifferentiated state (Friedenstein et al., 1976Go). MSCs are spindle-shaped fibroblasts that have potential for multilineage differentiation into mesenchymal tissues such as osteoblasts, adipocytes, chondrocytes and myoblast under specific culture conditions (Pittenger et al., 1999Go; Reyes et al., 2001Go; Herzog et al., 2003Go). The in vitro expansion of MSCs obtained from bone marrow has been successfully achieved in their undifferentiated state and they have been suggested for use as multipotent precursors (Pittenger et al., 1999Go) in the therapeutic setting (Barry et al., 2003Go; Ochsenbein-Kolble et al., 2003Go), such as engraftment of various organs (Horwitz et al., 1999Go; Koc et al., 2000Go; Liechty et al., 2000Go).

MSCs can be isolated from various human sources, including bone marrow, umbilical cord blood, adipose tissue, amniotic fluid and muscle (Minguell et al., 2001Go; Covas et al., 2003Go; Tocci et al., 2003Go; Kim et al., 2007Go). Human amnion-derived mesenchymal stem cells (HAMs) express Oct-4 (Prusa et al., 2003Go) and have some of the characteristics of cardiomyocytes (Zhao et al., 2005Go). In addition, amniotic membrane-isolated cells had potential for osteogenic, adipogenic, chondrogenic and myogenic differentiation after being processed in vitro (In ‘t Anker et al., 2003Go; Fukuchi et al., 2004Go; Portmann-Lanz et al., 2006Go; Alviano et al., 2007Go), which might be potential sources of material for engraftment (Bailo et al., 2004Go). Human amniotic membranes are advantageous in that they are easy to obtain and not associated with ethical debate, since they are discarded at delivery (Alviano et al., 2007Go).

Formulating a cryopreservation protocol for the HAMs is required because these cells cannot survive for long periods under in vitro culture conditions. Slow rate cooling methods using dimethylsulfoxide (DMSO) as a cryoprotectant have been used for a wide variety of MSC lines established from bone marrow (Lee et al., 2004aGo,bGo; Kotobuki et al., 2005Go), umbilical cord blood (Erices et al., 2000Go; Romanov et al., 2003Go; Lee et al., 2004aGo,bGo) and hematopoietic progenitor cells (Zhao et al., 2001Go). Slow freezing has been developed to reduce ice crystal formation and to eliminate toxic and osmotic damage to cells through exposure to low concentration of cryoprotectants while slowly decreasing the temperatures (Vajta et al., 2006Go). However, it is difficult to eliminate injuries by intracellular ice formation completely. Alternately, vitrification, a rapid cooling method using a high concentration of cryoprotectant, could also be used. Vitrification can completely eliminate the damage caused by ice crystal formation in the cytoplasm of cells during freezing (Kasai et al., 2004Go). It is also advantageous because the procedure takes a relatively short time and a programmable temperature-decreasing container is not required (Karlsson, 2002Go). Vitrification has been successfully used as a method of preservation for human oocytes and embryos (Rall and Fahy, 1985Go; Kuleshova et al., 1999Go; Cho et al., 2002Go; Dobrinsky, 2002Go) and for hematopoietic progenitor cells retrieved from human cord blood (Kurata et al., 1994Go). Reubinoff et al. (2001)Go tested vitrification of the human embryonic stem cells (hESCs) with an open-pulled straw; although hESCs could be recovered after thawing, the survival rate was quite low. In addition, it has been shown that the vitrification is an efficient and reliable method for hESCs compared with conventional slow freezing (Fujioka et al., 2004Go). Li et al. (2008)Go also reported that vitrification of hESCs with open-pulled straw resulted in a high survival rate of up to 94.3% compared with that (38.6%) of slow freezing in a cryovial. However, as a long-term preservation method for HAMs, the usefulness of vitrification remains to be elucidated. The aim of this study was to investigate whether vitrification is a feasible method for long-term cryopreservation of HAMs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
Isolation and culture of hams
Human placentas (n = 10) were obtained during Cesarean section after receiving informed consent from patients. This study was approved by the Institutional Review Board at Seoul National University Bundang Hospital. The peeled amniotic membranes were treated with 0.25% trypsin (Giboc BRL, Grand Island, NY, USA) for 20 min before mechanical mincing. Then, the pieces of amniotic membranes (~5 x 5 mm2) were incubated at 37°C in Dulbecco's phosphate-buffered saline (DPBS; Gibco) containing 2 mg/ml collagenase (Roche Diagnostics, Rotkreuz, Switzerland) and 0.05 mg/ml DNase (Roche Diagnostics) for 2 h. The dispersed cells were harvested and then incubated in 25 cm2 culture flask (Nunc, Rochester, MN, USA) using low-glucose Dulbecco's Modified Eagle's Medium (DMEM-LG; Gibco) containing 100 IU penicillin (Gibco), 100 µg streptomycin (Gibco), 3.7 ml/l sodium bicarbonate (Sigma Chemical Co., St Louis, MO, USA) and 10% fetal bovine serum (FBS; Gibco) under 5% CO2 at 37°C. Seven days later, non-adherent cells were removed and the culture was continued, replacing medium twice a week. The confluent cells were treated with 0.05% trypsin (Gibco) and then re-plated on 75 cm2 culture flask (Nunc) at a density of 105 cells/ml for subculture. Under the same conditions, the retrieved mesenchymal cells continued to be cultured.

Vitrification of hams
The HAMs were cryopreserved by vitrification method using a two-step exposure to equilibration and vitrification solutions (Cho et al., 2002Go). The equilibration solution was 20% ethylene glycol (EG; Sigma) and the vitrification solution was composed of 40% EG, 18% Ficoll 70 (Sigma) and 0.3M sucrose (Sigma). All solutions were based on DPBS containing 20% FBS. A pellet of ~1 x 106 HAMs (~10 µl) was first suspended in 50 µl equilibration solution for 5 min, and then mixed with 500 µl vitrification solution for 40 s. Suspended HAMs were immediately transferred to 1.2 ml cryovial (Nunc) and plunged directly into liquid nitrogen. Two weeks later, the cells were thawed by rapidly immersing the vials in a water bath at 37°C and were suspended serially in 0.5, 0.25 and 0 M sucrose in DPBS containing 20% FBS, through a simple dilution of sucrose solution. After thawing, the survival rate was evaluated by the Trypan Blue staining method. After removing some of the cell pellet and adding 0.4% Trypan Blue (Gibco), the cells were plated onto a slide, and unstained cells were counted as live cells (Zhao et al., 2001Go). The remaining cells were plated at a density of 1 x 105 cells/ml in a 75 cm2 culture flask and subcultured over 7 days.

Flow cytometry analysis
Thawed and non-cryopreserved fresh HAMs (at Passage 3) were examined for expression of surface antigens using a fluorescence-activated cell sorter (FACS Calibur, Becton Dickinson, CA, USA) equipped with Cell Quest software. At least 10 000 cells were analyzed per sample. Trypsinized HAM cells were re-suspended in DMEM supplemented with 10% FBS and washed with PBS containing 3% FBS. Cells were incubated with primary antibodies for 1 h at 4°C. Unbound antibodies were removed by washing with PBS. The following specific primary monoclonal antibodies conjugated with fluorescein isothiocyanate (FITC)-, phycoertythrin (PE)- or allophycocyanin (APC) were used to detect surface antigen expression: CD31-FITC, CD34-APC, CD44-FITC, CD45-FITC, CD49d-PE, CD59-PE, CD90-PE, CD105-FITC, CD106-FITC, CD117-PE, HLA-G-PE, HLA-ABC-FITC and HLA-DR-FITC (all from BD Pharmingen, San Diego, CA, USA, http://www.bdbiosciences.com). Table I shows the CD antigens used in this study.


View this table:
[in this window]
[in a new window]

 
Table I. Immunophenotype of HAMs: list of CD antigens examined in this study.

 
RNA extraction and RT–PCR
RNA extraction and RT–PCR was performed in thawed and non-cryopreserved HAMs (both at 3rd and 7th passage). Total RNA was extracted using Tri-reagent (Sigma). RNA concentrations were determined by absorbance at 260 nm with a spectrophotometer. A total of 5 µg RNA was reverse transcribed using a 1 mM dNTP mixture, 20 U RNase inhibitor (Takara, Japan) and 20 U moloney murine leukemia virus reverse transcriptase (Fermentas, Burlington, Canada) for 60 min at 42°C in the presence of 0.5 µg/µl oligo (dT) primer. PCR amplification was performed in a Gene Amp PCR system 2400 (Perkin Elmer, Boston, MA, USA) using 0.25 U Taq polymerase (Takara) and 10 pM gene-specific primers, as described previously (Kim et al., 2007Go). Amplification was performed using 35 cycles of denaturation at 94°C for 30 s, annealing for 30 s and extension at 72°C for 30 s. Annealing temperatures differed depending on the primers used (Table II). PCR products were stained with ethidium bromide on a 2% agarose gel and visualized by UV light using a Bioprofile image analysis system (Viber Lourmat, Marne la Vallee, France).


View this table:
[in this window]
[in a new window]

 
Table II. PCR primer sequences and product size.

 
Immunocytochemistry
Thawed and non-cryopreserved HAMs (each from 3rd passage) were seeded and cultured onto a Laboratory-Teck chamber slide (8 wells, Nunc), and then fixed with 4% paraformaldehyde at 4°C for 2 h and rinsed with PBS. Cells were then permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature. After three times washes, they were treated with 3% hydrogen peroxidase for 15 min to quench endogenous peroxidase activity and then incubated in 2% bovine serum albumin (BSA) for 1 h at 4°C. Cells were then incubated with mouse monoclonal antibodies; anti-TRA-1-60 (1:50), anti-SSEA-3 (Chemicon, Temecula, CA, USA) and anti-SSEA-4 (both 1:100) (R&D System, Minneapolis, MN, USA) for 17 h at 4°C. After incubation with primary antibody and three washes with PBS, cells were incubated in biotinylated goat anti-mouse immunoglobulin G (Chemicon) for 20 min at room temperature. The slides were rinsed with PBS and then incubated with horse-radish peroxidase-conjugated streptavidin (Chemicon) for 20 min at room temperature. Immunoreactivity for each protein was visualized using 3,3'-diaminobenzidine tetrahydrochloride (Chemicon) and counterstaining was performed with Mayer's hematoxylin (Sigma). The slides were photographed under a Zeiss LSM410 microscope using bright-field illumination (Carl Zeiss, Oberkochen, Germany). Signal intensity was assigned subjectively; no staining, weak, moderate and strong. A signal assigned to moderate or strong was considered positive. Cultivated HAMs were incubated without primary antibody for negative control.

Evaluation of the differentiation potential of HAMs
To identify osteogenic differentiation, thawed and non-cryopreserved HAMs (each from 3rd passage) were cultured in a chamber slide (Nunc) for subsequent staining, in 0.01 µM dexamethasone, 100 mM β-glycerol phosphate and 50 µM ascorbic acid-2-phosphate in 400 µl DMEM-LG supplemented with 10% FBS.

During the culture period, medium was changed once per week. After 1 week, calcium accumulation, an indicator of osteogenic induction, was assessed by Von Kossa staining (Sigma). Adipogenic differentiation was induced in 400 µl DMEM-LG with 10% FBS, 1 µM dexamethasone, 0.5 µM 3-isobutyl-1-methylxanthine, 0.05 mg/l human insulin and 200 µM indomethacin in chamber slide (Nunc). After culture for 2 weeks, accumulation of lipid-rich vacuoles within cells, an indicator of adipocyte differentiation, was assessed by Oil-red O staining (Sigma). Chondrogenic differentiation was induced in chamber slide (Nunc) using 400 µl high glucose DMEM, 0.1 µM dexamethasone, 50 µg/ml ascorbic acid-2-phosphate, 100 µg/ml sodium pyruvate, 40 µg/ml proline, 10 ng/ml transforming growth factor-β3 and 50 mg/ml ITS-premix (insulin, transferrin and selenious acid at 6.25 µg/ml each, 1.35 mg/ml BSA and 5.35 mg/ml linoleic acid). After culture for 3 weeks, chondrogenesis was evaluated using Alcian Blue staining (Sigma). Each staining was performed after fixing with 4% paraformaldehyde at 4°C for 2 h and washing twice with PBS. The differentiated HAMs were also evaluated by RT–PCR analysis to check appropriate expression of each cell-specific marker; core binding factor {alpha}-1 (CBFA-1) for osteogenic differentiation, lipoprotein lipase (LPL) for adipogenic differentiation and decorin for chondrogenic differentiation. Each differentiated HAM cell pellet for RT–PCR was prepared after culture for 2 or 3 weeks in 75 cm2 flask (Nunc, Rochester, MN, USA) in 10 ml differentiation media (for osteogenic, adipogenic or chondrogenic induction). We also changed media once per week. The primer sequences used to test for markers of osteogenic, adipogenic or chondrogenic induction were as follows; CBFA-1 (320 bp product, forward: 5' CTCACTACCACACCTACCTG 3', reverse: 5' TCAATATGGTCGCCAAACAGATTC 3'), LPL (276 bp, forward: 5' GAGATTTCTCTGTATGGCACC 3', reverse: 5' CTGCAAATGAGACACTTTCTC 3') and Decorin (300 bp, forward: 5' CCTTTGGTGAAGTTGGAACG 3', reverse: 5' AAGATGTAATTCCGTAAGGG 3') and annealing temperatures were 63°C, 59°C and 55°C, respectively. RT–PCRs were performed as described above.

Statistical analysis
Statistical analysis for comparison of post-thaw survival rate was performed using the {chi}2 test. A P-value of <0.05 was considered to be statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
Morphology of HAMs and viability of vitrified-thawed HAMs
In primary culture, the HAMs grew in a scattered manner and some cells formed a colony. The morphology of the HAMs appeared rather heterogeneous in primary culture as seen in Fig. 1; however, they progressively showed homogenous fibroblast-like features following subsequent subculture. The viability of HAMs after vitrification and thawing was 84.3 ± 3.2%. The thawed HAMs showed fibroblast-like morphology and growth patterns, similar to non-cryopreserved HAMs (Fig. 2).


Figure 1
View larger version (148K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1: Morphology and growth of HAMs.

(A) Primary (x100), (B) Passage 2 (14 days, x100), (C) Passage 4 (28 days, x100) and (D) Passage 4 (28 days, x200). In primary culture, the cells grew up scattered and some cells formed colony. Following subsequent subculture, the cells changed into spindle-like fibroblast. Bar: A–C = 100 µm, D = 50 µm.

 

Figure 2
View larger version (109K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2: Morphology and growth of vitrified-thawed HAMs.

(A) 1 day after thawing (x100), (B) 7 days after thawing (x100) and (C) 7 days after thawing (x200). After vitrification and thawing, HAMs had similar morphology like fibroblast and were indistinguishable from non-cryopreserved HAMs. Bar: A, B = 100 µm. C = 50 µm.

 
Proliferation of vitrified-thawed HAMs
The thawed and non-cryopreserved HAMs were subcultured until Passage 14 (30 or 31 cell doublings) (Fig. 3). Until 13th passage, fibroblast-like morphology was observed consistently both in thawed and non-cryopreserved HAMs. At 14th passage, cells in both cultures became large and flat, suggesting senescence. Average doubling time from Passage 3 to 14 in thawed and non-cryopreserved HAMs was 3.4 and 3.3 days, respectively. The cumulative cell number for thawed and non-cryopreserved HAMs was 13 x 1014 and 4.6 x 1014, respectively.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3: Cumulative cell growth according to days of culture (A) and passage (B). (A) Growth curve for the HAMs throughout ex vivo expansion, (B) cumulative doubling numbers for the HAMs during the same culture period.

 
Expression of surface antigens by flow cytometry
The cell surface antigen profiles of thawed and non-cryopreserved HAMs at 3rd passage were analyzed. Thawed HAMs showed strong positive immunoreactivity for CD44, CD49d, CD59, CD90, CD105 and HLA-ABC, weak positive signals for HLA-G, and cells were negative for CD31, CD34, CD45, CD106, CD117 and HLA-DR (Fig. 4, Table III). These expression patterns were similar for thawed and non-cryopreserved HAMs.


Figure 4
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4: Immunophenotypic characteristics of thawed and non-cryopreserved HAMs.

Immunophenotypic characteristics were examined by flow cytometry. A similar pattern of expressions of surface antigens was observed in thawed and non-cryopreserved HAMs; strong positive for CD44, CD49d, CD59, CD90, CD105 and HLA-ABC, weak positive for HLA-G, and negative for CD31, CD34, CD45, CD106, CD117 and HLA-DR. +, strong positive; ±, weak positive; –, negative.

 

View this table:
[in this window]
[in a new window]

 
Table III. Comparison of phenotype of non-cryopreserved and post-vitrification HAMs assessed using a fluorescence- activated cell sorter.

 
Expression of ESC markers
The vitrified-thawed HAMs at 3rd and 7th passage consistently expressed CK18, fibroblast growth factor-5, GATA-4, neural cell adhesion molecule, Nestin, Oct-4, stem cell factor (SCF), HLA-ABC, Vimentin, bone morphogenetic protein 4 (BMP-4), hepatocyte nuclear factor 4{alpha}, Pax-6, alpha-fetoprotein AFP, Brachyury, BMP-2, as analyzed by RT–PCR (Fig. 5), and showed positive immunoreactivity for TRA-1-60, SSEA-3 and SSEA-4 (Fig. 6). These patterns of expression were consistent with non-cryopreserved HAMs at the same passages. HLA-DR was not detected in any of the cells studied.


Figure 5
View larger version (50K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5: Comparison of mRNA expressions between non-cryopreserved and vitrified-thawed HAMs.

P3, 3rd passage of non-cryopreserved HAMs; V-P3, 3rd passage of post-vitrification HAMs; P7, 7th passage of non-cryopreserved HAMs; V-P7, 7th passage of post-vitrification. Both non-cryopreserved and post-vitrification HAMs expressed specific makers in the same manner.

 

Figure 6
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6: Immunocytochemical analysis of non-cryopreserved and vitrified-thawed HAMs.

Non-cryopreserved and vitrified-thawed HAMs showed the same immunoreactivity against Tra-1-60, stage-specific embryonic antigen (SSEA)-3 and SSEA-4. Only nuclei were stained with hematoxylin in negative control. Magnification: x40, Bar = 100 µm.

 
Examination of differentiation potential
As shown in Fig. 7, mRNAs of CBFA-1 and LPL were detected by RT–PCR in thawed HAMs after osteogenic and adipogenic differentiation, respectively. These patterns of expression were consistent with non-cryopreserved HAMs. After chondrogenic differentiation, decorin mRNA was detected and the signal was stronger in differentiated thawed HAMs than in the undifferentiated state. This pattern of expression was also observed in non-cryopreserved HAMs.


Figure 7
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7: mRNA expressions of non-cryopreserved and vitrified-thawed HAMs after induction of differentiation.

(A) Non-cryopreserved HAMs, undifferentiated; (B) non-cryopreserved HAMs, differentiated; (C) vitrified-thawed HAMs, undifferentiated; (D) vitrified-thawed HAMs, differentiated. The vitrified-thawed HAMs expressed lineage specific markers in the same manner as non-cryopreserved HAMs after induction of differentiation for adipogenesis, osteogenesis and chondrogenesis.

 
After culture for osteogenic differentiation, vitrified-thawed HAMs showed mineral accumulation (stained by Von Kossa). After culture for adipogenic differentiation, numerous neutral lipid droplets were observed in the cytoplasm of vitrified-thawed HAMs cells (stained by Oil Red O). After culture for chondrogenic differentiation, chondrogenic matrices were observed (stained by Alcian Blue) (Fig. 8).


Figure 8
View larger version (145K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 8: Differentiation potency of vitrified-thawed HAMs.

(A) Before differentiation (x200), (B) after osteogenic induction (Von Kossa staining, x200), (C) after adipogenic induction (Oil Red O staining, x200) and (D) after chondrogenic induction (Alcian Blue staining, x200). After induction of differentiation for 2–3 weeks in respective induction media, post-vitrification HAMs were stained positively for each staining, which indicate appropriate osteogenic, adipogenic and chondrogenic induction, respectively. Bar = 50 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
The objective of this study was to test the possibility that vitrification is a useful method for cryopreservation of HAMs. Slow freezing has been principally used for cryopreservation of various cells, including human embryos. We successfully vitrified HAMs, and confirmed the morphology, cell surface antigens, gene expression patterns and differentiation capacity of the post-vitrification HAMs compared with non-cryopreserved controls. These observations indicate that vitrification can be an efficient storage method for HAMs without losing the activity and usual properties of MSCs.

Slow freezing is a method used to balance the damage caused by various factors, including ice crystal formation, fracture, toxic and osmotic damage, by decreasing temperature slowly with low concentration of cryoprotectant (Vajta et al., 2006Go). But it is difficult to eliminate injuries from intracellular ice formation completely, which is the main source of fracture and damage to the cytoplasm (Youssry et al., 2008Go); it is also time-consuming procedure and requires an expensive programmable freezer. In our preliminary study on HAMs, we observed that slow freezing resulted in lower survival rate compared with the vitrification (data not shown).

Vitrification is a process where glass-like solidification of a solution occurs without the formation of ice crystals inside living cells, by exposing to high concentration of cryoprotectant with higher cooling rate (Chian et al., 2004Go). This procedure is a simple method to circumvent the obstacles of slow freezing (Rall and Fahy, 1985Go) without the need for a freezing container to modulate the reduction of temperature in the deep freezer before storing in liquid nitrogen. Also, Kuleshova and Lopata (2002)Goascertained advantages of vitrification when compared with previously applied cryopreservation techniques. These advantages include control of solute penetration and dehydration rate, prevention of prolonged temperature shock and damage from ice formation, and inexpensive equipment and running costs. In most vitrification protocols, very high concentrations of cryoprotectants have been used, thus rapidly dehydrating the cells or embryos (Rall et al., 1987Go). A tight correlation between the concentration of the cryoprotectant and cooling-warming rates during the vitrification process has been previously demonstrated (Chian et al., 2004Go). However, the vitrification method requires a high concentration of permeable and/or non-permeable cryoprotectants loaded onto cells before plunging into liquid nitrogen, exposing them to extreme osmotic stresses and chemical toxicity (Woods et al., 2004Go). Therefore, use of a cryoprotectant as a permeating agent is an essential component in all vitrification solutions (Kasai et al., 2004Go). EG is the most commonly used cryoprotectant for vitrification due to its low molecular weight and low toxicity (Chian et al., 2004Go). Moreover, it has been reported that cryoprotectant mixtures may have some advantage over solutions containing only one permeable cryoprotectant (Vajta et al., 1998Go). In addition, additives with high molecular weights, such as sucrose, can significantly reduce the toxicity by decreasing the concentration of permeating agents required for vitrificaiton solution. In this study, we established a two-step vitrification protocol for the HAMs using EG-based cryoprotectant, and our findings are in line with the previous reports showing the superiority of EG, which has been proven to be less toxic on murine and human embryos compared with permeating agents such as DMSO and propylene glycol (PROH) (Ali and Shelton, 1993Go; Chi et al., 2002Go). We chose EFS 40 containing 40% v/v EG for the vitrification solution, which is widely used for successful vitrification of mouse embryos (Kasai et al., 1990Go; Nagy et al., 2003Go), human blastocysts (Cho et al., 2002Go) and ESCs (Fujioka et al., 2004Go). Our preliminary data demonstrated that the combination of EG with either PROH or DMSO resulted in a very low survival rate of HAMs compared with EFS 40 alone (data not shown). In addition, we used Ficoll 70 as a macromolecule to promote permeation by cryoprotectants, which seems to have advantages of lower toxicity, higher solubility and lower viscosity (Kasai et al., 1990Go).

In addition, there have also been several reports of the successful vitrification of human oocytes, zygotes and embryos by their direct contact with liquid nitrogen (Park et al., 2000Go; Isachenko et al., 2003Go, 2004a). The achievable cooling rate by direct plunging into liquid nitrogen (Palasz and Mapletoft, 1996Go) was approximately from 2500°C/min to 5000°C/min. But liquid nitrogen used for storage can be a source of contamination by micro-organisms (Tedder et al., 1995Go; Bielanski et al., 2000Go), and filtration or ultratreatment of liquid nitrogen cannot guarantee the absence of contamination of biological material by virus (Isachenko et al., 2005bGo).

Some authors suggested the aseptic vitrification method, using open-pulled straw or reliable sealing, to avoid direct contact with liquid nitrogen (Kuleshova et al., 2000Go; Isachenko et al., 2005bGo), although this isolation method results in a decreased speed of cooling, which can decrease the efficacy of the vitrification protocol (Isachenko et al., 2005bGo). They also obtained the equally high survival rates of mouse 8-cell embryo after vitrification (Isachenko et al., 2005aGo) at cooling rates ranging from ~15°C to 2500°C/min and similar post-thaw characteristics of human vitrified spermatozoa by fast (20 000°C/min) or relatively moderate (200°C/min) cooling (Isachenko et al., 2004bGo). Rall (1987)Go reported cooling rates of 10°C/min as sufficient for the vitrification of mouse embryos, whereas the elevated warming rate is the most important parameter for increasing viability of vitrified cells after thawing (Isachenlo et al., 1998Go). We achieved vitrification of a bulk solution and HAMs using a cryovial and abrupt cooling at very high speed by plunging into liquid nitrogen without direct contact.

In our study, HAMs showed typical features of spindle-shaped cells and underwent successful passage over ten times, with 30 cell doublings. The cells uniformly expressed cell surface antigens (positive for CD44, CD59, CD90 and CD105, negative for CD31, CD34, CD45, CD106 and CD117), consistent with the antigen profile previously reported (Pittenger et al., 1999Go). HAMs are known to share many surface antigenic properties with other cells (Pittenger et al., 1999Go) as well as gene expression profiles; SCF (Majumdar et al., 2003Go), CK18 (Lee et al., 2004aGo,bGo) and Nestin (Vogel et al., 2003Go), which are similar to MSCs derived from bone marrow. However, HAMs were different from MSCs derived from bone marrow with regard to immunopositivity for TRA-1-60, and SSEA-3 and -4 (Xu et al., 2001Go). In addition, Yen et al. (2005)Go reported that placenta-derived stem cells share ESC markers including SSEA-4 and TRA-1-80. In our study, we could confirm the immunopositivity for TRA-1-60, SSEA-3 and -4 in HAMs before and after vitrification. This might indicate that HAMs originating from the amnion have different MSCs characteristics, thus suggesting that HAMs are a new source of pluripotent stem cells.

In addition, a similar expression profile for surface antigens were observed in HAMs before and after vitrification in our study and this finding suggests that vitrification may be a useful method for cryopreservation of HAMs. Post-vitrification HAMs still expressed multilineage specific genes such as Oct-4, and ESC markers (Tsai et al., 2004Go); CK 18, one of the endodermic lineage-specific genes (Wells et al., 1997Go); Nestin, a specific marker for neural stem cells (Lendahl et al., 1990Go); BMP-4, a marker for chondrogenesis (Kuroda et al., 2006Go); GATA-4, a cardiac specific marker (Grepin et al., 1997Go); AFP, a hepatocyte marker (Engelhardt et al., 1984Go); and HLA-ABC, similar to those of the non-cryopreserved HAMs. These results indicate that HAMs still have the potential for multilineage differentiation after vitrification. In addition, the findings from immunocytochemical staining of the post-vitrification HAMs were similar to the non-cryopreserved HAMs with respect to the positive immunoreactivity against TRA-1-60, SSEA-3 and -4.

When the HAMs were thawed after vitrification, they were recovered with acceptable viability (84.3 ± 3.2%), even after relatively short duration (2-week storage). After thawing, the HAMs retained their typical morphology, resembling the fibroblast immunophenotype and their proliferation/differentiation potential was similar to their non-cryopreserved counterparts. Moreover, the vitrified HAMs showed a prolonged growth capacity for >10 passages without any changes in their morphology, proliferation potential or immunophenotype. In addition, post-vitrification HAMs expressed the mesenchymal tissue-specific genes such as CBFA-1 (a marker for osteoblast), LPL (a marker for adipocyte) and Decorin (a marker for chondrocyte) after induction of differentiation. These findings indicate that HAMs consistently maintain the potential to differentiate into mesodermal tissues after vitrification. Although further studies on prolonged duration of cryopreservation and consideration of other cryoprotectant solutions for vitrification are needed, we have shown that HAMs which are vitrified using sequential exposure to EG 20 and EFS 40 could maintain the characteristics of MSCs and differentiation potential into mesenchymal derivatives, including osteoblast, adipocyte and chondrocyte cell types.

In conclusion, the results of our study indicate that vitrification is an effective and highly conservative cryopreservation method for HAMs. We believe that vitrification might be useful for banking HAMs for future research and clinical applications.


    Funding
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
This study was supported by the research fund of the College of Medicine, Seoul National University (Grant No. 03-2006-002).


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 References
 
Ali J, Shelton N. Vitrification of preimplantation stage of mouse embryos. J Reprod Fertil (1993) 98:459–465.[Abstract/Free Full Text]

Alviano F, Fossati V, Marchionni C, Arpinati M, Bonsi L, Franchina M, Lanzoni G, Cantoni S, Cavallini C, Bianchi F, et al. Term Amniotic membrane is a high throughput source for multipotent Mesenchymal Stem Cells with the ability to differentiate into endothelial cells in vitro. BMC Dev Biol (2007) 7:11.[CrossRef][Medline]

Bailo M, Soncini M, Vertua E, Signoroni PB, Sanzone S, Lombardi G, Arienti D, Calamani F, Zatti D, Paul P, et al. Engraftment potential of human amnion and chorion cells derived from term placenta. Transplantation (2004) 78:1439–1448.[CrossRef][Web of Science][Medline]

Barry FP. Biology and clinical applications of mesenchymal stem cells. Birth Defects Res Part C Embryo Today (2003) 69:250–256.[CrossRef][Medline]

Bielanski A, Nadin-Davis S, Sapp T, Lutze-Wallace C. Viral contamination of embryos cryopreserved in liquid nitrogen. Cryobiology (2000) 40:110–116.[CrossRef][Medline]

Chi HJ, Koo JJ, Kim MY, Joo JY, Chang SS, Chung KS. Cryopreservation of human embryos using ethylene glycol in controlled slow freezing. Hum Reprod (2002) 17:2146–2151.[Abstract/Free Full Text]

Chian RC, Kuwayama M, Tan L, Tan J, Kato O, Nagai T. High survival rate of bovine oocytes matured in vitro following vitrification. J Reprod Dev (2004) 50:685–696.[CrossRef][Web of Science][Medline]

Cho HJ, Son WY, Yoon SH, Lee SW, Lim JH. An improved protocol for dilution of cryoprotectants from vitrified human blastocysts. Hum Reprod (2002) 17:2419–2422.[Abstract/Free Full Text]

Covas DT, Siufi JL, Silva AR, Orellana MD. Isolation and culture of umbilical vein mesenchymal stem cells. Braz J Med Biol Res (2003) 9:1179–1183.

Dobrinsky JR. Advancements in cryopreservation of domestic animal embryos. Theriogenology (2002) 67:285–302.

Engelhardt NA, Baranov VN, Lazareva MN, Goussev AI. Ultrastructural localization of alpha-fete (AFP) in regenerating mouse liver poisoned with CCL-4.1. Reexpression of AFP in differentiated hepatocytes. Histochemistry (1984) 80:401–409.[CrossRef][Web of Science][Medline]

Erices A, Conget P, Minguell JJ. Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol (2000) 109:235–242.[CrossRef][Web of Science][Medline]

Friedenstein AJ, Gorskaja JF, Kulagina NN. Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp Hematol (1976) 4:267–274.[Web of Science][Medline]

Fujioka T, Yasuchika K, Nakamura Y, Nakatsuji N, Suemori H. A simple and efficient cryopreservation method for primate embryonic stem cells. Int J Dev Biol (2004) 48:1149–1154.[CrossRef][Web of Science][Medline]

Fukuchi Y, Nakajima H, Sugiyama D, Hirose I, Kitamura T, Tsuji K. Human placenta derived cells have mesenchymal stem/progenitor cell potential. Stem Cells (2004) 22:649–658.[CrossRef][Medline]

Grepin C, Nemer G, Nemer M. Enhanced cariogenesis in embronic stem cells everexpressing the GATA-4 transcription factor. Development (1997) 124:2387–2395.[Abstract]

Herzog EL, Chai L, Krause DS. Plasticity of marrow-derived stem cells. Blood (2003) 102:2483–2493.

Horwitz EM, Prockop DJ, Fitzpatrick LA, Koo WW, Gordon PL, Neel M, Sussman M, Orchard P, Marx JC, Pyeritz RE, et al. Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med (1999) 5:309–313.[CrossRef][Web of Science][Medline]

In ‘t Anker PS, Scherjon SA, Kleijburg-van der Keur C, Noort WA, Claas FH, Willemze R, Fibbe WE, Kanhai NH. Amniotic fluid as a novel source of mesenchymal stem cells for therapeutic transplantation. Blood (2003) 102:1548–1549.[Free Full Text]

Isachenlo V, Perez-Sanchez F, Isachenko V, Grishchenko V, Soler C. Vitrification of GV-porcine oocytes with intact intracellular lipids: effect of the cryoprotectant saturation/dilution stepping, elevated temperature and cytoskeletal inhibitor. Cryobiology (1998) 36:250–253.[CrossRef][Medline]

Isachenko V, Selman H, Isachenko E, Montag M, Al-Danasuri I, Nawroth F. Modified vitrification of human pronuclear oocytes: efficacy and effect on ultrastructure. Reprod Biomed Online (2003) 7:211–216.[Medline]

Isachenko V, Selman H, Isachenko E, Montag M, El-Danasouri I, Nawroth F. Effect of cryoprotectants on the ultrastructure of cooled human pronuclear oocytes. Fertil Steril (2004) a 81:720–722.[CrossRef][Web of Science][Medline]

Isachenko V, Isachenko E, Katkov II, Montag M, Dessole S, Nawroth F, Van der ven H. Cyoprotectant-free cryopreservation of human spermatozoa by vitrification and freezing in vapor: effect on motility, DNA integrity, and fertilization ability. Biol Reprod (2004) b 71:1167–1173.[Abstract/Free Full Text]

Isachenko V, Montag M, Isachenko E, van der Ven H. Vitrification of mouse pronuclear embryos after polar body biopsy without direct contact with liquid nitrogen. Fertil Steril (2005) a84:1011–1016.[CrossRef][Web of Science][Medline]

Isachenko V, Montag M, Isachenko E, Zaeva V, Krivokharchenko I, Shafei R, van der Ven H. Aseptic technology of vitrificaiton of human pronuclear oocytes using open-pulled straws. Hum Reprod (2005) b 20:492–496.[Abstract/Free Full Text]

Karlsson OM. Cryopreservation: freezing and vitrification. Science (2002) 296:655–656.[Web of Science][Medline]

Kasai M, Mukaida T. Cryopreservation of animal and human embryos by vitrification. Reprod Biomed Online (2004) 9:164–170.[Web of Science][Medline]

Kasai M, Komi JH, Takakamo A, Tsudera H, Sakurai T, Machida T. A simple method for mouse embryo cryopreservation in a low toxicity vitrification solution, without appreciable loss of viability. J Reprod Fertil (1990) 89:91–97.[Abstract/Free Full Text]

Kim J, Lee Y, Kim H, Hwang KJ, Kwon HC, Kim SK, Cho DJ, Kang SG, You J. Human amniotic fluid-stem cells have characteristics of multipotent stem cells. Cell Prolif (2007) 40:75–90.[Web of Science][Medline]

Koc ON, Gerson SL, Cooper BW, Dyhouse SM, Haynesworth SE, Caplan AI, Lazarus HM. Rapid hematopoietic recovery after coinfusion of autologous-blood stem cells and culture-expanded marrow mesenchymal stem cells in advanced breast cancer patients receiving high-dose chemotherapy. J Clin Oncol (2000) 18:307–316.[Abstract/Free Full Text]

Kotobuki N, Hirose M, Machida H, Katou Y, Muraki K, Takakura Y, Ohgushi H. Viability and osteogenic potential of cryopreserved human bone marrow-derived mesenchymal cells. Tissue Eng (2005) 11:663–673.[CrossRef][Web of Science][Medline]

Kuleshova L, Lopata A. Vitrification can be more favorable them slow cooling. Fertil Steril (2002) 78:449–454.[CrossRef][Web of Science][Medline]

Kuleshova L, Shaw J. A strategy for rapid cooling of mouse embryos within a double straw to eliminate the risk of contamination during storage in liquid nitrogen. Hum Reprod (2000) 15:2604–2609.[Abstract/Free Full Text]

Kuleshova L, Gianaroli L, Magli C, Ferraretti A, Trounson A. Birth following vitrification of a small number of human oocytes: case report. Hum Reprod (1999) 14:3077–3079.[Abstract/Free Full Text]

Kurata H, Takakuwa K, Tanaka K. Vitrification of hematopoietic progenitor cells obtained form human cord blood. Bone Marrow Transplant (1994) 14:261–263.[Web of Science][Medline]

Kuroda R, Usas A, Kubo S, Corsi K, Peng H, Rose T, Cummins J, Fu FH, Huard J. Cartilage repair using bone morphogenetic protein 4 and muscle-derived stem cells. Arthritis Rheum (2006) 54:433–442.[CrossRef][Web of Science][Medline]

Lee MW, Choi J, Yang MS, Moon YJ, Park JS, Kim HC, Kim YJ. Mesenchymal stem cells from cryopreserved human umbilical cord blood. Biochem Biophys Res Commun (2004) a 320:273–278.[CrossRef][Web of Science][Medline]

Lee RH, Kim B, Choi I, Kim H, Choi HS, Suh K, Bae YC, Jung JS. Characterization and expression analysis of mesenchymal stem cells from human bone marrow and adipose tissue. Cell Physiol Biochem (2004) b 14:311–324.[CrossRef][Web of Science][Medline]

Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell (1990) 60:585–595.[CrossRef][Web of Science][Medline]

Li T, Zhou C, Liu C, Mai Q, Zhuang G. Bulk vitrification of human embryonic stem cells. Hum Reprod (2008) 23:358–364.[Abstract/Free Full Text]

Liechty KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med (2000) 6:1282–1286.[CrossRef][Web of Science][Medline]

Majumdar MK, Keane-Moore M, Buyaner D, Hardy WB, Moorman MA, McIntosh KR, Mosca JD. Characterization and functionality of cell surface molecules on human mesenchymal stem cells. J Biomed Sci (2003) 10:228–241.[Web of Science][Medline]

Minguell JJ, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med (2001) 226:507–520.[Abstract/Free Full Text]

Nagy A, Gertsenstein M, Vintersten K, Behringer R. Embyo cryopreservation by rapid cooling. In: Manipulating the Mouse Embryo: A Laboratory Manual (2003) 3rd edn. Cold spring Habor Laboratory Press. 610–615.

Ochsenbein-Kolble N, Bilic G, Hall H, Huch R, Zimmermann R. Inducing proliferation of human amnion epithelial and mesenchymal cells for prospective engineering of membrane repair. J Perinat Med (2003) 31:287–294.[CrossRef][Web of Science][Medline]

Palasz AT, Mapletoft RJ. Cryopreservation of mammalian embryos and oocytes: recent advances. Biotechnol Adv (1996) 14:127–149.[CrossRef][Web of Science][Medline]

Park SP, Kim EY, Oh JH, Nam HK, Lee KS, Park SY, Park EM, Yoon SH, Chung KS, Lim JH. Ultra-rapid freezing of human multipronuclear oocytes using electron microscope grids. Hum Reprod (2000) 15:1787–1790.[Abstract/Free Full Text]

Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science (1999) 284:143–147.[Abstract/Free Full Text]

Portmann-Lanz CB, Schoeberlein A, Huber A, Sager R, Malek A, Holzgreve W, Surbek DV. Placental mesenchymal stem cells as potential autologous graft for pre- and perinatal neuroregeneration. Am J Obstet Gynecol (2006) 194:664–673.[CrossRef][Web of Science][Medline]

Prusa AR, Marton E, Rosner M, Bernasch G, Hengstschlager M. Oct-4 expressing cells in human amniotic fluid: a new source for stem cell research? Hum Reprod (2003) 18:1489–1493.[Abstract/Free Full Text]

Rall WF. Factor affecting the survival of mouse embryos cryopreserved by vitrification. Cryobiology (1987) 24:539–542.

Rall WF, Fahy GM. Ice-free cryopreservation of mouse embryos at -196°C by vitrification. Nature (1985) 313:573–575.[CrossRef][Medline]

Rall WF, Wood MJ, Kirby C, Whittingham DG. Development of mouse embryos cryopreserved by vitrification. J Reprod Fertil (1987) 80:499–504.[Abstract/Free Full Text]

Reubinoff BE, Pera MF, Vajta G, Trounson AO. Effective cryopreservation of human embryonic stem cells by open pulled straw vitrification method. Hum Reprod (2001) 16:2187–2194.[Abstract/Free Full Text]

Reyes M, Lund T, Lenvik T, Aguiar D, Koodie L, Verfaillie CM. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood (2001) 98:2615–2625.[Abstract/Free Full Text]

Romanov YA, Svintsitskaya VA, Smirnov VN. Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem Cells (2003) 21:105–110.[CrossRef][Web of Science][Medline]

Tedder RS, Zuckerman Ma, Goldstone AH, Hawkins AE, Fielding A, Briggs EM, Irwin K, Blair S, Gorman AM, Patterson KG, et al. Hepatitis-B transmission from contaminated cryopreservation tank. Lancet (1995) 346:137–139.[CrossRef][Web of Science][Medline]

Tocci A, Forte L. Mesenchymal stem cell: Use and perspectives. Hematol J (2003) 4:92–96.[CrossRef][Medline]

Tsai MS, Lee JL, Chang YH, Hwang SM. Isolation of human Multipotent mesenchymal stem cells from second trimester amniotic fluid using a novel two-stage culture protocol. Hum Reprod (2004) 19:1450–1457.[Abstract/Free Full Text]

Vajta G, Nagy Z. Are programmable freezers still needed in the embryo laboratory? Review on vitrification. Reprod Biomed Online (2006) 12:779–796.[Web of Science][Medline]

Vajta G, Holm P, Kuwayama M, Booth PJ, Jacobsen H, Greve T, Callesen H. Open pulled straw (OPS) vitrification: a new way to reduce cryo-injures bovine ova and embryos. Mol Reprod Dev (1998) 51:53–58.[CrossRef][Web of Science][Medline]

Vogel W, Grunebach F, Messam CA, Kanz L, Brugger W, Buhring HJ. Heterogeneity among human bone marrow-derived mesenchymal stem cells and neural progenitor cells. Haematologica (2003) 88:126–133.[Abstract/Free Full Text]

Wells MJ, Hatton MW, Hewelett B, Podor TJ, Sheffield WP, Blajchman MA. Cytokeratin 18 is expressed on the hepatocyte plasma membrane surface and interacts with thrombin-antithrombin complex. J Biol Chem (1997) 272:18574–18581.

Woods A, Benson J, Agca Y, Critser J. Fundamental cryobiology of reproductive cells and tissues. Cryobiology (2004) 48:146–156.[CrossRef][Medline]

Xu C, Inokuma MS, Denham J, Gold K, Kundu P, Gold JD, Carpenter MK. Freeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol (2001) 19:971–974.[CrossRef][Web of Science][Medline]

Yen BG, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, Yen ML, Lee MC, Chen YC. Isolation of Multipotent cells from human term placenta. Stem cells (2005) 23:3–9.[CrossRef][Web of Science][Medline]

Youssry M, Ozmen B, Zohni K, Diedrich K, Al-Hasani S. Current aspects of blastocyst cryopreservation. Reprod Biomed Online (2008) 16:311–320.[Web of Science][Medline]

Zhao J, Hao HN, Thomas RL, Lyman WD. An efficient method for the cryopreservation of fetal human liver hematopoeitic progenitor cells. Stem Cells (2001) 19:212–218.[CrossRef][Web of Science][Medline]

Zhao P, Ise H, Hongo M, Ota M, Konishi I, Nikaido T. Human amniotic mesenchymal cells have some characteristics of cardiomyocytes. Transplantation (2005) 79:528–535.[CrossRef][Web of Science][Medline]

Submitted on February 19, 2008; resubmitted on April 23, 2008; accepted on May 2, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF ) Freely available
Right arrow All Versions of this Article:
23/8/1760    most recent
den202v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Moon, J. H.
Right arrow Articles by Kim, H. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, J. H.
Right arrow Articles by Kim, H. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?