Hum. Reprod. Advance Access published online on July 24, 2008
Human Reproduction, doi:10.1093/humrep/den280
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The pattern of localization of the putative oocyte activation factor, phospholipase C
, in uncapacitated, capacitated, and ionophore-treated human spermatozoa



1 Department of Pharmacology, University of Oxford, Mansfield Road, Oxford OX1 3QT, UK 2 Present address: Nuffield Department of Obstetrics and Gynaecology, University of Oxford, Level 3, Women's Centre, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK
3 Correspondence address. E-mail: john.parrington{at}pharm.ox.ac.uk
| Abstract |
|---|
|
|
|---|
BACKGROUND: Recent studies suggest that in mammals, oocyte activation at fertilization is triggered by a sperm-specific phospholipase C, PLC
. We investigated PLC
localization in human spermatozoa.
METHODS: A polyclonal antibody was generated against human PLC
and used in immunoblotting and immunofluorescence studies of ejaculated human sperm in uncapacitated and capacitated states. An ionophore was also used to induce the acrosome reaction in vitro.
RESULTS: After verifying specificity of the anti-PLC
antibody by immunoblotting, immunofluorescence studies showed that the predominant localization of PLC
in uncapacitated sperm was in the equatorial region, a pattern maintained following capacitation and ionophore treatment. The analysis of pooled samples showed
88% of uncapacitated sperm expressed PLC
in the equatorial region, whereas
35% and
21% of sperm expressed additional populations of PLC
in the acrosomal or post-acrosomal region, respectively. One population of PLC
was observed in the post-acrosomal region of
12% of sperm. The proportion of cells with post-acrosomal PLC
increased following capacitation and ionophore treatment (P < 0.05). The same tendency was found in individual samples. There was a strong correlation (r = 0.716, P < 0.0001) between presence of an intact acrosome and proportion of sperm immunoreactive to PLC
in the acrosomal region.
CONCLUSIONS: PLC
was variably detectable in three localities within the sperm head: the equatorial segment and acrosomal/post-acrosomal region. Variability in PLC
localization in sperm from fertile males may reflect differences in oocyte activation capabilities between individuals or within an ejaculate. This approach may help in investigating the possible links between PLC
and certain types of male infertility.
Key words: oocyte activation/phospholipase C zeta/sperm/capacitation/acrosome reaction
| Introduction |
|---|
|
|
|---|
Activation of the oocyte is a fundamental developmental event that includes such processes as cortical granule exocytosis, zygotic genome activation, prevention of polyspermy and the release of the oocyte from meiotic arrest (Whitaker, 2006
(Swann et al., 2006
was first identified in the mouse (Saunders et al., 2002
orthologues in two non-mammalian species, the domestic chicken (Coward et al., 2005
may have a universal role in triggering oocyte activation in vertebrates.
Several pieces of evidence point to PLC
being the physiological agent of oocyte activation. Injection of mouse or human PLC
complementary RNA, or mouse PLC
recombinant protein, into mouse oocytes triggers Ca2+ oscillations identical to those seen at fertilization (Cox et al., 2002
; Saunders et al., 2002
; Kouchi et al., 2004
), whereas immunodepletion of endogenous PLC
from sperm protein extracts removes their ability to release Ca2+ (Saunders et al., 2002
). The estimated PLC
content of a single sperm was determined to be sufficient to induce Ca2+ oscillations in mouse oocytes along with normal development to the blastocyst stage (Saunders et al., 2002
). PLC
has other distinctive properties similar to those ascribed to the endogenous oocyte activation factor, such as high Ca2+ sensitivity (Kouchi et al., 2004
) and accumulation in the zygotic pronucleus (Larman et al., 2004
; Yoda et al., 2004
). Furthermore, the sperm of transgenic mice expressing short hairpin RNAs targeting PLC
exhibited reduced amounts of PLC
, and when injected into mouse oocytes, they induced Ca2+ oscillations that ended prematurely (Knott et al., 2005
).
Infertility is a major public health problem with an estimated prevalence of 9% of couples in the human population (Boivin et al., 2007
). The clinical technique intra-cytoplasmic sperm injection (ICSI) has been of great importance for treating infertility. However, it is known that 2–3% of ICSI cycles fail as an apparent consequence of the oocyte failing to activate (Mahutte and Arici, 2003
). Consequently, there is much clinical interest in investigating the possible mechanisms underlying oocyte activation failure following ICSI (Sousa and Tesarik, 1994
; Flaherty et al., 1995
; Araki et al., 2004
; Heindryckx et al., 2005
; Moaz et al., 2006
) and the development of methods to overcome such difficulties (Eldar-Geva et al., 2003
; Ebner, et al., 2004
; Murase et al., 2004
; Morozumi et al., 2006
). It is possible that oocyte activation failure following ICSI or other types of male infertility could be due to deficiencies in PLC
, possibly by outright absence of expression, but also by other more subtle changes, for instance an incorrect pattern of localization.
One key issue still to be resolved is the pattern of localization of PLC
protein in the human spermatozoon. The aim of the present study was to carry out immunofluorescence studies with specific antibodies against human PLC
to investigate the precise intracellular localization of PLC
in ejaculated human sperm. We also sought to examine whether changes in the pattern of localization of PLC
occur during the important physiological events associated with capacitation and the acrosome reaction.
| Materials and Methods |
|---|
|
|
|---|
Semen samples
Fresh semen samples were obtained from healthy fertile volunteer donors (after 3 days of abstinence) with informed written consent. Samples were conveyed to the laboratory within 1 h of ejaculation. The study was ethically approved by the National Research Ethics Service (NRES, UK). Only ejaculates determined to have normal semen parameters (WHO, 1999) were selected for the analysis. Analyses were performed using sperm samples treated in two different ways. First, in an effort to reduce the potential for variability due to donor and sample, we pooled ejaculated sperm samples collected from at least three individuals. Second, in order to specifically investigate potential variability both within and between single ejaculates, we individually analysed sperm samples from six normal healthy donors.
Antibody design and purification
Two potentially immunogenic peptide sequences were identified in the human PLC
amino-acid sequence (Accession Number: AF532185
[GenBank]
): (C-RESKSYFNPSNIKE-coNH2; C-ETHERKGSDKRGDN-coNH2) and injected into rabbits to allow production of a polyclonal antibody (Covalab, Villeurbanne, France). The crude final bleed serum was affinity purified to both peptides using a SulfoLink Kit (Pierce Biotechnology, Rockford, USA) and dialysed overnight into phosphate-buffered saline (PBS)/50% glycerol using a Slide-A-Lyzer Kit (Pierce Biotechnology). The concentration of the final affinity-purified anti-human-PLC
antibody was determined with an EZQ Protein Quantification Kit (Invitrogen, Paisley, UK).
Preparation of whole sperm and sperm protein extracts
To determine antibody specificity and validation, fresh semen samples were treated such that two distinct sample types could be obtained: whole sperm and sperm protein extract. Fresh sperm samples were first allowed to liquefy at 37°C for 1 h. Sperm samples from at least three donors were then pooled and washed with PBS containing a cocktail of EDTA-free protease inhibitors (Roche Diagnostics, Burgess Hill, UK). Samples were centrifuged at 2000 g for 10 min at room temperature, the supernatant removed and the pellet resuspended in PBS containing protease inhibitors. Pellets were washed twice further and finally resuspended in a volume of KCl/HEPES/EDTA (120 mM KCl, 20 mM HEPES, 1 mM EDTA, pH 7.5) containing Complete protease inhibitors (Roche Diagnostics). Sperm samples were then lysed by freezing and thawing in liquid nitrogen and stored at –80°C to await analysis. Sperm protein extracts were prepared by lysing whole sperm samples further with two additional freeze/thaw cycles to release soluble proteins into the cytoplasm. Lysed samples were centrifuged at 55 500 g for 1 h and the resultant supernatant concentrated on a Microcon C-30 (Millipore, Watford, UK). Protein concentration was determined using the BCA Protein Assay (Pierce Biotechnology) and sperm protein extracts stored at –80°C to await further analysis.
Preparation of recombinant human PLC
protein
The full-length complementary DNA (cDNA) encoding human PLC
was initially isolated by PCR from a human testis cDNA library obtained from RZPD (Berlin, Germany) using the primers forward (5'ATGGAAATGAGATGGTTTTTG3') and reverse (5'TCTGACGTACCAAACATAAAC3'). PCR was carried out using the High Fidelity PCR Master System (Roche Diagnostics) in accordance with the manufacturer's instructions. The PCR fragment encoding full-length human PLC
was subsequently ligated into the pCR II-TOPO vector (Invitrogen) and transformed into competent TOPO 10 bacterial cells (Invitrogen) for cloning. Plasmid DNA was extracted using the QIAprep Mini-Prep Kit (Qiagen, Crawley, UK) and the Wizard Plus Midiprep DNA Purification System (Promega, Southampton, UK). A second round of PCR was then used to re-amplify full length human PLC
from the original human PLC
-pCR II-TOPO construct. PCR primers were designed with BamHI and SalI restriction enzyme sites at the 5' and 3' ends of the PLC
sequence (forward: GATCGGATCCAGATGGTTTTTGTCAAAG; reverse: GATCGTCGACCTATCTGACGTACCAAACATA). PCR products were subcloned into the pCR II-TOPO vector, transfected into competent cells and plasmid DNA purified as before. BamHI and SalI restriction digests were used to ligate full-length human PLC
into the PGEX2TKP protein expression vector (GE Healthcare Life Sciences, Amersham, UK) with the aid of a Rapid DNA Ligation Kit (Roche Diagnostics). The PGEX2TKP vector adds a glutathione-S-transferase (GST) tag onto the N-terminus of the synthesized recombinant protein to facilitate subsequent purification. The identities of all constructs were verified by DNA sequencing (MWG Biotech, Ebersberg, Germany).
Recombinant human PLC
was synthesized by transforming the human PLC
-PGEX2TKP construct into BL21 DE3 codon+PLysS competent cells (Stratagene, La Jolla, USA). Cells were grown overnight at 37°C on Luria Broth (LB) agar plates containing 100 µg/ml ampicillin and individual colonies grown overnight in 10 ml of LB broth (+ampicillin) at 37°C. The 10 ml overnight cultures were then added to 1 l of pre-warmed LB broth (+ampicillin) and incubated on a shaker (225 rpm) at 37°C until cell density (A600) was 0.4–0.6. Protein expression was induced by adding 0.1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG) and the culture incubated on a shaker overnight at 16°C. Small (1 ml) samples of non-induced and induced culture media were taken at appropriate time-points and frozen at –25°C to aid subsequent analysis. Induced cultures were centrifuged at 5000g for 15 min and the supernatant removed. A 1 ml sample of supernatant was frozen at –25°C to aid subsequent analysis. Pelleted cells were then resuspended in 10 ml of PBS containing protease inhibitors and 0.5% Triton X-100 (Sigma, Poole, UK) and lysed on ice by sonication. The sonicated lysate was spun at 14 000g for 30 min and added to 2.5 ml of Glutathione Sepharose 4 Fast Flow Beads (GE Healthcare Life Sciences) that had been pre-washed twice in 10 ml of PBS. The lysate/bead mixture was incubated for 30 min on a rotator at room temperature and was then centrifuged for 3 min at 2000g. The supernatant was removed and the pelleted beads washed twice with PBS containing protease inhibitors and 0.5% Triton X-100 followed by a final wash in PBS only. Recombinant human PLC
was stored on the beads in PBS at –25°C to await analysis.
Antibody specificity and validation
Immunoblotting was used to demonstrate the affinity of the purified antibody to whole sperm, sperm protein extract and recombinant human PLC
using the pre-immune sera as a negative control. In brief, 100 µg of each sample type was denatured with Laemmli buffer (Laemmli, 1970
) at 95°C for 5 min and then separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis on a 10% gel. Separated proteins were then transferred for 1 h onto Protran nitrocellulose membranes (Whatman, Brentford, UK) using a wet transfer method and a Mini Trans Blot Cell (Bio-Rad Laboratories, Hemel Hempstead, UK) in accordance with the manufacturer's instructions. The extent of protein transfer was assessed by staining nitrocellulose membranes with Ponceau S (Sigma) for 1 min. For immunoblotting, membranes were first placed in blocking buffer [PBS containing 0.5% Tween (Sigma) and 5% dried milk powder] on a rocking platform for 1 h at room temperature. Membranes were then heat-sealed in a plastic pouch containing 3 ml of blocking buffer and 25 µg/ml of the affinity-purified anti-human-PLC
antibody and incubated at 4°C overnight on a rocking platform. Membranes were then washed three times in PBS/0.5% Tween and goat-anti-rabbit secondary antibody conjugated to horse-radish peroxidase (Sigma) applied at a dilution of 1:10 000 in blocking buffer. Membranes were incubated with secondary antibody for 1 h at room temperature on a rocking platform and were subsequently washed three times in PBS/0.5% Tween for 15 min. Finally, antibody binding was visualized on the membranes by enhanced chemiluminescence detection (GE Healthcare Life Sciences).
In vitro capacitation and induction of the acrosome reaction by ionophore treatment
Capacitation experiments and ionophore treatment (as a means of inducing the acrosome reaction) were undertaken with two types of sperm sample: (i) sperm pooled from at least three individual donors and (ii) individual samples collected from six normal healthy donors. A highly motile subpopulation of sperm was then harvested by a dextran/swim-up procedure (Alvarez et al., 1993
) performed in a medium devoid of bicarbonate to minimize capacitation [non-capacitating medium (NCM): 132 mM NaCl, 5.4 mM KCl, 1 mM NaH2PO4, 0.8 mM MgSO4·7H2O, 1.8 mM CaCl2·H2O, 5.6 mM glucose, 2.5 mM sodium pyruvate, 19 mM sodium lactate and 10 mM HEPES, pH 7.4]. In addition to swim-up selection procedures, we also used propidium iodide staining (0.2 µg/ml; Sigma) to ensure that only viable cells were used throughout our immunofluorecence studies. Only viable cells, those not staining with propidium iodide, were included in the analysis. Phase contract microscopy was used to confirm that the sample taken consisted of motile sperm. The concentration of collected spermatozoa was assessed using a Neubauer counting chamber (Weber Scientific International Ltd, Teddington, UK) and sperm were resuspended to a final concentration of 6 x 106 cells/ml. All samples to be analysed in the uncapacitated experimental group were taken immediately following dilution into NCM to process by immunofluorescence.
For in vitro capacitation, spermatozoa were resuspended in a capacitating medium containing bicarbonate and supplemented with 5 mg/ml of bovine serum albumin (BSA) (116 mM NaCl, 5.4 mM KCl, 1 mM NaH2PO4, 0.8 mM MgSO4·7H2O, 1.8 M CaCl2·H2O, 5.6 mM glucose, 2.5 mM sodium pyruvate, 19 mM sodium lactate, 26 mM NaHCO3, pH 7.4; Moseley et al., 2005
) and incubated for 20 h at 37°C, 5% CO2 in air. The acrosome reaction was induced by incubating aliquots of capacitated samples in the presence of 10 µM calcium ionophore A23187
[GenBank]
(Sigma) for a further 45 min at 37°C, 5% CO2. Control tubes contained dimethylsulphoxide but no ionophore.
The acrosomal status of uncapacitated (NC), capacitated (C) and ionophore-treated (IT) samples was evaluated by fluorescein iso-thiocyanate-conjugated peanut agglutinin (FITC-PNA; Invitrogen) (Mortimer et al., 1987
). For this purpose, sperm aliquots fixed in PBS/4% paraformaldehyde were smeared in duplicate onto poly-L-lysine treated slides, air-dried and permeabilized with PBS/0.5% Triton X-100 for 15 min. Slides were rinsed with PBS twice and stained with 30 µg FITC-PNA/ml for 15 min at 37°C in the dark. Subsequently, slides were washed three times with PBS and mounted for further assessment. At least 200 cells were evaluated in duplicate (n = 400) for each sample under a fluorescence microscope (DM 5000B; Leica, Milton Keynes, UK). Cells were classified into one of the four categories described by Mortimer et al. (1989)
and Gearon et al. (1994)
and only sperm showing evenly distributed fluorescence over the acrosomal region were considered as acrosome-intact (category I). Results are presented as mean (%) ± SEM of acrosome-intact cells.
Immunofluorescence studies
Immunofluorescence experiments were undertaken with two types of sperm sample: (i) sperm pooled from at least three individual donors and (ii) individual samples collected from six normal healthy donors. For immunofluorescence studies, NC, C and IT samples were pelleted by centrifugation at 1500g for 5 min, washed with PBS and fixed with PBS/4% paraformaldehyde (BDH, Lutterworth, UK) for 30 min at room temperature. After two washes in PBS, fixed sperm samples were diluted as appropriate and added to PAP moulds (Vector Laboratories, Peterborough, UK) drawn on slides pre-coated with 0.01% poly-L-lysine (Sigma). Samples were allowed to settle on slides and were then permeabilized with PBS/0.5% Triton X-100 for a period of 30 min. The slides were then rinsed twice with PBS and incubated for 1 h at room temperature with PBS/3% BSA (Sigma) to block non-specific binding sites. The affinity-purified anti-human-PLC
antibody, diluted to a concentration of 25 µg/ml in PBS/0.05% BSA, was applied overnight at 4°C. Negative control samples were included which were incubated in PBS/3% BSA instead of primary antibody. Samples were subsequently washed three times in PBS and incubated at room temperature for 1 h with 5 µg/ml of secondary fluorescent antibody (Alexa Fluor 546 F [Ab]2 fragment goat anti-rabbit immunoglobulin G; Invitrogen). In order to simultaneously visualize the acrosomal status and the sperm nucleus, slides were stained with 20 µg/ml FITC-PNA and 2 µg/ml Hoechst-33342 (Sigma) for 15 min at 37°C in the dark. Finally, samples were washed three times in PBS and mounted (Prolong Gold Antifade Mounting Reagent; Invitrogen) for analysis. Specificity of the affinity-purified anti-human-PLC
antibody was assessed by pre-incubation with an excess (50–100 µg/ml) of the corresponding immunogenic peptide. Peptide block data were analysed quantitatively using Image J software (http://rsb.info.nih.gov/ij/).
The localization of PLC
in relation to acrosomal status and the position of the nucleus was also determined by laser scanning confocal microscopy (Zeiss, Welwyn Garden City, UK) using HeNe (anti-PLC
antibody), Argon (FITC-PNA) and UV (Hoescht-33342) lasers at wavelengths of 543 nm, 488 nm and 364 nm, respectively. The distribution of PLC
in NC, C and IT samples was visualized under a fluorescence microscope (DM 5000B; Leica) and characteristic patterns of immunofluorescence classified and recorded. One hundred cells were assessed in duplicate (n = 200) and results were presented as mean% ± SEM for each characteristic pattern of PLC
distribution.
Statistics
Data are presented as mean ± SEM of the number of samples evaluated in each case. Analysis of variance was performed to compare the means of acrosome intact cells and PLC
distribution of NC, C and IT samples and Tukey's test applied to post hoc comparison. Correlations between the distribution of PLC
over the acrosomal region and the presence of an intact acrosome were determined using Pearson's correlation coefficient. Statistical analysis was carried out using GraphPad InStat software (San Diego, USA). A P-value of <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
Identification of presence of PLC
in human spermTo investigate the presence and pattern of localization of PLC
in human sperm, we generated a rabbit polyclonal antibody against two human PLC
immunogenic peptide sequences. After affinity purification, the specificity of the antibody was tested by immunoblotting. The antibody recognized a band of
100 kDa corresponding to the recombinant GST fusion human PLC
(Fig. 1A). We next used the antibody to investigate the presence of PLC
in human sperm. For this purpose, two kinds of samples were used, whole sperm and a soluble sperm extract. In both cases, a band of
74 kDa, the expected size for endogenous human PLC
, was detected (Fig. 1B). Other, more minor bands were observed, which may be break-down products of PLC
, or alternatively, unrelated proteins. In contrast, no immunoreactivity was found using pre-immune sera (Fig. 1C).
|
Pattern of localization of PLC
in uncapacitated human sperm and following capacitation and the acrosome reactionWe next used the affinity-purified anti-PLC
antibody to investigate the pattern of localization of PLC
in ejaculated uncapacitated human sperm and also in human sperm following in vitro induction of capacitation and the acrosome reaction. In these experiments, swim-up sperm samples were pooled from at least three donors. Analyses were carried out in three replicates. To obtain more information about the sub-cellular localization of PLC
, we additionally stained the sperm nucleus with Hoechst-33342 and the acrosome with FITC-PNA. Figure 2 shows representative images of each sample type. The analysis showed that in uncapacitated human sperm PLC
appears to be predominantly localized to the equatorial region (Fig. 2A–D). This pattern of localization persisted following capacitation (Fig. 2E–H) and in ionophore-treated (acrosome reacted) sperm (Fig. 2I–L). Further confirmation of this equatorial pattern of immunofluorescence was shown by the fact that in the ionophore-treated samples, the PLC
signal co-localized with the FITC-PNA staining within the equatorial segment (Fig. 2L). No immunofluorescence was obtained when samples were processed in the absence of the primary antibody (Fig. 2M–P). Moreover, we failed to detect significant immunofluorescence in the sperm head after the primary antibody had been pre-incubated with an excess of immunogenic peptide (Fig. 2Q and R). Image analysis clearly demonstrated that there was a highly significant (P < 0.0001) reduction in the fluorescent signal in sperm exposed to primary antibody that had been pre-incubated with peptide.
|
Variability in the pattern of PLC localization in human sperm
Although the predominant pattern of PLC
localization in pooled swim-up sperm samples appeared to be in the equatorial region, in some cases, PLC
was found to be localized to other regions of the sperm head, specifically in the acrosomal and post-acrosomal regions (Fig. 3A). In an attempt to quantify these differences, the different patterns of observed localization were grouped into four categories (AcEq, acrosomal and equatorial; Eq, equatorial alone; EqPa, equatorial and post-acrosomal and Pa, post-acrosomal alone), and the proportion of cells displaying each pattern of localization in NC, C and IT samples was assessed, as presented in Fig. 3B. Analysis showed that 88.4% of cells in NC samples displayed immunofluorescence in the equatorial region, 35.3% of spermatozoa showed PLC
also distributed over the acrosome, 21.4% showed an additional post-acrosomal localization and 11.6% exhibited only a post-acrosomal pattern of localization (Fig. 3B).
|
We also looked at what happens to these distribution patterns following capacitation and ionophore treatment in vitro. After capacitation, although the proportion of sperm showing an equatorial pattern of localization for PLC
remained roughly the same, an increase in PLC
distribution in the post-acrosomal region was observed concordant with a significant decrease in the percentage of cells exhibiting acrosomal PLC
(Fig. 3B). The increase in PLC
localization in the post-acrosomal region and corresponding decrease in the acrosomal region was even more pronounced in the IT samples, whereas the equatorial pattern of localization again remained unchanged (Fig. 3B). These changes may be linked to the observed reduction in the proportion of cells possessing an intact acrosome during both capacitation and the acrosome reaction. The proportion of cells possessing an intact acrosome was 70.6% in NC sperm but fell to 46.0% and 22.1% in C and IT sperm, respectively (Fig. 3C).
In an effort to examine these findings further, we repeated our analysis but instead of pooled sperm samples, used individual sperm samples provided by six normal healthy donors (Fig. 4). An important consideration here was that individual analysis would allow us to first assess whether the patterns of PLC
immunostaining observed in pooled samples were consistent with those in individual samples, but in addition, would allow us to compare the results both among different individuals and within a single ejaculate. If the analysis is to be utilized effectively in diagnostic studies of infertile men in the future, it is critical that we characterize the specific pattern of PLC
in normal healthy males. In NC sperm, it was clear that there was significant variability among the individual donor samples. The predominant pattern of PLC
immunostaining in these samples was in the equatorial region. This equatorial localization was sometimes seen in conjunction with further immunostaining in the acrosomal or post-acrosomal region. In two donors, the predominant PLC
immunopattern was in the equatorial/post-acrosomal region. The percentage of sperm exhibiting PLC
immunostaining in the acrosomal/equatorial, equatorial, equatorial/post-acrosomal, and post-acrosomal regions of NC sperm from individual donors was 25.0–40.6%, 15.3–46.2%, 21.5–48.3% and 0–15.7%, respectively (Fig. 4A). Despite observed variability in NC sperm, the observed trends in PLC
immunostaining among individual ejaculates remained remarkably consistent following capacitation and ionophore treatment with a pronounced increase in the proportion of PLC
immunostaining in the equatorial/post-acrosomal region (Fig. 4B–D). In C and IT samples, the percentage of sperm exhibiting PLC
immunostaining in the acrosomal/equatorial, equatorial, equatorial/post-acrosomal and post-acrosomal region was 5.6–21.9%, 11.9–42.5%, 25.2–54.6% and 5.9–28.4%, respectively (Fig. 4B–D). Analysis of the combined results from the six individual samples further confirmed that there was a clear reduction in PLC
immunofluorescence in the acrosomal region concurrent with increased immunofluorescence in the post-acrosomal area, following capacitation and ionophore treatment in vitro (Fig. 4D).
|
Interestingly, further statistical analysis revealed that there was a strong correlation (r = 0.716, P < 0.0001, n = 25) between the presence of an intact acrosome (confirmed by FITC-PNA staining) and the proportion of sperm exhibiting immunoreactivity to the PLC
antibody in the acrosomal region (Fig. 5). This provides direct quantitative data to support the potential involvement of PLC
in the acrosome reaction.
|
| Discussion |
|---|
|
|
|---|
The mechanism of oocyte activation at fertilization has been an unresolved issue in reproductive biology for many years (Parrington et al., 2007
, which appears to have the expected properties of the oocyte activation factor (Saunders et al., 2007
is the physiological agent of oocyte activation.
Here, we have focused on the pattern of localization of PLC
in human sperm. This is an important issue for two main reasons. First, identifying a pattern of localization for PLC
that is compatible with its putative role as an oocyte activation factor would provide further important confirmation of the physiological relevance of PLC
as a mediator of this key process. Second, identifying the pattern of localization of PLC
in sperm from normal fertile males will set a bench-mark against which sperm from infertile males can be compared, in order to see whether changes in the pattern of localization of PLC
accompany certain types of male human infertility. In addition, we have determined whether changes in the pattern of localization of PLC
in human sperm occur during capacitation and the acrosome reaction. Such an investigation is important, as one would expect that an oocyte activation factor would be retained during these key physiological processes, rather than being lost. Moreover, changes in the pattern of localization of PLC
during capacitation and the acrosome reaction might reveal clues as to how PLC
is activated or otherwise prepared for its role as an activator of the oocyte.
To date, our only knowledge concerning the localization of PLC
in sperm comes from animal studies (Fujimoto et al., 2004
; Yoon and Fissore, 2007
; Young et al., 2008
); there are no available data for human sperm. Fujimoto et al. (2007) first reported the identification of two populations of PLC
in mouse sperm: a predominant population in the post-acrosomal region but also a second minor, more peripheral population, located in the perinuclear matrix, close to the acrosome. These authors speculated that the peripheral population of PLC
might be responsible for oocyte activation, whereas the predominant post-acrosomal population possibly modulated pronuclear activity. Yoon and Fissore (2007)
later reported PLC
to be localized in the post-acrosomal region and equatorial segment, in mouse and bull sperm, respectively. Interestingly, the Yoon and Fissore (2007)
study also reported immunoreactivity in the acrosomal regions of sperm from both species but claimed this to be of non-specific origin. Most recently, a study from our own laboratory successfully detected PLC
in both acrosomal and post-acrosomal regions of mouse and hamster sperm (Young et al., 2008
). Peptide block experiments showed that the immunofluorescent signals detected in these two regions were indeed specific. We further showed that the post-acrosomal population becomes more evident after capacitation and that the acrosomal population, though present in >80% of uncapacitated sperm in these two species, disappeared following capacitation and ionophore treatment. We postulated that the acrosomal population of PLC
might have functional significance for the acrosome reaction, or some other physiological event other than oocyte activation, whereas the post-acrosomal population was linked to oocyte activation (Young et al., 2008
).
In the present study, using an affinity-purified polyclonal antibody generated against human PLC
, we show for the first time that in NC human sperm pooled from several healthy fertile donors, PLC
is predominantly found in the equatorial region of the sperm head (Fig. 2A–D), similar to the pattern identified by Yoon and Fissore (2007)
in bull sperm. This pattern of localization is highly significant since previous studies have shown that the equatorial segment remains intact following the acrosomal reaction, and underlies the domain of the sperm that fuses with the oocyte membrane during fertilization (Bedford et al., 1979
; Yanagimachi, 1994; Wolkowicz et al., 2003
). It is thus an ideal location for a putative oocyte activation factor that needs to be released into the oocyte as rapidly as possible following gamete fusion.
We next investigated what effect capacitation and ionophore treatment (an inducer of the acrosome reaction) have upon the pattern of localization of PLC
. Our findings both support the physiological relevance of PLC
for the process of oocyte activation but also reveal potential dynamic changes in the pattern of localization of this protein during these pre-fertilization events that may reveal important clues about PLC
s mechanism of action and mode of activation. Thus, on the one hand, we found that the predominant pattern of localization of PLC
in the equatorial region was maintained during both capacitation (Fig. 2E–H) and ionophore treatment (Fig. 2I–L). The fact that PLC
was not lost during ionophore treatment is further important confirmation of its physiological relevance as this is exactly what one would expect of an oocyte activation factor, which must necessarily be retained by the sperm beyond the acrosome reaction and up to the point of gamete fusion, at which stage it can be released into the oocyte. The co-localization of PLC
with FITC-PNA in IT sperm (Fig. 2L) further confirms the equatorial pattern of localization of this protein, as FITC-PNA is known to stain the equatorial segment in such sperm (Mortimer et al., 1987
). These findings mirror those reported recently by Young et al. (2008)
for the mouse and hamster.
However, more quantitative analysis of our findings showed that although the predominant pattern of localization of PLC
was in the equatorial region in NC human sperm, we also found evidence for subsidiary patterns of localization and considerable variability within a sample of sperm pooled from several donors (Fig. 3A and B). Thus, although the vast majority of NC sperm exhibit an equatorial pattern of localization for PLC
(88.4%), within this grouping, there are sperm that have only this pattern of localization (31.2%), but also those that have an equatorial combined with an acrosomal pattern of localization (35.3%), as well as those that have an equatorial combined with a post-acrosomal pattern of localization (21.4%). A small minority of sperm also appear to have a purely post-acrosomal pattern of localization (11.6%). The significance of these subsidiary patterns of PLC
localization remains to be ascertained. However, in a recent study in mice and hamsters, we have found evidence for a secondary, acrosomal location for PLC
as well as in the post-acrosomal region, leading us to suggest that in sperm from these species, PLC
may have additional functional roles besides that of agent of oocyte activation, for instance in the mediation of the acrosome reaction (Young et al., 2008
). In the present study, we also find evidence for an acrosomal pattern of localization in around one-third of NC human sperm (35.3%). Of more interest from the point of view of PLC
s putative role in oocyte activation is the location of the protein in the post-acrosomal region in one-third of NC sperm (32.9%), as one recent study has suggested that this is the most likely location for the mammalian oocyte activation factor, rather than the equatorial region (Sutovsky et al., 2003
).
Intriguingly, when we studied how these distribution patterns were affected by capacitation and ionophore treatment, although the proportion of sperm displaying the predominant equatorial location remained unchanged, these subsidiary patterns of localization showed some interesting changes. Thus, following these events, the proportion of sperm showing localization of PLC
to the acrosome decreased (from 35.3% to 7.9%), whereas those sperm with a post-acrosomal pattern of localization for PLC
increased (from 32.9% to 65.0%). We have reported similar dynamic change with mouse and hamster sperm (Young et al., 2008
). Our present findings were supported by our analysis of sperm samples provided by individual donors. As with the pooled samples, it was clear that there was significant variability in uncapacitated sperm when compared among the individual donor samples. As seen in our earlier experiments, the predominant pattern of PLC
immunostaining in these samples was in the equatorial region but with some subsidiary staining in other areas. The predominant immunopatterns in NC sperm from individual donors was in the equatorial region with or without an acrosomal population, though two donors exhibited significant immunostaining in the equatorial/post-acrosomal region (Fig. 4A). Despite observed variability in NC sperm, in which only one-third of sperm exhibited PLC
in the acrosomal region, the observed trends in PLC
immunostaining between individual ejaculates remained remarkably consistent following capacitation and ionophore treatment with a pronounced increase in the proportion of PLC
immunostaining in the equatorial/post-acrosomal region (Fig. 4B and C). That only one-third of NC human sperm exhibit PLC
in the acrosomal region, compared with 88% and 80% of mouse and hamster sperm, respectively, is of great interest and clearly requires future study. It is possible that these observations may be related to differing levels of fertilizing ability among sperm samples and is thus of great clinical importance.
Interestingly, further statistical analysis of samples from individual donors revealed a strong statistical correlation between the presence of an intact acrosome and the proportion of sperm exhibiting PLC
immunofluorescence in this region. These quantitative data support the potential involvement of PLC
in the acrosome reaction, or at least suggest that PLC
might play a role in mediating other processes in the sperm besides oocyte activation.
It would be of great interest in future studies to investigate whether these changes are accompanied by changes to the post-translational state of the PLC
protein. What would also be interesting to determine is whether the changes in the distribution of PLC
in human sperm during capacitation and the acrosome reaction are linked to the activation of the protein in preparation for its role in oocyte activation, and what they can tell us about other potential functional roles of PLC
in the sperm.
Another possible interpretation of the variability that we observe in the pattern of localization of PLC
in samples of ejaculated (NC) sperm, analysed by either pooling sperm from several normal fertile donors or by analysing samples from individual donors, is that a proportion of such sperm do not have PLC
localized in an optimum position within the sperm head for its role as an oocyte activation factor. Such variability could reflect important differences between sperm, even when obtained from normal, fertile males, in their ability to activate the oocyte.
What will be of great interest in the future is to study the patterns of localization of PLC
in sperm from infertile human males. It would, for instance, be interesting to use an immunobased approach, such as the one described here, to study whether those infertile males whose sperm fail to activate the oocyte following ICSI (see above) have an absence of expression of the protein in their sperm, or alternatively an erroneous pattern of localization of PLC
. In addition, the absence of PLC
expression, or its erroneous patterning, might be useful as a diagnostic tool to indicate/investigate sperm dysfunction. Studies of this type will be important both for confirming the status of PLC
as the physiological agent of oocyte activation in mammals, and also to help provide a mechanistic explanation for certain types of human male infertility, thus opening up the prospects of improved treatment for such types of infertility in the future.
| Funding |
|---|
|
|
|---|
This study was supported by a Medical Research Council (MRC) Non-Clinical Senior Fellowship and MRC project grant awarded to John Parrington.
| Acknowledgements |
|---|
|
|
|---|
The authors would like to thank Professor Antony Galione, Dr Anthony Morgan and Dr Lianne Davis (Department of Pharmacology, University of Oxford) for their help and advice concerning confocal microscopy and use of their microscope. The authors would also like to thank Victoria Crossland, Teresa Tsakok and Ruth Wood (University of Oxford) for assistance with the antibody studies.
| Footnotes |
|---|
These authors contributed equally. | References |
|---|
|
|
|---|
Alvarez JG, Lasso JL, Blasco L, Nunez RC, Heyner S, Caballero PP, Storey BT. Centrifugation of human spermatozoa induces sublethal damage; separation of human spermatozoa from seminal plasma by a dextran swim-up procedure without centrifugation extends their motile lifetime. Hum Reprod (1993) 8:1087–1092.
Araki Y, Yoshizawa M, Abe H, Murase Y, Araki Y. Use of mouse oocytes to evaluate the ability of human sperm to activate oocytes after failure of activation by intracytoplasmic sperm injection. Zygote (2004) 12:111–116.[CrossRef][Web of Science][Medline]
Bedford JM, Moore HD, Franklin LE. Significance of the equatorial segment of the acrosome of the spermatozoon in eutherian mammals. Exp Cell Res (1979) 119:119–126.[CrossRef][Web of Science][Medline]
Boivin J, Bunting L, Collins JA, Nygren KG. International estimates of infertility prevalence and treatment-seeking: potential need and demand for infertility medical care. Hum Reprod (2007) 22:1506–1512.
Coward K, Ponting CP, Chang HY, Hibbitt O, Savolainen P, Jones KT, Parrington J. Phospholipase Czeta, the trigger of egg activation in mammals, is present in a non-mammalian species. Reproduction (2005) 130:157–163.
Cox LJ, Larman MG, Saunders CM, Hashimoto K, Swann K, Lai FA. Sperm phospholipase Czeta from humans and cynomolgus monkeys triggers Ca2+ oscillations, activation and development of mouse oocytes. Reproduction (2002) 124:611–623.[Abstract]
Ebner T, Moser M, Sommergruber M, Jesacher K, Tews G. Complete oocyte activation failure after ICSI can be overcome by a modified injection technique. Hum Reprod (2004) 19:1837–1841.
Eldar-Geva T, Brooks B, Margalioth EJ, Zylber-Haran E, Gal M, Silber SJ. Successful pregnancy and delivery after calcium ionophore oocyte activation in a normozoospermic patient with previous repeated failed fertilization after intracytoplasmic sperm injection. Fertil Steril (2003) 79(Suppl 3):1656–1658.[CrossRef][Web of Science][Medline]
Flaherty SP, Payne D, Swann NJ, Matthews CD. Aetiology of failed and abnormal fertilization after intracytoplasmic sperm injection. Hum Reprod (1995) 10:2623–2629.
Fujimoto S, Yoshida N, Fukui T, Amanai M, Isobe T, Itagaki C, Izumi T, Perry AC. Mammalian phospholipase C
induces oocyte activation from the sperm perinuclear matrix. Dev Biol (2004) 274:370–383.[CrossRef][Web of Science][Medline]
Gearon CM, Mortimer D, Chapman MG, Forman RG. Artificial induction of the acrosome reaction in human spermatozoa. Hum Reprod (1994) 9:77–82.
Heindryckx B, Van der Elst J, De Sutter P, Dhont M. Treatment option for sperm- or oocyte-related fertilization failure: assisted oocyte activation following diagnostic heterologous ICSI. Hum Reprod (2005) 20:2237–2241.
Ito M, Shikano T, Oda S, Horiguchi T, Tanimoto S, Awaji T, Mitani H, Miyazaki S. Difference in Ca2+ oscillation-inducing activity and nuclear translocation ability of PLCZ1, an egg-activating sperm factor candidate, between mouse, rat, human and medaka fish. Biol Reprod (2008) 78:1081–1090.
Jones KT. Mammalian egg activation: from Ca2+ spiking to cell cycle progression. Reproduction (2005) 130:813–823.
Knott JG, Kurokawa M, Fissore RA, Schultz RM, Williams CJ. Transgenic RNA interference reveals role for mouse sperm phospholipase Czeta in triggering Ca2+ oscillations during fertilization. Biol Reprod (2005) 72:992–996.
Kouchi Z, Fukami K, Shikano T, Oda S, Nakamura Y, Takenawa T, Miyazaki S. Recombinant phospholipase Czeta has high Ca2+ sensitivity and induces Ca2+ oscillations in mouse eggs. J Biol Chem (2004) 279:10408–10412.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (1970) 227:680–685.[CrossRef][Web of Science][Medline]
Larman MG, Saunders CM, Carroll J, Lai FA, Swann K. Cell cycle-dependent Ca2+ oscillations in mouse embryos are regulated by nuclear targeting of PLCzeta. J Cell Sci (2004) 117:2513–2521.
Mahutte NG, Arici A. Failed fertilization: is it predictable? Curr Opin Obstet Gynecol (2003) 15:211–218.[CrossRef][Web of Science][Medline]
Miyazaki S, Shirakawa H, Nakada K, Honda Y. Essential role of the inositol 1,4,5-trisphosphate receptor/Ca2+ release channel in Ca2+ waves and Ca2+ oscillations at fertilization of mammalian eggs. Dev Biol (1993) 158:62–78.[CrossRef][Web of Science][Medline]
Moaz MN, Khattab S, Foutouh IA, Mohsen EA. Chemical activation of oocytes in different types of sperm abnormalities in cases of low or failed fertilization after ICSI: a prospective pilot study. Reprod Biomed Online (2006) 13:791–794.[Web of Science][Medline]
Morozumi K, Shikano T, Miyazaki S, Yanagimachi R. Simultaneous removal of sperm plasma membrane and acrosome before intracytoplasmic sperm injection improves oocyte activation/embryonic development. Proc Natl Acad Sci USA (2006) 103:17661–17666.
Mortimer D, Curtis EF, Miller RG. Specific labelling by peanut agglutinin of the outer acrosomal membrane of the human spermatozoon. J Reprod Fertil (1987) 81:127–135.
Mortimer D, Curtis EF, Camenzind AR, Tanaka S. The spontaneous acrosome reaction of human spermatozoa incubated in vitro. Hum Reprod (1989) 4:57–62.
Moseley FL, Jha KN, Bjorndahl L, Brewis IA, Publicover SJ, Barratt CL, Lefievre L. Protein tyrosine phosphorylation, hyperactivation and progesterone-induced acrosome reaction are enhanced in IVF media: an effect that is not associated with an increase in protein kinase A activation. Mol Hum Reprod (2005) 11:523–529.
Murase Y, Araki Y, Mizuno S, Kawaguchi C, Naito M, Yoshizawa M, Araki Y. Pregnancy following chemical activation of oocytes in a couple with repeated failure of fertilization using ICSI: case report. Hum Reprod (2004) 19:1604–1607.
Parrington J, Davis LC, Galione A, Wessel G. Flipping the switch: How a sperm activates the egg at fertilization. Dev Dyn (2007) 236:2027–2038.[CrossRef][Web of Science][Medline]
Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, Swann K, Lai FA. PLC zeta: a sperm-specific trigger of Ca(2+) oscillations in eggs and embryo development. Development (2002) 129:3533–3544.
Saunders CM, Swann K, Lai FA. PLCzeta, a sperm-specific PLC and its potential role in fertilization. Biochem Soc Symp (2007) 74:23–36.[CrossRef][Web of Science][Medline]
Sousa M, Tesarik J. Ultrastructural analysis of fertilization failure after intracytoplasmic sperm injection. Hum Reprod (1994) 9:2374–2380.
Stricker SA. Comparative biology of calcium signaling during fertilization and egg activation in animals. Dev Biol (1999) 211:157–176.[CrossRef][Web of Science][Medline]
Sutovsky P, Manandhar G, Wu A, Oko R. Interactions of sperm perinuclear theca with the oocyte: implications for oocyte activation, anti-polyspermy defense, and assisted reproduction. Microsc Res Tech (2003) 61:362–378.[CrossRef][Web of Science][Medline]
Swann K, Saunders CM, Rogers NT, Lai FA. PLCzeta(zeta): a sperm protein that triggers Ca2+ oscillations and egg activation in mammals. Semin Cell Dev Biol (2006) 17:264–273.[CrossRef][Web of Science][Medline]
Whitaker M. Calcium at fertilization and in early development. Physiol Rev (2006) 86:25–88.
WHO, World Health Organization. WHO laboratory manual for the examination of human semen and sperm-cervical mucus interactions. (1999) Cambridge: Cambridge University Press.
Wolkowicz MJ, Shetty J, Westbrook A, Klotz K, Jayes F, Mandal A, Flickinger CJ, Herr JC. Equatorial segment protein defines a discrete acrosomal subcompartment persisting throughout acrosomal biogenesis. Biol Reprod (2003) 69:735–745.
Yanagimachi R. Mammalian fertilization. In: In the Physiology of Reproduction—Knobil E, Neil JD, eds. (1994) New York: Raven Press. 189–317.
Yoda A, Oda S, Shikano T, Kouchi Z, Awaji T, Shirakawa H, Kinoshita K, Miyazaki S. Ca2+ oscillation-inducing phospholipase C zeta expressed in mouse eggs is accumulated to the pronucleus during egg activation. Dev Biol (2004) 268:245–257.[CrossRef][Web of Science][Medline]
Yoneda A, Kashima M, Yoshida S, Terada K, Nakagawa S, Sakamoto A, Hayakawa K, Suzuki K, Ueda J, Watanabe T. Molecular cloning, testicular postnatal expression, and oocyte-activating potential of porcine phospholipase Czeta. Reproduction (2006) 132:393–401.
Yoon SY, Fissore RA. Release of phospholipase C zeta and [Ca2+]I oscillation inducing activity during mammalian fertilization. Reproduction (2007) 134:695–704.
Young C, Grasa P, Coward K, Davis LC, Parrington J. Phospholipase C zeta undergoes dynamic changes in its pattern of localization in sperm during capacitation and the acrosome reaction. Fertil Steril (2008) (in press).
Submitted on March 7, 2008; resubmitted on June 18, 2008; accepted on June 24, 2008.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
E. Heytens, J. Parrington, K. Coward, C. Young, S. Lambrecht, S.-Y. Yoon, R.A. Fissore, R. Hamer, C.M. Deane, M. Ruas, et al. Reduced amounts and abnormal forms of phospholipase C zeta (PLC{zeta}) in spermatozoa from infertile men Hum. Reprod., October 1, 2009; 24(10): 2417 - 2428. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





